The modulation of the strength of binding and cleavage by Rnt1p resulted in changes in steady-state transcript levels and thus protein levels. The second type of posttranscriptional elements studied is the location of internal ribosome entry sites (IRESes) in the 5' UTR that initiate translation independently of the 5' cap through direct interaction with the ribosomal machinery.
Introduction
Synthetic biology and metabolic engineering
It is desirable to transfer the ability to make these chemicals to organisms that grow faster on cheap energy sources to lower the cost of these compounds. Internal ribosome entry sites (IRES) and AU-rich elements (AREs) have shown the ability to modulate gene expression in yeast, while more recently antisense and ribozyme-based riboswitches have shown the ability to enhance or repress gene expression due to the presence of a small molecule effector39-43.
Common pathways of transcriptional decay and translation in yeast
- Deadenylation-dependent decapping pathway of transcript
- Cap-dependent translation initiation
Transcripts are present in a circular conformation due to the interaction of the cap-binding protein, eukaryotic transcription factor (eIF)4E, on the 5‟ cap and the poly(A) binding protein (Pab1p) on the 3‟ poly(A) tail mediated by binding to eIF4G, a scaffolding protein (Figure 1.2). The 43S complex binds eIF4F to form the 48S complex and scanning of the transcript begins before the initiating AUG start codon57.
Posttranscriptional regulation through transcript stability and
- Control of transcript decay
- Control of the initiation of translation
- RNA processing by the RNase III enzyme Rnt1p
- Translation initiation mediated through internal ribosome entry
In the deadenylation-independent decapping pathway, transcript degradation proceeds without the removal of the 3‟ poly(A) tail. The processing of eukaryotic transcripts after endonucleolytic cleavage is independent of the 5' cap and the 3' poly(A) tail.
Interrelationship among the thesis projects
The regulatory range of genes of the Rnt1p library spans a wide range of protein expression levels. Demonstration of functional modularity of the hair library in the context of a diverse genetic construct.
Synthetic RNA control modules that tune gene expression
Introduction
The proper functioning of synthetic genetic circuits often relies on precise control and tuning of the expression levels of key protein components. However, despite extensive characterization of this RNA processing enzyme, neither natural nor synthetic Rnt1p substrates have been used to control gene expression levels in yeast.
Results
- Design and selection of an Rnt1p cleavage library to achieve
- A synthetic Rnt1p hairpin library exhibits a range of gene
- Rnt1p library hairpins maintain regulatory activity in a different
- In vitro characterization demonstrates that Rnt1p library
- Control of endogenous ERG9 expression by 3’ UTR
In vitro characterization of Rnt1p library supports tuning of gene regulatory activity through splicing rate modulation. The regulatory activity of the seven Rnt1p bands examined for ERG9 was first assessed by measuring ERG9 transcript levels (Table 2.3).
Discussion
The combination of the synthetic Rnt1p substrates with endogenous genetic targets allows specific engineering control strategies to be added to a system while retaining native regulatory schemes that may play an important role in the overall functioning of the system. Therefore, this work supports the unique ability of the synthetic Rnt1p hairpin library to systematically titrate pathway enzyme levels while maintaining native cellular control strategies that operate through transcriptional mechanisms. However, in contrast to RBS elements, the structural and functional isolation of the synthetic Rnt1p controllers allows for more successful maintenance of regulatory activities in different genetic contexts.
Materials and Methods
- Plasmid construction
- Rnt1p substrate characterization assays
- Fluorescence quantification
- Quantification of cellular transcript levels
- Cell growth rate determination
- Cellular ergosterol quantification
- In vitro transcription of Rnt1p substrates
- Rnt1p expression and purification
- In vitro Rnt1p substrate cleavage assay
- In vitro Rnt1p substrate mobility shift assay
Plasmid pCS182 was constructed by inserting the yEGFP3 PCR product into a modified version of pRS31654 harboring the GAL1-10 promoter via the unique restriction sites HindIII and XhoI located in the multiple cloning site (MCS) downstream of the GAL1-10 promoter. The Rnt1p expression plasmid (pRNT1) was constructed by inserting the RNT1 PCR product into the pProEx HT plasmid (Stratagene) via the unique restriction sites NcoI and XhoI located in the MCS downstream of the 5' (His)6 tag, the spacer region, and the rTEV protease cleavage site . A PCR product harboring the full ERG9 coding sequence through the 3' end of the ADH1 terminator was amplified from pCS321-ERG9 using forward and reverse primers ERG9hpADH1t-SalI_fwd_prmr (5' CAACGTCGACATGGGAAAGCTATTACARGtG_hpSADI ERG9hpADH1t-SalI_fwd_prmr) GTGTCGACTATATTACCCTGTTA TCCCTAGCGG). .
Supplementary Information
The regulatory roles of the galactose permease and kinase in the induction response of the GAL network in Saccharomyces cerevisiae. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. A small segment of the MAT alpha 1 transcript promotes mRNA decay in Saccharomyces cerevisiae: a stimulatory role for rare codons.
Introduction
We designed an initial Rnt1p CEB substrate randomization-based library and screened this library to identify a set of Rnt1p control modules that regulate expression levels through differential rates of Rnt1p processing (Chapter II). Here, we examined the role of a different critical Rnt1p substrate region, the BSB, in Rnt1p processing efficiency and thus gene regulatory activities. We generated a hairpin library based on BSB randomization to identify sequences that modulated Rnt1p binding affinity.
Results
- Design and selection of an Rnt1p binding library to achieve
- A synthetic Rnt1p binding library exhibits a range of gene
- Synthetic BSBs exhibit modular activity with different CEBs in
- In vitro characterization demonstrates that Rnt1p binding library
The range of regulatory activities involved by the binding library in the context of A02 CEB was measured at the protein and transcript levels. The gene regulatory activities of the binding library spanned an intermediate range of protein expression levels. Therefore, it is important to examine the effects of the binding library on the rate of Rnt1p processing.
Discussion
To demonstrate the ability to predictably combine BSB and CEB sequences, we examined the synthetic BSB sequences in the context of two synthetic CEBs generated in the splice library. Changes in the BSB sequence are expected to result in changes in the Rnt1p cleavage rate and to affect Rnt1p binding. The data indicate that nucleotide modifications in the BSB cause changes in affinity and cleavage rate; however, the exact contribution of each of these variables to the observed gene regulatory activity is unclear.
Materials and Methods
- Plasmid construction
- Library-scale yeast transformation
- FACS and sorted library retransformation
- Rnt1p substrate characterization assays
- Fluorescence quantification
- Quantification of cellular transcript levels
- In vitro transcription of Rnt1p substrates
- Rnt1p expression and purification
- In vitro Rnt1p substrate cleavage assay
- In vitro Rnt1p substrate mobility shift assay
After construction and sequence verification of the desired vectors, 100-500 ng of each plasmid was transformed into strain W303. 100 l of the culture was collected and the library hairpins were amplified by colony PCR with forward and reverse primers RntGap321_fwd and RntGap321_rev2, respectively. Elution of the protein was performed with an imidazole concentration of 150 mM in Ni2+ buffer and the protein was collected in 6 1-ml fractions.
Supplementary Information
Sequences and structures of a selected Rnt1p binding library and control hairpins containing the "parent" BSB. Structural basis for RNA tetraloop AGNN fold recognition by the double-stranded RNA binding domain of Rnt1p RNase III. Triplicate single-module switches resulted in an increase in switching from 1.93 to 5.57.
Introduction
We demonstrated three different strategies for tuning the quantitative properties of the device response curve based on the integration of different modules into the Rnt1p switch platform. Aptamer/CEB, BSB and multiple switching modules were used to modulate the EC50 value and switching activity of the device. Finally, we demonstrated that these modules can be implemented combinatorially in a predictable manner to further improve the regulatory response properties of the switch.
Results
- Design of a ligand-responsive RNA switch based on Rnt1p
- Replacement of the aptamer sequence modulates ligand
- Incorporation of synthetic BSBs modulates ligand responsiveness
- The application of multiple switch modules decreases theophylline
- Combined tuning strategies support the rational design of Rnt1p
Tuning the response curve of the Rnt1p switch through integration of different theophylline aptamers. Tuning the response curve of the Rnt1p switch through integration of different synthetic BSB modules. Predictive tuning of the Rnt1p switch response curve through integration of multiple copies of the switch module.
Discussion
Therefore, it is also expected that changing the aptamer sequence in the CEB will result in unpredictable changes in the baseline levels exhibited by the shift due to effects of the aptamer sequence on Rnt1p cleavage activity. Using this approach, we identified two synthetic BSB modules (B07 and B12) that increase the dynamic range and fold change of the switch response. Therefore, the data indicate that the relative activities of the BSB elements may be influenced by the stem sequence between the CEB and BSB modules.
Materials and Methods
- Plasmid construction
- Rnt1p substrate characterization assays
- Fluorescence quantification
- Quantification of cellular transcript levels
- In vitro transcription of Rnt1p substrates
- Rnt1p expression and purification
- In vitro Rnt1p substrate cleavage assay
The construction of the Rnt1p characterization plasmid, pCS321, and the Rnt1p expression plasmid, pRNT1, have been described previously (Chapter II). Two of the theophylline aptamer variants required individually designed primers: RSnt_fwd (5' ATGGTATGGATGAATTGTACAAATA AAGAGCCTAGGAAACAAACAAACTTGATGCCATTGG) and RS_rev for RSnt; and RS-theo2_fwd (5' ATGGTATGGATGAATTGTACAAATAAAGAGCCTAGGAAACA AACAAACTTGGCCCTTGGCA) and RS-theo2_rev (5' AAATTCGCTTATTTAGAAG TGGCGCGCCCCTCTCGAATTGTACAAAATAAAAGAGCCTAGGAAACA AACAAACTTGGCCCTTGGCA) and RS-theo2_rev (5' AAATTCGCTTATTTAGAAG TGGCGCGCCCCTCTCGAGTTTATTGTATTGTG) for gap repair. 250-500 ng of PCR product and 100 ng of plasmid digested with AvrII and XhoI were transformed into yeast strains.
Supplementary Information
The previously reported gene regulatory activity of the synthetic BSB modules selected for use in this study in the context of the Rnt1p hairpin genetic control element (A02). Previous work developed a library of short IRES sequences that base-pair with parts of the 18S rRNA under stressful conditions where cell viability was dependent on the IRES initiating translation of an auxotrophic gene product. We propose to design a library screen for short IRES sequences based on the placement of a 10-nt random sequence along six modules of the known active IRES.
Introduction
Furthermore, when multiple modules of this 9-nt sequence were placed in tandem, the amount of translation was significantly increased as the avidity of the region containing the 18S rRNA increased. In both studies, a dicistronic vector was constructed and the randomized library was placed in the intercistronic region (IR) such that positive IRESs could be selected by expression of the second cistron. Using the yeast -galactosidase, MEL120, we have developed a visual plate-based assay for screening a library of IRES modules.
Results
- Implementing internal ribosome sites as RNA-based gene
- Development of a plate-based screen for IRES activity
- Implementation of short sequential IRESes in tandem drives
- Design of an IRES library to achieve tunable gene regulatory
As an initial control for IRES activity, the YAP1 5′ UTR was inserted into the IR of the dicistronic vector to create pR-YAP1-M. The strength of the blue color is an indication of the amount of MEL1 protein being translated. Removal of cellular stress may explain the reduction in IRES activity in the quantification of multiple IRES modules through solution-based analysis.
Discussion and Future Work
The strength of an IRES is based on the location of base pairing with the 18S rRNA and the actual strength of that base pairing. On the other hand, reduced complementarity will also reduce the probability of interaction with 18S rRNA. Our design is based on a 7-module IRES, IRES47, where the seventh module would be randomly selected and screened for IRES activity (Figure 5.4).
Materials and Methods
- Plasmid and strain construction
- MEL1 quantification
- CyPET and YPET fluorescence distribution
Supplementary Information
Conclusions
