Journal of Life Sciences Volume 7 Number (1)

(1)

Journal of Life Sciences

Volume 7, Number 4, April 2013 (Serial Number 60)

David Publishing Company www.davidpublishing.com

(2)

Publication Information

Journal of Life Sciences is published monthly in hard copy (ISSN 1934-7391) and online (ISSN 1934-7405) by David Publishing Company located at 9460 TELSTAR AVE SUITE 5, EL MONTE, CA 91731, USA.

Aims and Scope

Journal of Life Sciences, a monthly professional academic journal, covers all sorts of researches on molecular biology, microbiology, botany, zoology, genetics, bioengineering, ecology, cytology, biochemistry, and biophysics, as well as other issues related to life sciences.

Editorial Board Members

Dr. Stefan Hershberger (USA), Dr. Suiyun Chen (China), Dr. Farzana Perveen (Pakistan), Dr. Francisco Torrens (Spain), Dr. Filipa João (Portugal), Dr. Masahiro Yoshida (Japan), Dr. Reyhan Erdogan (Turkey), Dr. Grzegorz Żurek (Poland), Dr. Ali Izadpanah (Canada), Dr. Barbara Wiewióra (Poland), Dr. Valery Lyubimov (Russia), Dr. Amanda de Moraes Narcizo (Brasil), Dr. Marinus Frederik Willem te Pas (The Netherlands), Dr. Anthony Luke Byrne (Australia), Dr. Xingjun Li (China), Dr. Stefania Staibano (Italy), Dr. Wenle Xia (USA), Hamed Khalilvandi-Behroozyar (Iran).

Manuscripts and correspondence are invited for publication. You can submit your papers via Web Submission, or E-mail to [email protected] or [email protected]. Submission guidelines and Web Submission system are available at http://www.davidpublishing.com.

Editorial Office

9460 TELSTAR AVE SUITE 5, EL MONTE, CA 91731, USA Tel: 1-323-9847526, Fax: 1-323-9847374

E-mail:[email protected], [email protected]

Copyright©2013 by David Publishing Company and individual contributors. All rights reserved. David Publishing Company holds the exclusive copyright of all the contents of this journal. In accordance with the international convention, no part of this journal may be reproduced or transmitted by any media or publishing organs (including various websites) without the written permission of the copyright holder. Otherwise, any conduct would be considered as the violation of the copyright. The contents of this journal are available for any citation. However, all the citations should be clearly indicated with the title of this journal, serial number and the name of the author.

Abstracted / Indexed in

Database of EBSCO, Massachusetts, USA Chemical Abstracts Service (CAS), USA Cambridge Scientific Abstracts (CSA), USA

Chinese Database of CEPS, American Federal Computer Library center (OCLC), USA Ulrich’s Periodicals Directory, USA

Chinese Scientific Journals Database, VIP Corporation, Chongqing, China Universe Digital Library S/B, Proquest

Subscription Information

Price (per year): Print $520, Online $360, Print and Online $680.

David Publishing Company

9460 TELSTAR AVE SUITE 5, EL MONTE, CA 91731, USA Tel: 1-323-9847526, 323-410-1082; Fax: 1-323-9847374 E-mail: [email protected]

David Publishing Company www.davidpublishing.com

DAV ID P UBL ISH IN G

(3)

J LS

Journal of Life Sciences

Volume 7, Number 4, April 2013 (Serial Number 60)

Molecular Biology and Bioinformatics

333 Cloning of ACC Oxidase (ACO) Gene from Dendrobium officinale

Ke Xu, Yi Tang, Jia Lai, Ze-Sheng Yan, Qian Luo and Huan-Xiu Li

341 Genetic Association Study of KCNB1 Gene with the Susceptibility of Hypertension Related LVH (Left Ventricular Hypertrophy) Patients in Malaysia

Julia Ashazila Mat Jusoh, Norlaila Danuri, Fadhlina Abdul Majid, Hoh Boon Peng and Khalid Yusoff

348 Charaterization of Citrus Hybrid “Huangguogan” through the Combination of Morphological and Molecular Markers

Xue-Fei Wang, Xi-Rui Xiong, Xue-Li Pu, Qiao-Qiao Yan, Bo Xiong, Feng-Ling Liao, Qian-Qian Fan

and Zhi-Hui Wang

353 A Test for Stabilization of an Oligomeric Protein by Introduction of Aromatic Residues into the Interface

Yuho Mano, Ayako Shiota, Kotaro Hara, Azumi Hirata, Masayuki Oda and Kazufumi Takano

358 Automated Classification of Segmented Cancerous Cells in Multispectral Images

Alaa Hilal, Jamal Charara, Ali Al Houseini, Walid Hassan and Mohamad Nassreddine

363 Biphasic Response of Mouse Ileal Smooth Muscles to Aspirin in a Dose Response Manner

Ismail Salih Kakey and Sundus Majeed Hamza

370 The Effect of Mercury on Lipid Peroxidation and Its Relation with Vitamin (A, E) and Essential Elements in Dentals Serum

Jaffer Hashim Mohsen, Hanan Fadel Abbas and Kasim Kadhim Alasedi

Microbiology and Biological Engineering

377 Production of Aflatoxins from Aspergillus flavus in Liquid Medium

(4)

382 Numerical Classification of Brevibacterium and Related Genera Using Linocin M18 Bacteriocin

Essra Gh. Al-Sammak

390 Incidence of Coagulase Positive Staphylococcus aureus in Raw Cow Milk Produced by Cattle

Farms in Fieri Region in Albania

Kapllan Sulaj, Jorida Terpollari, Renata Kongoli, Kastriot Korro, Sokol Duro, Fejzo Selami, Ilirian Kumbe and Bejo Bizhga

Botany and Zoology

395 Artificial Pollination and Seed Germination of Dendrobium candidum Wall. ex Lindl

Ke Xu, Yi Tang, Jia Lai, Ze-Sheng Yan, Qian Luo and Huan-Xiu Li

400 The Quality of Sour Cherry Maidens Fertilized with Various Biopreparations in an Organic

Nursery

Zygmunt Stanisław Grzyb, Wojciech Piotrowski, Lidia Sas Paszt and Paweł Bielicki

410 Note on the Orchids of the Moutas Hunting Reserve—Tlemcen (Western Algeria)

Brahim Babali, Abderrahmane Hasnaoui and Mohammed Bouazza

416 Study of Camelina Biodiversity in Southwestern of Algeria

Cherifi Youcef Amine, Gaouar Souheil Bachir Samir, Moussi Nasreddine, Tabet Aoul Nacera and

Saïdi-Mehtar Nadhira

428 Antioxidant Properties, Polyphenol Content and Colorimetric Characteristics of Different Floral Origin Honeys from Different Areas of Southern Italy

Annamaria Perna, Amalia Simonetti, Immacolata Intaglietta and Emilio Gambacorta

437 Investigation of Biochemical Properties and Fractional Composition of Amaranth Oil

(5)

Apr. 2013, Vol. 7, No. 4, pp. 333-340

Journal of Life Sciences, ISSN 1934-7391, USA

Cloning of ACC Oxidase (ACO) Gene from

Dendrobium

officinale

Ke Xu, Yi Tang, Jia Lai, Ze-Sheng Yan, Qian Luo and Huan-Xiu Li

College of Horticulture, Sichuan Agricultural University, Ya’An 62504, Sichuan, China

Received: April 2, 2013 / Accepted: April 17, 2013 / Published: April 30, 2013.

Abstract: Many studies suggest that ethylene plays an important role in regulating metabolite synthesis. Dendrobium plants are traditional Chinese medicine and nowadays its medicinal components are known to be secondary metabolites. In present study, a homolog of ACC oxidase (ACO) gene was isolated from flowers of Dendrobium officinale Kimura et Migo by PCR-method. The obtained cDNA of DoACO is 970 bp long and contains an open reading frame (ORF) encoding a protein with 314 amino acid residues. The DoACO shows high identity to its homologues from other plant species, that has 94.8% closest amino acid sequence of related protein with the ACO from Dendrobium hybrid cultivar. The putative ORF of the obtained sequence could encode a proper protein in respect of molecular weight under T7Lac promoter in E. coli.

Key words: Dendrobium officinale, ACC oxidase gene, gene clone, recombinant protein, heterologous expression.

1. Introduction



Dendrobium plants are important ornamental and medicine plants. There are 74 Dendrobium species reported in China and among them D. officinale, D. chrysanthum, D. fimbriatum, D. loddigesii and D.

nobile are listed in the Chinese Phrmacopoeia [1, 2].

Dendrobium officinale Kimura et Migo is the orchid

Dendrobium perennial herbaceous plants [3].

Dendrobium has been known for its amazing curative effects, such as enhancing the body immunity, reducing blood sugar level and clearing away toxic materials accumulated in human body [4-7]. The medicinal components of Dendrobium have been identified to be alkaloid [8, 9]. As early as 1932, Suzuki [10] reported that alkaloid from Dendrobium

was the major alkaloid of the Chinese herbal medicine. The total content of alkaloids is rather low in

Dendrobium plants and it is only approximately 0.02% despite its determinant of Dendrobium curative

Corresponding author: Huan-Xiu Li, professor, research fields: application of biological technology in horticulture plant. E-mail: [email protected].

effects [11]. Therefore, it is extremely important to improve the alkaloids contents.

Ethylene can induce enzyme involved in metabolite biosynthesis such as phenylalanine ammonia-lyase (PAL), peroxidase, polyphenol oxidase and chitinase [12-15]. Among these enzymes, PAL plays an especially role in phenylpropanoids synthesis since it is positioned at the first step of phenylpropanoid pathway and controls the metabolite flux into this secondary pathway [16, 17]. Some researchers reported a significant correlation between Dendrobium’s alkaloids content and PAL activity, indicating PAL is the key factor for the synthesis of Dendrobium alkaloids [18-21]. In the process of plant growth and development, PAL can be accumulated along with endogenous ethylene synthesis [22]. Rickey [23], Chen [24], Wang [25], and Liu [26] provided evidences that ethylene is likely to be the endogenous signal molecules which was able to inducePAL expression.

(6)

Cloning of ACC Oxidase (ACO) Gene from Dendrobium officinale 334

ACC converts to ethylene [27]. It is proposed that ACO controls ethylene synthesis rate [28]. ACO gene has been isolated and characterized in various plant species like Wheat, Cabbage, etc.. These studies show that ACO are highly conserved among higher plants in amino acid sequence and usually several ACO genes constitute a small gene family in each plant species [29]. The expression pattern of ACO in Dendrobium has not yet been well revealed. In flower organs, Ketsa [30] found ethylene yield increased significantly 9 h after the Dendrobium pollination. This is quite agreement with the profiles of ethylene synthesis during flower development in many plant species [31, 32].

Recently, many studies of Dendrobium concentrate on its micropropagation via tissue culture. Quite a few studies are about the biosynthesis of medicinal metabolites. In present study, we isolated the cDNA of ACO from Dendrobium officinale. This lays the foundation to study the ethylene biosynthesis and has an implication to improve the alkaloids content in the future.

2. Materials and Methods

2.1 Plant Materials

Dendrobium officinale Kimura et Migo was used in this study, this plant material was collected from Yunnan province and cultured in incubator.

2.2 RNA Extraction

Flower petals of 9 h after pollination were collected and used to RNA extraction. The RNA extraction is done by CTAB method described by Liu [33].

2.3 Gene Fragment Isolation

First strand cDNA was synthesized using Super Script III reverse transcriptase (Formentas) and poly T-adaptor primer. Specific primers were designed based on the conserved region among ACO from

Dianthus caryophyllus, Cattleya hybrida, Paeonia suffruticosa and Lilium brownii. The primers are 5′-GCAGAAGCTTCCC TGTGA-TTAA-3′ (P1) and

5′-TCAAGCAGTAGGAATCGGCTGA-3′ (P2). A 50

L PCR mixture consists of Taq DNA Polymerase (5 U/L), 5 L 10×LA PCR buffer, 8 L dNTP (2.5 mM), 1 L upstream primer, 1 L downstream primer (10 M) and 1 L reverse transcription product. The reaction condition is as following: 35 cycles of 1-min denaturation (94 °C), 1 min annealing (56 °C), and 1 min extension (72 °C); a final extension was conducted at 72 °C for 5 min.

PCR products were segregated by 1% agarose gel. The target single band was cut and subsequently to be recovered by using DNA Gel Extraction Kit (Takara). The recovered fragments were then inserted into pMD19-T vector and the plasmid DNA was extracted by using a plasmid Miniprep kit (Takara) and then sent to the Invitrogen Trading Co., Ltd. for sequencing.

2.4 Sequence Analysis

A Blast search (NCBI) was completed to identify genes showing a high identity of amino acid sequence (Table 1). Multiple alignment analysis was done using MEGA 4.0 software and the phylogenetic tree was made.

2.5 Construction of the Expression Vector

To construct the expression vector of DoACO, primers P3 (CCCATATGATGGA-GCTTCTTG AGGGTT) and P4 (CCCAAGCTTTCAAGCAGTAG GAATCGG) were designed that carried Nde I and

Hind III site respectively and amplified the putative ORF of DoACO. The PCR-amplified fragment inserted into pMD19-T and the recombinant plasmids were transformed into E. coli DH5α competent cells.

For extracting pMD19-T-ACC and pET-28a (+) plasmids, double digest with restriction enzyme

(7)

Table 1 Reference plants sequence information.

No. Name of the plant Place of origin Genbank accession

1 Dendrobium hybrid cultivar Thailand EF487342

2 Dendrobium cv. 'Sonia' Thailand EF061081

3 Dendrobium hybrid cultivar Sonia 'Earsakul' Thailand HQ186252

4 Dendrobium hybrid cultivar Thailand EU151724

5 Dendrobium hybrid cultivar Anna Thailand GQ332400

6 Dendrobium crumenatum Singapore AF038840

7 Cattleya bicolor Taiwan AY598793

8 Cattleya intermedia Taiwan AY598794

9 Laelia anceps Taiwan AY598795

10 Cymbidium hybrid cultivar Japan AB257311

11 Phalaenopsis sp. 'True Lady' Taiwan AF004662

12 X Doritaenopsis sp. Unkown DORACCOXID

13 X Sophrolaeliocattleya 'Love Castle' China EU363762

14 X Brassolaeliocattleya 'Sung Ya Green' China EU363763

15 x Doritaenopsis sp. Unkown DORCAROXI

16 Papilionanthe hookeriana x Papilionanthe teres Thailand GQ140315

17 Oncidium hybrid cultivar Kutoo China JN997419

18 Vitis vinifera clone SS0AFA20YK24 France FQ394455

19 Cucumis sativus Israel AF033582

20 Musa acuminata Singapore AF081917

21 Lilium hybrid cultivar Polyanna China EU296623

22 Manihot esculenta U.K. EF035079

23 Hevea brasiliensis France AM743172

24 Siraitia grosvenorii China HQ141614

25 Elaeis guineensis putative Thailand JN203256

mixtures were transformed into E. coli DH5α. Individual colonies were picked from plate, and inoculated into 3 mL LB liquid medium which containing Amp (100 g/mL) at 37 °C for 12-16 h shaking cultivation. The plasmids were extracted and identified by enzyme cut assay with Hind Ⅲ and

NdeⅠ.

2.6 Heterologous Expression Analysis

The pET-28a-ACC plasmid was transformed into BL21 (DE3) cells and then cultured the cells on LB plate at 4 °C overnight. Positive colony was identified by PCR method and then was used to inoculate liquid LB medium containing Amp (100 g/mL). Then the

E. coli culture was used to inoculate fresh liquid LB medium with the ratio of 1:100. When the cell concentration reached 0.4-0.6 (OD600), IPTG was

added to a final concentration of 1 mmol/L for

induction at 37 °C for 4 h. The different concentration of IPTG (0, 0.2, 0.4, 0.6, 0.8, 1.0 and 1.2 mmol·L-1) were studied in protein expression. The null vector and pET-28a-ACC without IPTG-induction was used as control. The induction time was set for 0 h, 1 h, 2 h, 3 h, 4 h and 5 h. All the treatments were examined by SDS-PAGE protein electrophoresis.

3. Results

3.1 Sequence Analysis

(8)

nucleotide sequence compared with the relevant fragments of 25 plants, during which there was 98.9% identity between Dendrobium cv “sonic” and D. hybrid cultivar, there was 94.8% identity between JX679494 (D. officinale) and D. hybrid cultivar (GeneBank: EF487342). A phylogenetic tree, drawn by using truncated nucleotide sequences, showed that

DoACO formed a cluster with those from Orchidaceae plants (Fig.1).

3.2 Heterologous Expression of DoACO in E. coli Cells

In the construction of the expression vector, primers P3 and P4 amplify a fragment of 970 bp as shown in Fig. 2. After digesting T-clone with EcoRⅠ and

XhoⅠ, a fragment of the same length was resulted in, which indicated that the PCR-amplified DoACO has been linked to the empty vector in a right way. The recombinant plasmids pET-28a-ACO was identified by restriction enzyme cleaving with NdeⅠ and Hind

Ⅲ. Two fragments in length of approximately 5,900 bp and 970 bp were obtained (Fig. 3), which indicates that the ACO gene has been successfully cloned in the expression vector.

The constructed pET-28a-ACC was transformed into E. coli BL21 (DE3). After induction with IPTG for 4 h, the products were analyzed by SDS-PAGE. A specific protein band with a molecular weight of about 55 kDa was presented and that was in line with expectation (Figs. 4-6). The authors tested the expression level of DoACO in different IPTG concentration in E. coli, the highest expression level occurred 4 h after IPTG-induction when the IPTG concentration was 0.4 mmol/L.

4. Discussion

This is the first report about cloning the ACO gene from Dendrobium officinale Kimura et Migo. We successfully constructed the prokaryotic expression vector, and then optimized the protein expression

(9)

5.Dendrobium_hybrid_cultivar_Anna.seq

3.Dendrobium_hybrid_cultivar_Sonia_Earsakul.seq

4.Dendrobium_hybrid_cultivar.seq

2.Dendrobium_cv._Sonia.seq

1.Dendrobium_hybrid_cultivar.seq

JX679494.seq

6.Dendrobium_crumenatum.seq

9.Laelia_anceps.seq

8.Cattleya_intermedia.seq

7.Cattleya_bicolor.seq

14.X_Brassolaeliocattleya_Sung_Ya_Green.seq

13.X_Sophrolaeliocattleya_Love_Castle.seq

16.Papilionanthe_hookeriana_x_Papilionanthe_teres.seq

12.X_Doritaenopsis_sp..seq

15.Doritaenopsis_sp..seq

11.Phalaenopsis_sp._True_Lady.seq

10.Cymbidium_hybrid_cultivar.seq

17.Oncidium_hybrid_cultivar_Kutoo.seq

25.Elaeis_guineensis_putative.seq

20.Musa_acuminata.seq

21.Lilium_hybrid_cultivar_Polyanna.seq

19.Cucumis_sativus.seq

24.Siraitia_grosvenorii.seq

18.Vitis_vinifera_clone_SS0AFA20YK24.seq

23.Hevea_brasiliensis.seq

22.Manihot_esculenta.seq

0.05

Fig. 1 Phylogenetic tree of ACO gene.

Fig. 2 Electrophoregram of PCR products of ACO gene. 1: Result of PCR amplification of expressed gene; 2: Result of restriction enzyme after T clone.

factors, all of which would play a fundamental role in the future’s research about the expression of the ACO gene and production of the ethylene in Dendrobium officinale.

(10)

Fig. 3 The electrophoresis map of enzyme cleave of recombinant expression plasmids pET-28a-ACC.

Fig. 4 SDS-PAGE identification of the expression products of recombined protein.

1: Uninduced recombinant protein; 2: Induced recombinant protein; 3: Uninduced empty vector; 4: Induced empty vector.

Fig. 5 Effect of the concentration of IPTG on protein expression.

1-7: Concentration of IPTG was 0, 0.2, 0.4, 0.6, 0.8, 1.0 and 1.2 mmol·L-1.

coming from the Colletotrichum lindemuthianum to react with the leaves of Phaseolus vulgaris L., ACC and the ethylene will soon be synthesized. Because of the ACC and the ethylene, PAL will not be suppressed by AVG (Aminoethoxyvinylglycine), which has the ability to make PAL suppression.

Fig. 6 Effect of the induction time on protein expression. 1-6: Induction time was 0, 1, 2, 3, 4, 5 h.

Many factors affect the exogenous gene expression efficiency when using the E. coli. For instance, the varieties of E. coli strains, density of inducer, inducing temperature and the inducing time are all playing significant role in the gene expression [40]. In this study, BL21/pET-28a (+) were selected to express the exogenous gene. Firstly, BL21 is an E. coli strain which has an advantage that the gene expression products will not be degraded by the OmpT (outer membrane protein), for BL21 is lack of the protein. Secondly, pET-28a (+) is a reliable vector which is usually used to express the exogenous gene. And the vector owns the MCS (Multiple Cloning Site), making the exogenous gene easier to insert in. Additionally, the T7Lac promoter of the vector has a notable

characteristic that the up-stream Lacl gene is able to encode enough Lac repressor which will block the producing of T7RNA polymerase and then decrease

transcription of the exogenous gene. This characteristic makes the basic transcription level be the lowest, and that will finally conduce to the stability of the recombinant vector [41] What’s more, IPTG induces the expression of the TTRNA polymerase which will promote T7Lac promoter to

transcript and translate the exogenous gene [42]. Moreover, the inducing density and time of using IPTG which could affect the expression of the exogenous gene has been studied.

(11)

On account of the negative effect to the E. coli caused by IPTG, 0.8 mmol·L-1 would perfectly induce the expression. Then the inducing time has been designed from 1 h to 5 h. From 1 h to 4 h, as time went by, the expression products had increased rapidly. However, from 4 h to 5 h, the products remained steady, without any significant changes. Notwithstanding that BL21 (DE3) is an E. coli strain lacking of the OmpT (outer membrane protein), the increasing expression products may also be degraded by other proteases in the E. coli.

So the inducing time was controlled 4 h after adding the IPTG to express the exogenous gene.

Acknowledgments

This work was supported by Sichuan Agricultural University “Shuang-Zhi Plan”.

References

[1] L. Bill, H. Wayne, S. Geoff, Dendrobium and Its Relatives, Timber Press, Oregan, 2002.

[2] C.J. Bulpitt, Y. Li, J.G. Wang, The use of orchids in Chinese medicine, J. Roy. Soc. Med. 100 (2007) 558-563.

[3] Flora of China Editorial Committee of Chinese Academy of Sciences, Flora of China, Science Press, Beijing, 1999, p. 19.

[4] X.P. Cheng, Y.P. Zhang, X.R. Zhu, X. Zheng, Y. Zhu, X.K. Xue, et al., Clinical study on effects of Tiepi Fengdou granule capsule combined with chemotherapy and mor radiotherapy in treating lung cancer with Qi-Yin Asthenia syndrome, Chinese Journal of Integrative Medicine 26 (5) (2006) 394-397.

[5] L. Li, X.L. Deng, X.B. Zhao, Z. Yong, D.S. Ouyang, Advances in studies on chemical constituents in

Dendrobium candidum and their pharmacological effects,

Anti-Tumor Pharmacy 1 (2) (2011) 90-94.

[6] H.S. Wu, J.H. Xu, L.Z. Chen, J.J. Zhang, Studies on anti-hyperglycemic effect and its mechanism of

Dendrobium candidum, China Journal of Chinese Materia

Medica 29 (2) (2004) 160-163.

[7] L.M. Wang, J.H. Xu, L.Z. Chen, J.J. Sun, H.H.Wu Pharmacodynamics of Dendrobium candicum granules on experimental stomach Yin deficiency, Chinese Traditional Patent Medicine 24 (10) (2002) 803-805. [8] W.X. Yong, Review on the research progress of alkaloid

in Dendrobium plants, Chinese Pharmaceutical Affairs 19 (7) (2005) 447.

[9] Y.H. Lee, J.D. Park, N.I. Beak, S.I. Kim, B.Z. Ahn, In

vitro and vivo antitumoral phenanthrenes from the aerial

parts of Dendrobium nobile, Planta Med. 61 (1995) 178. [10] H. Suzuki, I. Keimatsu, Alkaloid of the Chinese drug,

“Chin-Shin-Hu”. II. Dendrobine, J. Pharm. Soc. Jpn. 52 (1932) 1049-1060.

[11] Y.F. Li, X.H. Zhang, G.M. Sun, Determination of alkaloids and polysaccharide in Herba dendrobii, Chinese Pharmaceutical Affairs 16 (7) (2002) 426-428.

[12] S.Y. Cheng, Y. Wang, W.H. Liu, H.W. Du, K.S. Chen, Effects of plant growth regulators on phenylalanine ammonia-lyase (PAL) activities in leaves of Ginkgo

biloba in vitro, Journal of Plant Resources and

Environment 14 (1) (2005) 20-22.

[13] C.F. Zhou, Y.R. Li, L.T. Yang, Effects of ethephon sprayed at early tillering stage on the activities of peroxidase, IAA oxidase and acid invertase in sugarcane in correlation to tillering, Guihaia 27 (4) (2007) 649-652. [14] Z.T. Ying, S.X. Li, Relation of sec expression to ethylene

evolution and oxidase activity in Lagenaria leucantha

and Cucumis sativus, Acta Horticulturae Sinica 17 (1)

(1990) 51-58.

[15] J. Huang, X.Z. Xiao, Effects of ethrel treatment on chitinase activity in latex of Heyea bras Uiensis, Chinese Journal of Tropical Crops 24 (4) (2003) 1-5.

[16] G.C. Ouyang, Y.L. Xue, Physiological role and regulation of phenylpropanoid metabolism in plant, Plant Physiology Communications 24 (3) (1988) 9-16. [17] A. Kumar, B.E. Ellis, The phenylalanine ammonia-lyase

gene family in raspberry, structure, expression, and evolution, Plant Physiology 127 (1) (2001) 230-239. [18] H.H. Fan, Study on molecular taxonomy, physiological

regulation function of nitric oxide and gene cloning of FPS in Dendrobium Huoshanense, M.Sc. Thesis, AnHui Agricultural University, 2008.

[19] K.C. Zhang, Isolation, purification, properties and its outer factors of phenylalanine ammonia lyase (PAL) in D.

huoshanense, M.Sc. Thesis, AnHui Agricultural

University, 2009.

[20] S.L. Hong, Q. Jin, B. Huang, Y.P. Cai, Y. Lin, Effects of

60_Co _γ_{-Rays irradiation on cell growth and alkaloid}

accumulation of protocorm-like bodies in suspension cultures from Dendrobium huoshanense, Acta Agricultural Nucleatae Sinica 23 (4) (2009) 592-596. [21] Q. Jin, Y.P. Cai, Y. Lin, Q. Wu, Effects of nitric oxide on

endogenous hormones and alkaloids production of hybrid dendrobium PLBs, Acta Agricultural Nucleatae Sinica 24 (6) (2010) 1291-1296.

(12)

[23] T.M. Rickey, W.R. Belknapk, Comparison of the expression of several stress responsive genes in potato tubes, Plant Molecular Biology 16 (6) (1991) 1009-1018.

[24] S.Y. Chen, K.S. Chen, H.W. Liu, H.W. Du, Regulation and expression of the PAL in plant and its outlook, Journal of Fruit Science 20 (5) (2003) 351-357.

[25] J.W. Wang, Y.L. Xue, Studies on plant phenylalanine ammonia-lyase I. The effect of phytohormone on the increase in phenylalanine ammonia-lyase(PAL) and cinnamic acid 4-hydroxylase(CA4H) activity and the sequence of concomitant changes of enzyme activities in sweet potato root tuber discs, Acta Phytopathologica Sinica 7 (3) (1981) 373-379.

[26] H.X. Liu, W.B. Jiang, Y.B. Luo, Suppression of 1-MCP and ethylene treatment on Penicillium expansum of wounded-inoculated peach fruit, Food Science and Technology Z1 (2003) 152-156.

[27] A.K. Mattoo, D.O. Adams, G.W. Patterson, M.

Lieberman, Inhibition of 1-aminocyclopropane-1-carboxylic acid synthase by

phenothiazines, Plant Sci Lett 28 (1982) 173-179. [28] C. Balague, C.F. Watson, A.J. Turner, P. Rouge, S.

Picton, J.C. Pech, et al., Isolation of a ripening and wound-induced-cDNA from Cucumis melo L. encoding a protein with homology to the ethylene-forming enzyme, Eur J Biochem 212 (1993) 27-34.

[29] C.S. Barry, B. Blume, M. Bouzayen, W. Cooper, A.J. Hamilton, D. Grierson, Differential expression of the 1-aminocyclopropane-1-carboxylate oxidase gene family of tomato, Plant J. 9 (1996) 525-535.

[30] S. Ketsa, A. Rugkong, Ethylene pmduction, senescence and ethylene sensitivity of Dendrobium pompadour’ flowers following pollination, The Journal of Horticultural Science and Bioteclmology 75 (2000) 149-153.

[31] S.D. O’Neill, J.A. Nadeau, X.S. Zhang, A.Q. Bui, A.H. Halevy, Interorgan regulation of ethylene biosynthetic genes by pollination, Plant Cel1 5 (1993) 419-432. [32] A.D. Stead, Pollination-induced flower senescence: A

review, Plant Growth Regul. 11 (1992) 13-20.

[33] W.Q. Liu, B.C. Wang, C.R. Duan, B. Li, A method for isolating functional RNA from callus of Dendrobium

candidum contented rich polysaccharides, Colloids Surf

B: Biointerfaces 42 (2005) 259-262.

[34] S.F. Yang, N.E. Hoffman, Ethylene biosynthesis and its regulation in higher plants, Ann. Rev. Plant Physiol. 35 (1) (1984) 155-189.

[35] J.F. Jiang, Studied on the effects of Aspergillus niger

extract and salicylic acid on the growth and alkaloid metabolism of Catharanthurs roseus cells in the suspension culture, M.Sc. Thesis, HuNan Agricultural University, 2004.

[36] J. Zhao, W.H. Zhu, Q. Hu, Enhanced catharanthine production in Catharanthus roseus cell cultures by combined elicitor treatment in shake flasks and bioreactors, Enzyme and Microbial Technology 28 (7-8) (2001) 673-681.

[37] O.A. Moreno-Valenzuela, M. Monforte-Gonzalez, J.A. Munoz-Sanchez, M. Mendez-Zeel, V.M. Loyola Vargas, M.T. Hernandez-Sotomayor, Effect of macerozyme on secondary metabolism plant product production and phospholipase C activity in Catharanthus roseus hairy roots, Journal of Plant Physiology 155 (4/5) (1999) 447-452.

[38] G. Diallinas, A.K. Kanellis, A phenylalanine ammonia-lyase gene from melon fruit: cDNA cloning, sequence and expression in response to development and wounding, Plant Milecular Biology 26 (1) (1994) 473-479.

[39] R.K. Hughes, A.G. Dickerson, The effect of ethylene on phenylalanine ammonia-lyase (PAL) induction by a fungal elicitor in Phaseolus vulgans, Physiological and Molecular Plant Patholgy 34 (4) (1989) 361-378.

[40] Y. Li, Q. Zhang, H.X. Li, T.T. Liu, X.M. An, Z.Y. Zhang, Prokaryotic expression analysis of a NBS-type PtDRG01

gene isolated from Populus tomentosa Carr., Acta Bot. Boreal.-Occident. Sin. 28 (5) (2008) 882-888.

[41] K.J. Di, S.G. Liu, Q.H. Zhang, J.B. Zhang, The study of BL21(DE3)/PET-28 as an expression system of human IL-6, Acta Anatomica Sinica 4 (1998) 67-69.

[42] L.F. Du, W.B. Sun, X.Y. Tang, J.Q. Huang, Construction of the prokaryotic expression vector of peb1 A gene of

Campylobacter jejuni and its expression, Chinees Journal

(13)

Apr. 2013, Vol. 7, No. 4, pp. 341-347

Genetic Association Study of

KCNB1

Gene with the

Susceptibility of Hypertension Related LVH (Left

Ventricular Hypertrophy) Patients in Malaysia

Julia Ashazila Mat Jusoh1, Norlaila Danuri2, Fadhlina Abdul Majid2, Hoh Boon Peng1, 2 and Khalid Yusoff2

1. Institute of Medical Molecular Biotechnology, Faculty of Medicine, Universiti Teknologi MARA, Sungai Buloh 47000, Malaysia

2. Faculty of Medicine, Universiti Teknologi MARA, Batu Caves 68100, Selangor, Malaysia

Received: September 24, 2012 / Accepted: December 07, 2012 / Published: April 30, 2013.

Abstract: LVH (Left ventricular hypertrophy) is an independent risk factor for the development of heart failure, cardiac arrhythmias and stroke. A recent genome-wide association study reported the involvement of a candidate gene namely KCNB1 in mechanism for development of LVH in hypertension. This study aimed to replicate the finding by investigating the genetic association of KCNB1

gene among the hypertensive LVH patients from Malaysia. We genotyped a SNP (single nucleotide polymorphism) located in

KCNB1 namely, rs6063397 among 200 subjects consisting of 61 LVH and 139 non LVH patients using Sanger sequencing method.

Statistical analysis revealed no significant association between the LVH susceptibility between the allele and genotype frequencies (P

= 0.2719 and 0.4768, respectively). This finding suggests that KCNB1 may not play a role in LVH susceptibility in hypertensive patients in Southeast Asian populations.

Key words: Left ventricular hypertrophy, KCNB1, SNP (single nucleotide polymorphism), Malaysia.

1. Introduction



LVH (Left ventricular hypertrophy) is an independent risk factor for the development of heart failure, cardiac arrhythmias and stroke. It develops as a result of hemodynamic overload, for instance, hypertension [1, 2]. Blood pressure is an important determinant of LVH, and a significant proportion of patients with essential hypertension develops this complication. However, this condition varies in a wide range of phenotypes, and studies had shown that patients with LVH may have near-normal blood pressure, suggesting that development of LVH may be due to a genetic factor independent of hypertension [3].

LVH can be reversed with anti-HT (anti-hypertensive) agents. Angiotensinogen receptor

Corresponding author: Khalid Yusoff, professor, FRCP, research field: cardiology. E-mail: [email protected].

blocker like losartan has been shown to improve the reversal effect [4-6]. However, it is unknown whether using this anti-HT agent alone would be useful in preventing LVH. Hence, identifying HT patients with the risk of LVH may allow this hypothesis to be tested, and if successful, would lead to the prevention, treatment and improvement of prognosis of LVH.

The normal distribution of LV mass (as an indicator of LVH) in the population indicates the involvement of complex and multiple genetic factors to the trait. Various genetic studies had been carried out extensively, reporting mainly on the candidate genes like ACE (angiotensin converting enzyme), guanine nucleotide-binding protein gene (GNB3), IGF-1 (insulin-like growth factor), AGT II (angiotensin II), AGTRs (angiotensin receptors) [7-12] etc., but no conclusive result was obtained.

(14)

Genetic Association Study of KCNB1 Gene with the Susceptibility of Hypertension Related Left Ventricular Hypertrophy (LVH) Patients in Malaysia

342

involvement of a candidate gene KCNB1 located at chromosome 20q13.2. The protein produced by this gene is dephosphorylated by calcineurin, which is well known to be associated with LVH [14], reflecting a unique mechanism for development of LVH in hypertension. However, whether the finding is relevant to the Southeast Asia populations or not remains to be validated, as the study was carried out in the Western populations, of which the allele frequencies and the structure of LD (linkage disequilibrium) are known to be different between the two major continents.

This proposed study hence, attempts to verify the study by replicating the finding in our population, i.e., studying the SNPs of the KCNB1 gene among the hypertensive patients with LVH.

2. Materials and Methods

2.1 Sample Recruitment

The study was approved by UiTM Research and Ethics Committee, as well as ethics committee of Ministry of Health. A total of 200 blood samples (61 LVH and 139 non LVH) were recruited from the PURE (Prospective Urban-Rural Epidemiologic). Study from 2007 to 2010. General consent was obtained earlier. We defined the control group as those hypertensive patients without LVH; whilst the case group as those hypertensive patients with LVH. The following criteria were followed during sample recruitment:

(1) Age 30-60 years old;

(2) Hypertension, defined as: systolic blood pressure ≥ 140 mmHg and/or diastolic blood pressure

≥ 90 mmHg;

(3) Have not received any anti-hypertensive therapy during the participation of the study;

(4) Non-smoker; (5) Non-alchohol takers.

To enhance the potential genetic differences and statistical power, we selected the highest and lowest deciles for LVMI followed by ventricular wall

thickness. Subjects were re-consented before further experimental procedure was carried out.

2.2 Echocardiography

Echocardiography measurements were made using the Echo Pac in our Non Invasive Cardiac Laboratory. Doppler, two-dimensional (2D), and M-mode (2D-guided) echocardiograms were performed following a standardized protocol. Measurements were made using M-Mode at the PSAX (Parasternal Short Axis view) using a computerized review station equipped with a digitizing tablet and monitor overlay used for calibration and quantification.

Transthoracic echocardiogram criteria for LV mass index used the formula, LV mass index = (0.8 (1:04 ([LVIDD PWTD IVSTD]3-[LVIDD]3) (0.6 g/heigh2) > 110 g/m2 in female and > 125 g/m2 in male (Devereux Criteria).

2.3 DNA Extraction

Genomic DNA was extracted from whole blood from the recruited subjects using commercially available kit namely QIAamp DNA Blood Midi Kit (Qiagen, Inc., Valencia, CA.).

2.4 Genotyping

2.4.1 PCR (Polymerase Chain Reaction)

PCR amplification was performed on a total reaction volume of 20 µL. Each PCR mixture contained 60 ng of sample DNA, 1 × PCR buffer (10 mmol/L Tris-HCl, 50 mmol/L KCl, pH 8.3), 0.5 mM dNTP, 1.5 mM MgCl2, 5 pmol of each primer

(15)

343

2.4.2 Sequencing

DNA sequencing of the KCNB1 gene SNP was performed with a CEQ dye terminator cycle sequencing Quick Start kit (Beckman Coulter, Fullerton, CA) according to the manufacturer’s recommendations. Sequencing analyses were done with the CEQ 8000 genetic analysis system software (Beckman Coulter, Fullerton, CA) followed by BioEdit sequence alignment editor (Ibis Therapeutics, Carlsbad, CA).

2.5 Statistical Analysis

The genotype (C/C, C/T and T/T) and allele (C or T) frequencies, as well as the allele carriage frequencies (the percentage of individuals carrying at least 1 copy of the T or C allele) were determined by direct counting. Chi-square test with 2 degrees of freedom was used to determine the significance of the difference in genotype distributions. The chi-square test with Yates’ correction and Fisher’s exact test for

≥ 1 cell with < 5 counts were used to test the significance of differences in 2 × 2 contingency tables.

P values for T allele positivity were obtained from the comparison between individuals with at least 1 T

allele (T/T genotype plus T/C genotype) and those with the C/C genotype; P values for C allele positivity were obtained in a similar way. Two-sided P values were calculated; P values less than 0.05 were considered significant. OR (Odds ratio) and a Cornfield’s 95% confidence interval (95% CI) were calculated.

3. Results and Discussion

3.1 Demographic and Clinical Characteristics

Of the 200 hypertensive subjects recruited, 139 were non LVH and the remaining had LVH. The demographic and clinical characteristics of these subjects are summarized in Table 1. There was no significant difference between the case and control groups with regards to their ethnicity, weight, height, systolic and diastolic blood pressure and IVSD. However, male was found to be significantly higher in case group (P = 0.011). This data agrees with previous research reported that the incidence of LVH were different between males and females suggesting gender differences in the pathogenesis of the condition [15].

Table 1 Demographic and clinical characteristics of case-control cohort.

Characteristics Case (n = 61) Control (n = 139) P value

Mean weight (kg) 70.0 (12.4) 66.0 (11.3) 0.640

Mean height (cm) 158.9 (8.4) 159.6 (7.7) 0.602

Mean systolic blood pressure (mmHg) 157.9 (19.8) 151.5 (14.8) 0.083

Mean diastolic blood pressure (mmHg) 93.9 (9.9) 89.6 (8.7) 0.275

Mean IVSD 1.2 (0.2) 0.9 (0.2) 0.463

Mean LV mass 252.1 (65.6) 160.7 (38.2) < 0.0001*

Mean LVMI 146.9 (35.7) 94.1 (1.5) < 0.0001*

Ethnicity

Malay 54 117

0.744

Chinese 4 12

Indian 1 5

Aborigine 0 2

Others 2 3

Mean age 54.9 (6.0) 51.8 (6.8) 0.361

Gender Male 51 91 0.011

Female 10 48

(16)

344

3.2 Allele and Genotype Frequencies

Genotype analysis of the SNP rs6063397 revealed that the distribution of the CC, CT and TT genotypes in the both groups was 50%, 27.5% and 22.5% respectively; and were in Hardy-Weinberg equilibrium. Interestingly, the overall MAF (minor allele frequency) observed in this study was 47.5% for C allele. This is different from those reported amongst Asian population in 1000 Genomes study (http://www. ncbi.nlm.nih.gov/variation/tools/1000genomes/) with an overall frequency of 43% for the T allele in Table 2.

3.3 Genetic Association Analysis

Genetic variants in specific genes or regions of the human genome are known to be responsible for a variety of phenotypes such as disease risk or variable drug response [16-19]. These variants can be investigated either directly, or through an indirect method via their non-random associations with the neighboring markers called, the LD (linkage disequilibrium). Previous study found that SNP (rs756529) located in KCNB1 gene were associated with LV mass in the European population [13]. Protein product by KCNB1 gene was dephosphorylated by calcineurin, a protein known to be associated with LVH in both animal model and human [14].

In the current study, we tested the association of SNP rs6063397 with LVH susceptibility in case-control samples of Malay and Chinese origins. Analysis with Haploview on the HapMap CHB and JPT samples revealed that rs756529 and rs6063397 were in full linkage disequilibrium (D’ = 1: r2= 1)

(Fig. 1) indicating that the SNPs were highly associated with each other and contained in a single LD block [20]. In other words, significant association of rs756529 found in the previous research in principle should be replicable by rs6063397 [10]. Indeed, these two variants are physically located close to each other (~ 5,000 bp). To further confirm the linkage disequilibrium between the two variants, we sequenced the SNP rs756529 in 50 samples selected randomly in this study and observed that r2 and D’ values were 1. The genotype and allele frequencies in both case and control groups are shown in Table 3. Fisher exact test revealed no significant association observed between both allele and genotypes of rs6063397 with LVH susceptibility. Permutation test was run (1,000 ×) but the result remained not significant (P = 0.264). Therefore we suspect that

KCNB1 may not play a role in LVH susceptibility in hypertensive patients in Southeast Asian populations (in particular Malaysian population).

Ethnic differences may lead to the conflicting results in genetic association study [21]. Replication in other populations with different ethnicities allows us to know whether a reported association signal is operative across populations, but it also provides valuable insights into the disease network or mechanism which may be different among ethnicities [16] if different association signals were observed. Hilgado et al [16] showed that the disease comorbidities of hypertension and ischemic heart disease were different between black and white men [16] suggesting a different disease aetiology in different populations. In addition to that, environmental

Table 2 Allele frequencies distribution.

SNP region Chr position SNP ID Major allele (%) Minor allele (%) Arnett et al. (2009) [10]

Chr 20 48,011,008 rs756529 G (59) A (41)

1000Genomes G (53) A (47)

Current study

Chr 20 48,016,209 rs6063397 T (52) C (48)

1000 Genomes C (57) T (43)

(17)

345

Fig. 1 LD block of KCNB1 gene. Haploview plot showing pairwise LD (D’ values). Each square plots the level of LD between a pair of SNPs; comparisons between neighboring SNPs located along the first line under the names of the SNPs. Numbers within squares indicate the D’ value expressed in percentile. Red squares indicate strong LD (D’ = 1) with LOD scores for LD ≥ 2, pink squares indicates LD < 1 with LOD ≥ 2, brighter pink indicates intermediate LD, and white indicate weak LD D’ < 1, and LOD score < 2.

Table 3 Frequency distribution of the KCNB1 polymorphism in control and case.

SNP ID No. (%) in control (n = 139) No. (%) in case (n = 61) P value

rs6063397

Genotype frequency

C/C 71 (51.1) 29 (47.5)

0.4768

C/T 40 (28.8) 15 (24.6)

T/T 28 (20.1) 17 (27.9)

Allele frequency C 151 (54.3) 59 (48.4) 0.2791

T 127 (45.7) 63 (51.6)

factors, especially nutrients, have to be precisely evaluated together with complex genotyping, in order to establish their importance in masking or unmasking functional variants correlated to a specific genetic background.

However, a relatively small number of samples recruited in this study may be a drawback in this study. A most realistic genetic association between a

(18)

346

considered in genetic association study, as it would increase chances of tagging the uncommon variants, often causative variants [17]. Another possibility of the non-significant finding is that rs756529 may play an indirect role in the mechanisms of LVH development, such as transcriptional factor regulation etc. However, UCSC Genome Browser (http://genome.ucsc.edu/index.html) revealed no apparent functional role played by this variant.

4. Conclusion

In summary, our study observed no significant association between KCNB1 genetic variation and hypertensive LVH. We suspect that the role of this gene in LVH pathogenesis may be relatively modest and only associated with specific ethnic groups. Our study would be informative to the meta-analysis for the studies of gene mapping of hypertensive LVH with Asian origin. Further studies are crucial to improve the understanding of the disease aetiology of hypertensive LVH.

Acknowledgments

This study is supported by the Malaysian Society of Hypertension research grant (100-RMI/PRI 16/6/2 (74/2010)), and the Ministry of Higher Education FRGS (600-RMI/ST/FRGS 5/3/fst (61/2010)) grant. The authors would like to thank staff and students of Institute Medical Molecular Biotechnology, PURE RUS team, staff of Clinical Teaching Center, Faculty of Medicine, Universiti Teknologi MARA for their help rendered in conducting this study, and the subjects who had participated into this study.

References

[1] B.H. Lorell, B.A. Carabello, Left ventricular hypertrophy: Pathogenesis, detection, and prognosis, Circulation 102 (2000) 470-479.

[2] J. Heineke, J.D. Molkentin, Regulation of cardiac hypertrophy by intracellular signalling pathways, Nature Reviews Molecular Cell Biology 7 (2006) 589-600. [3] D. Levy, K.M. Anderson, D.D. Savage, W.B. Kannel, J.C.

Christiansen, W.P. Castelli, Echocardiographically

detected left ventricular hypertrophy: Prevalence and risk factors, The Framingham Heart Study, Annals of Internal Medicine 108 (1988) 7-13.

[4] A.H. Gradman, R.E. Schmieder, R.L. Lins, J. Nussberger, Y. Chiang, M.P. Bedigian, Aliskiren, a novel orally effective renin inhibitor, provides dose-dependent antihypertensive efficacy and placebo-like tolerability in hypertensive patients, Circulation 111 (2005) 1012-1018. [5] J.M. Cruickshank, J. Lewis, V. Moore, C. Dodd,

Reversibility of left ventricular hypertrophy by differing types of antihypertensive therapy, Jounal of Human Hypertension 6 (1992) 85-90.

[6] M.E. Safar, J.J. Toto-Moukouo, J.A. Bouthier, R.E. Asmar, J.A. Levenson, A.C. Simon, et al., Arterial dynamics, cardiac hypertrophy, and antihypertensive treatment, Circulation 75 (1987) I156-161.

[7] K. Lindpaintner, M. Lee, M.G. Larson, V.S. Rao, M.A. Pfeffer, J.M. Ordovas, et al., Absence of association or

genetic linkage between the angiotensin-converting-enzyme gene and left ventricular

mass, New England Journal of Medicine 334 (1996) 1023-1028.

[8] Z. Nagy, A. Busjahn, S. Bahring, H.D. Faulhaber, H.R. Gohlke, H. Knoblauch, et al., Quantitative trait loci for blood pressure exist near the IGF-1, the Liddle syndrome, the angiotensin II-receptor gene and the renin loci in man, Jounal of the American of Nephrology 10 (1999) 1709-1716.

[9] A. Semplicini, W. Siffert, M. Sartori, A. Monari, C. Naber, G. Frigo, et al., G protein beta3 subunit gene 825T allele is associated with increased left ventricular mass in young subjects with mild hypertension, American Journal of Hypertension 14 (2001) 1191-1195.

[10] A. Olszanecka, K. Kawecka-Jaszcz, T. Kuznetsova, K. Stolarz, E. Brand, A. Ryabikov, et al., Ambulatory blood pressure and left ventricular structure and function in relation to the G-protein beta3-subunit polymorphism C825T in White Europeans, Journal of Human Hypertension 17 (2003) 325-332.

[11] G. Doolan, L. Nguyen, J. Chung, J. Ingles, C. Semsarian, Progression of left ventricular hypertrophy and the angiotensin-converting enzyme gene polymorphism in hypertrophic cardiomyopathy, International Journal of Cardiology 96 (2004) 157-163.

[12] X. Jeunemaitre, Genetics of the human renin angiotensin system, Journal of Molecular Medicine (Berlin) 86 (2008) 637-641.

[13] D.K. Arnett, N. Li, W. Tang, D.C. Rao, R.B. Devereux, S.A. Claas, et al., Genome-wide association study identifies single-nucleotide polymorphism in KCNB1

(19)

347

[14] W. Tang, D.K. Arnett, R.B. Devereux, D. Panagiotou, M.A. Province, M.B. Miller, et al., Identification of a novel 5-base pair deletion in calcineurin B (PPP3R1) promoter region and its association with left ventricular hypertrophy, American Heart Journal 150 (2005) 845-851.

[15] H. Schunkert, H.W. Hense, S.R. Holmer, M. Stender, S. Perz, U. Keil, et al., Association between a deletion polymorphism of the angiotensin-converting-enzyme gene and left ventricular hypertrophy, New England Journal of Medicine 330 (1994) 1634-1638.

[16] I. Roots, G. Laschinski, F. Arjomand-Nahad, J. Kirchheiner, D. Schwarz, J. Brockmoller, et al., Genotype and phenotype relationship in drug metabolism, Ernst Schering Research Foundation Workshop 59 (2007) 81-100.

[17] A.Y. Lu, Drug-metabolism research challenges in the new millennium: Individual variability in drug therapy and drug safety, Drug metabolism and disposition: The Biological Fate of Chemicals 26 (1998) 1217-1222.

[18] M.C. Miller, 3rd, H.W. Mohrenweiser, D.A. Bell, Genetic variability in susceptibility and response to toxicants, Toxicololy Letters 120 (2001) 269-280.

[19] G.M. Shenfield, Genetic polymorphisms, drug metabolism and drug concentrations, The Clinical Biochemist Reviews/Australian Association of Clinical Biochemists 25 (2004) 203-206.

[20] S.B. Gabriel, S.F. Schaffner, H. Nguyen, J.M. Moore, J. Roy, B. Blumenstiel, et al., The structure of haplotype blocks in the human genome, Science 296 (2002) 2225-2229.

[21] M. Mori, R. Yamada, K. Kobayashi, R. Kawaida, K. Yamamoto, Ethnic differences in allele frequency of autoimmune-disease-associated SNPs, Journal of Human Genetics 50 (2005) 264-266.

[22] E. Zintzaras, J. Lau, Trends in meta-analysis of genetic association studies, Journal of Human Genetics 53 (2008) 1-9.

(20)

Apr. 2013, Vol. 7, No. 4, pp. 348-352

Charaterization of

Citrus

Hybrid “Huangguogan”

through the Combination of Morphological and

Molecular Markers

Xue-Fei Wang, Xi-Rui Xiong, Xue-Li Pu, Qiao-Qiao Yan, Bo Xiong, Feng-Ling Liao, Qian-Qian Fan and Zhi-Hui Wang

College of Horticulture, Sichuan Agricultural University, Ya’An 625014, SiChuan, China

Received: October 23, 2012 / Accepted: January 24, 2013 / Published: April 30, 2013.

Abstract: Huangguogan, an obvious Citrus hybrid, is suitable for transportation and export and ripens in March or April. Because of late season, it may play a significant role in fruit market. However, its origin is still unconfirmed. The aim of this study was to clarify the possible parentage of Huangguogan via the combination of morphological and molecular markers including simple sequence repeat (SSR) and chloroplast simple sequence repeat (cpSSR). Analysis of morphological traits including leaf stalk length, phylliform index and fruit shape index indicated that Huangguogan had similarities in morphology with Sweet orange. The SSR Cluster Analysis showed that Huangguogan was clustered together with Hongju tangerine and revealed ~80% genetic similarity. They illustrated a close genetic distance between Huangguogan and Hongju tangerine. In addition, the bands of 2 polymorphic cpSSR were identical in Huangguoggan and Sweet orange. Consequently, it is likely that its female parentage was the sweet orange (Citrus sinensis (L.) Osbeck) and its male parentage was the tangerine (Citrus reticulata Blanco).

Key words: Citrus, natural hybrid, huangguogan, morphological and molecular markers.

1. Introduction



Citrus are one of the major fruit crops in the world [1]. Citrus varieties are related to the development of Citrus industry. In China, there are many Citrus resources, and a large amount of genetic variation exists within them. It is an important breeding way selecting the required Citrus varieties from local resources [2]. In 1956, the fruit resources investigators discovered an obvious Citrus hybrid in Shimian County, Sichuan Province, China and named it as Huangguogan. Its fruit is egg round in shape, surface colour is orange, has thick skin but easy to peel and seedless. Many morphological and physiological indicators range between the tangerine and the orange. Besides, it is suitable for transportation and export and ripens in March or April.

Corresponding author: Zhi-Hui Wang, Prof., research fields: plant physiology, molecular biology technology. E-mail: [email protected].

Because of late season, it may play a significant role in fruit market. However, its origin is still unconfirmed. SSR is a reliable method for parentage analysis on account of the co-dominant inheritance and large number of alleles per locus [3]. On the other hand, cpSSR can clearly identify the female parentage for the characteristic of female genetics [4]. The aim of this study was to clarify the possible parentage of Huangguogan via the combination of morphological and molecular markers with SSR and cpSSR.

2. Materials and Methods

2.1 Plant Materials

(21)

Charaterization of Citrus Hybrid “Huangguogan” through the Combination of Morphological and Molecular Markers

349

accepted to be control in the study.

2.2 Morphological Analysis

Thirty spring leaves selected randomly were used to measure their leaf stalk length and phylliform index and thirty ripe fruit selected randomly were used to measure their fruit shape index.

2.3 DNA Extraction

Total genomic DNA was isolated from fresh leaves following the procedure previously described by Cheng et al. [5]. The quality and concentration of the DNA samples were determined by spectrophotometer, and the sample concentration was diluted to 50 ng·µL-1.

2.4 SSR Analysis

Seventeen previously reported primer pairs were used (Table 2) [6, 7], synthesized by Sangon Inc. (Shanghai, China). The PCR reactions were performed in a PTC-200 thermocycler (MJ Research, Waltham, MA) in 20 µL reaction mixtures containing 10 uL 2×Taq MasterMix (CW Inc., Beijing, China), 0.8 uM of each forward and reverse primer, 50 ng of template DNA and sterilized double stilled water. The amplification program consisted of an initial denaturing cycle at 94 °C for 5 min; 30 cycles of 30 s (denaturing) at 94 °C; 45 s (annealing) at corresponding temperatures (Table 2); 1 min (elongation) at 72 °C;

Table 1 The Citrus varieties provided for the study.

Accession Variety Latin name Collection site

1 Huangguogan Shimian County, Sichuan Province, China

2 Yaogan Shimian County, Sichuan Province, China

3 Sweet orange C. sinensis (L.) Osbeck Shimian County, Sichuan Province, China 4 Hongju tangerine C. reticulata Blanco Shimian County, Sichuan Province, China 5 Navel orange C. sinensis (L.) Osbeck Shimian County, Sichuan Province, China 6 Shatian pummelo C. grandis (L.) Osbeck Sichuan Agricultural University, China 7 Huangguogan older than 100 years Shimian County, Sichuan Province, China 8 Satsuma mandarin C. umshiu Marc. Shimian County, Sichuan Province, China Yaogan is a wild Cirtus we discoveryed in Shimian County, Sichuan Province, China.

Table 2 Simple sequence repeat (SSR) primer sequences provided for the study.

Accession Primer F-Primer (5′-3′) R-Primer (5′-3′) Annealing

temperature (°C) Reference

1 TAA27 GGATGAAAAATGCTCAAAATG TAGTACCCACAGGGAAGAGAGC 55 Ref. [6]

2 ATC09 TTCCTTATGTAATTGCTCTTTG TGTGAGTGTTTGTGCGTGTG 55 Ref. [7]

3 TAA41 AGGTCTACATTGGCATTGTC ACATGCAGTGCTATAATGAATG 49 Ref. [6]

4 AAGG9 AATGCTGAAGATAATCCGCG TGCCTTGCTCTCCACTCC 49 Ref. [7]

5 CAC15 TAAATCTCCACTCTGCAAAAGC GATAGGAAGCGTCGTAGACCC 49 Ref. [6]

6 AG14 AAAGGGAAAGCCCTAATCTCA CTTCCTCTTGCGGAGTGTTC 49 Ref. [7]

7 TAA15 GAAAGGGTTACTTGACCAGGC CTTCCCAGCTGCACAAGC 49 Ref. [6]

8 CAC39 AGAAGCCATCTCTTCTGCTGC AATTCAGTCCCATTCCATTCC 55 Ref. [6]

9 TAA33 GGTACTGATAGTACTGCGGCG GCTAATCGCTACGTCTTCGC 55 Ref. [6]

10 CT19 CGCCAAGCTTACCACTCACTAC GCCACGATTTGTAGGGGATAG 55 Ref. [7]

11 GT03 GCCTTCTTGATTTACCGGAC TGCTCCGAACTTCATCATTG 51 Ref. [7]

12 CT02 ACGGTGCGTTTTGAGGTAAG TGACTGTTGGATTTGGGATG 51 Ref. [7]

13 CAG01 AACACTCGCACCAAATCCTC TAAATGGCAACCCCAGCTTTG 51 Ref. [7]

14 CAT01 GCTTTCGATCCCTCCACATA GATCCCTACAATCCTTGGTCC 51 Ref. [7]

15 TAA3 AGAGAAGAAACATTTGCGGAGC GAGATGGGACTTGGTTCATCACG 53 Ref. [6]

16 CT21 CGAACTCATTAAAAGCCGAAAC CAACAACCACCACTCTCACG 53 Ref. [7]

17 TC26 CTTCCTCTTGCGGAGTGTTC GAGGGAAAGCCCTAATCTCA 53 Ref. [7]

(22)

Charaterization of Citrus Hybrid “Huangguogan” through the Combination of Morphological and Molecular Markers 350

and one final cycle of 10 min at 72 °C. Samples were then stored at 4 °C. The ampliﬁcation products were separated by 12% polyacrylamide gel electrophoresis (PAGE) and detected by silver staining method previously described by Federici et al. [8].

2.5 cpSSR Analysis

Four previously reported primer pairs were used (Table 3) [9], synthesized by Sangon Inc. (Shanghai, China). The PCR reactions were performed in a PTC-200 thermocycler (MJ Research, Waltham, MA) in 20-μL reaction mixtures which were the same with SSR analysis. The amplification program consisted of an initial denaturing cycle at 94 °C for 3 min; 32 cycles of 1 min (denaturing) at 94 °C; 40 s (annealing) at 55 °C; 1 min (elongation) at 72 °C; and one final cycle of 5 min at 72 °C. Samples were then stored at 4 °C. The next steps were the same with SSR analysis.

2.6 Data Analysis

The data of morphological analysis were calculated using the software package SPSS V13.0. All clearly detectable SSR products were scored as band presence

(1) and absence (0). Genetic relationships among the haplotypes on the basis of SSR-amplified fragment sizes were analyzed with NTSYS-pc Version 2.10 software. A similarity matrix was generated by calculating the proportion of bands shared by each pair of accessions (Jaccard coefficient), and a dendrogram was constructed using the unweighted pair group method based on arithmetic means (UPGMA) in Cluster Analysis.

3 Results

3.1 Morphological Identification

Leaf stalk length, fruit shape index and phylliform index of Huangguogan were similar to Sweet orange but were statistically different from the rest of the varieties as presented in Table 4. Previous studies on anther and pollen morphology reported that anthers of Huangguogan were plump and yellow and pollen of Huangguogan was plenty, similar to Sweet orange but different from Navel orange. The pollen stain ability was also close to Sweet orange [10]. All together, these findings suggest that Huangguogan has morphological similarities to Sweet orange.

Table 3 Chloroplast simple sequence repeat (cpSSR) primer sequences used in the study.

Accession Primer F-Primer (5′-3′) R-Primer (5′-3′) Reference

1 SPCC1 CTTCCAAGCTAACGATGC CTGTCCTATCCATTAGACAATG Ref. [9]

2 SPCC3 GATGTAGCCAAGTGGATCA TAATTTGATTCTTCGTCGC Ref. [9]

3 SPCC9 TAAAGAAGGTTCTTTTTCAAGC CGAACCCTCGGTACGATTAA Ref. [9]

4 SPCC11 GGCCATAGGCTGGAAAGTCT GTTTATGCATGGCGAAAAGG Ref. [9]

F = Forward; R = Reverse.

Table 4 Analysis of leaf stalk and phylliform index and fruit shape index.

Accession Variety Leaf stalk length/cm Fruit shape index Phylliform index

1 Huangguogan 1.84 ± 0.14a 1.024 ± 0.006b 2.12 ± 0.04a

2 Yaogan 0.43 ± 0.08d 0.768 ± 0.004c 2.03 ± 0.05b

3 Sweet orange 1.88 ± 0.12a 1.042 ± 0.003b 2.15 ± 0.06a

4 Hongju tangerine 1.49 ± 0.14b 0.794 ± 0.004c 2.02 ± 0.05b

5 Navel orange 1.42 ± 0.09b _{1.114 ± 0.008}a _{1.91 ± 0.07}c

6 Shatian pummelo 1.22 ± 0.10c 1.118 ± 0.007a 1.86 ± 0.09c

7 Huangguogan older than 100 years 1.78 ± 0.13a 1.032 ± 0.005b 2.10 ± 0.04a

8 Satsuma mandarin 0.82 ± 0.08c 0.786 ± 0.005c 2.01 ± 0.05b

(23)

Charaterization of Citrus Hybrid “Huangguogan” through the Combination of Morphological and Molecular Markers

351

3.2 SSR Characterization

Twelve out of seventeen SSR primer pairs were polymorphic among these varieties. Gel image picture showing the amplicons of seven varieties amplified by SSR primer TAA1 is shown in Fig. 1. It clearly demonstrated that allelic was similar between Huangguoan (Lane 1) and Hongju tangerine (Lane 4) and allelic variation among others. These results reflected obviously that the SSR was a useful tool in distinguishing these genotypes.

Consequently, SSR results were collectively used to construct UPGMA dendrogram to reveal genetic relationships among varieties. In the cluster analysis, the dendrogram had two main branches, first branch including all of the varieties except Shatian pummelo which formed a separate branch. Huangguogan was clustered together with Hongju tangerine and revealed ~80% genetic similarity (Fig. 2). Huangguogan is the closest to Hongju tangerine, and Sweet orange and Navel orange are together and ~60% similar to Huangguogan.

Fig. 1 SSR profile of eight Citrus accessions using primer pair TAA1. Number refers to the samples listed in Table 1; M is size marker.

3.3 cpSSR Identification

Two out of four cpSSR primers were polymorphic (Figs. 3a and 3b). Band patterns were identical in Huangguoggan (Lane 1), Sweet orange (Lane 3), Navel orange (Lane 5) and Shatian pummelo (Lane 6); however, they were different from Yaogan (Lane 2), Hongju tangerine (Lane 4) and Satsuma mandarin (Lane 8) in Figs. 3a and 3b. Since cpSSR is maternal inheritance, together with the morphological data it is likely that the female parentage of Huangguoggan could be Sweet orange.

When the findings of the present study were taken into consideration, SSR data and the dendrogram

Fig. 3 cpSSR profile of eight Citrus varieties using primer pair SPCC1 (A) and SPCC3 (B). Number refers to the samples listed in Table 1; M is size marker.

Fig. 2 Dendrogram (UPGMA) representing genetic relationships among eight Citrus based on the dice coefficient obtained from pooled allelic profile of SSR markers technique; number refers to the samples listed in Table 1.

(a)

(24)

Charaterization of Citrus Hybrid “Huangguogan” through the Combination of Morphological and Molecular Markers 352

illustrated a close genetic distance between Huangguogan and Hongju tangerine (Citrus reticulata

Blanco). In addition, two polymorphic cpSSR suggested a positive association with Sweet orange (Citrus sinensis (L.) Osbeck).

4. Discussion and Conclusions

The morphological results supported previous studies on glutamic oxaloacetic transaminase (GOT), pexoxidase (POX) and esterase(EST) analysis by Zhang et al. [11]. Cluster analysis of SSR results revealed the genetic variation had occured in Huangguogan through many hundreds. Band patterns were identical in Sweet orange and Shatian pummelo. The present results supported that Cheng et al. [9] and Li [12] considered the female parentage of Sweet orange might come from Pummelo. The bands of Satsuma mandarin were the same with Hongju tangerine’s in the present study. The present results were in agreement with Brayan et al. [13], Li et al. [14] and Li et al. [2]. cpSSR markers provided a new and efficient tool for Citrus cytoplasm analyses. In comparison with nuclear DNA markers, chloroplast DNA markers were more reliable for Citrus

taxonomic studies because of the conservation and uni-parental inheritance of the chloroplast genome in higher plants. The reason that Huangguogan is seedless might be that the pollen tube extended just on the stigma surface but did not enter the stigma tissue [10].

Combining the results of morphological and molecular markers, it is likely that its female parentage was the sweet orange (Citrus sinensis (L.) Osbeck) and its male parentage was the tangerine (Citrus reticulata Blanco).

References

[1] H.A. Mohamed, K.B. Manosh, Z.W. Zhang, W.W. Guo, Exploitation of SSR, SRAP and CAPS-SNP markers for genetic diversity of Citrus germplasm collection, Scientia

Horticulturae 128 (2011) 220-227.

[2] J.F. Li, C.H. Xiang, X.X. Deng, Exploring the origin of

Citrus hybrid Zigui Tangor, Journal of Fruit Science 26 (4) (2009) 425-430. (in Chinese)

[3] T. Yamamoto, K. Mochida, T. Imai, T. Haji, H. Yaegaki, M. Yamaguchi, et al., Parentage analysis in japanese peaches using SSR markers, Breeding Science 53 (2003) 35-40.

[4] E. Novelli, Z.N. Deng, A. Gentile, S.L. Malfa, G. Continella, E. Tribulato, Citrus phylogeny and genetic origin of important species as investigated by molecular markers, Theor. Appl. Genet. 100 (2000) 1155-1166. [5] Y.J. Cheng, W.W. Guo, H.L. Yi, X.M. Pang, X.X. Deng,

An efﬁcient protocol for genomic DNA extraction from

Citrus species, Plant Mol. Biol. Rep. 21 (2003) 177-118. [6] J.M.H. Kijas, M.R. Thomas, J.C.S. Fowler, M.L. Roose,

Integration of trinucleotide microsatellites into a linkage map of Citrus, Theor. Appl. Genet. 94 (1997) 701-706. [7] N.A. Barkley, M.L. Roose, R.R. Krueger, C.T. Federici,

Assessing genetic diversity and population structure in a citrus germplasm collection utilizing simple sequence repeat markers (SSRs), Theor. Appl. Genet. 112 (8) (2006) 1519-1531.

[8] C.T. Federici, D.Q. Fang, R.W. Scora, M.L. Roose, Phylogenetic relationships within the genus Citrus

(Rutaceae) and related genera as revealed by RFLP and RAPD analysis, Theor. Appl. Genet. 96 (1998) 812-822. [9] Y.J. Cheng, M.C.D. Vicente, H.J. Meng, W.W. Guo, N.G.

Tao, X.X. Deng, A set of primers for analyzing chloroplast DNA diversity in Citrus and related genera, Tree Physiology 25 (2005) 661-672.

[10] M. Ye, Studies on the pollen morphology and fertility of guiwangan, South China Fruits 27 (6) (1998) 3-6. (in Chinese)

[11] Z.C. Zhang, D.H. Wang, Studies on the relationship of Huangguogan by isoayme, Journal of Sichuan Agricultural University 12 (1) (1994) 81-83. (in Chinese) [12] J.F. Li, Genetic Identification of the Natural Citrus

hybrid-‘Zigui’ Tangor, Huazhong Agricultural University, China, M. Thesis, 2007. (in Chinese)

[13] G.J. Brayan, J. Mcnicoll, G. Ramsay, R.C. Meyer, W.S.D. Jong, Polymorphic simple sequence repeat markers in chloroplast genomes of Solanaceous plants, Theor. Appl. Genet. 99 (1999) 859-867.