links.lww.com/JTO/A406

(1)

Supplementary Table 1. The primer sequences and annealing temperature for the PCR analysis and the restriction enzymes

SNP Sequences Annealing

Temperature (℃) Restriction Enzyme

rs2292832 Forward 5’- GTCTTCACTCCCGTGCTTGT -3’ 61 PvuII

Reverse 5’- GAGAGGCTGACGAGAGGCAT -3’

rs2910164 Forward 5’- TGGGTTGTGTCAGTGTCAGACC -3’ 62 Bsp1286I Reverse 5’- GAAGACTGGAGACAGAAGGCA -3’

rs1161491 3

Forward 5’- CCCTTCCCTTCTCCTCCAGATA -3’ 60 Hpy188I

Reverse 5’- CGAAAACCGACTGATGTAACTCCG -3’

rs3746444 Forward 5’- CAAAGTCTTCACTTCCCTGCCA -3’ 62 BclI

Reverse 5’- GATGTTTAACTCCTCTCCACGTGATC -3’

Supplementary Table 2. Associations between genotypes and clinicopathologic characteristics of patients with non-small cell lung cancer

(2)

SNP Age (years) Gender Smoking status Histologic type Pathologic stage Adjuvant therapy^b Genotype^a ≤63 >63 P^c M F P^c Never Ever P^c SCC AC P^c I II+IIIA P^c No Yes P^c rs2292832

TT 87 82 .98 131 38 .69 35 134 .73 92 73 .83 106 63 .68 34 29 .97

TC 75 70 112 33 33 112 84 59 84 61 33 28

CC 21 21 30 12 11 31 23 19 26 16 9 7

rs2910164

CC 79 64 .25 96 47 .002 45 98 .002 68 72 .03 86 57 .16 31 26 .59

CG 78 90 141 27 25 143 106 60 97 71 41 30

GG 28 23 40 11 12 39 27 23 37 14 6 8

rs11614913

CC 53 52 .98 77 28 .49 25 80 .84 62 42 .62 63 42 .95 23 19 .91

CT 93 88 138 43 42 139 95 81 112 69 39 30

TT 37 37 60 14 15 59 43 31 45 29 15 14

rs3746444

AA 124 120 .75 187 57 .76 55 189 .70 145 96 .09 149 95 .67 45 50 .05

AG 48 50 77 21 20 78 49 47 58 40 27 13

GG 10 7 12 5 5 12 6 10 12 5 4 1

a Patients with missing genotype date (7 for the rs2292832, 1 for the rs2910164, 3 for the rs11614913, and 4 for the rs3746444) were not included in the analysis.

b In pathologic stage II+ IIIA.

c Chi-square test.

Abbreviations: AC, adenocarcinoma; F, female; M, male; SCC, squamous cell carcinoma; SNP, single nucleotide polymorphism.

Supplementary Table 3. Multivariate analyses of the Prognostic Values of Various Factors

rs2292832T>C rs11614913C>T

(3)

Overall Survival Disease Free Survival Overall Survival Disease Free Survival

Variable HR(95% CI) P HR(95% CI) P HR(95% CI) P HR(95% CI) P

Age, year (≤63/>63) 1.50(1.06 - 2.11) 0.02 1.20(0.89 - 1.62) 0.24 1.46(1.04 - 2.05) 0.03 1.20(0.89 - 1.61) 0.24 Sex, male/female 0.54(0.25 - 1.16) 0.11 0.78(0.42 - 1.47) 0.44 0.54(0.25 - 1.16) 0.11 0.72(0.38 - 1.37) 0.32 Smoking status, never/ever 0.90(0.43 - 1.89) 0.77 0.88(0.47 - 1.66) 0.70 0.96(0.45 - 2.04) 0.91 0.84(0.45 - 1.57) 0.58 Histology, SQ/AD^a 1.51(1.03 - 2.22) 0.04 1.60(1.13 - 2.27) 0.01 1.62(1.11 - 2.36) 0.01 1.64(1.16 - 2.31) 0.01 Pathologic stage, I/II-IIIA 2.70(1.79 - 4.06) <.0001 3.08(2.15 - 4.41) <.0001 2.80(1.87 - 4.19) <.0001 2.98(2.08 - 4.25) <.0001 Adjuvant therapy, yes/no 0.95(0.61 - 1.48) 0.81 0.87(0.58 - 1.30) 0.49 0.90(0.58 - 1.41) 0.65 0.90(0.60 - 1.34) 0.59 Genotype, Dominant model^b 0.66(0.47 – 0.92) 0.01 0.64(0.48 – 0.87) 0.004 0.70(0.49 – 0.99) 0.05 0.66(0.48 – 0.90) 0.01 Abbreviations: AC, adenocarcinoma; HR, hazard ratio; SQ, squamous cell carcinoma.

aSix large-cell carcinomas were excluded from this analysis.

brs2292832, TC+CC vs. TT; and rs11614913, CT+TT vs. CC.