Supplementary Figures
Supp. Fig. 1. No changes of blood count and kidney function in 35 weeks old Thy1.1 mice.
Supp. Fig. 2. Mild kidney injury in 35 weeks old Thy1.1 mice.
Supp. Fig. 3. Tubulointerstitial fibrosis and inflammation in the Thy1.1 FSGS model.
Supp. Fig. 4. Characteristics of the Thy1.1 FSGS model.
Supp. Fig. 5. Ultrastructural analyses of the glomerular damage of the Thy1.1 FSGS model.
Supp. Fig. 6. Activation and proliferation of PECs during FSGS in Thy1.1 mice.
Supp. Fig. 7. PECs produced extracellular matrix during FSGS in Thy1.1 mice.
Supp. Fig. 8. Scheme of FSGS progression in Thy1.1 mice.
Supp. Fig. 9. Glomerular mRNA expression of Pdgfb and Pdgfrb in Thy1.1 FSGS mice.
Supp. Fig. 10. Glomerular mRNA expression of Pdgfb and Pdgfrb in Col4-/- Alport mice.
Supp. Fig. 11. Deletion of Pdgfb in podocytes reduces PEC activation in 5/6Nx mice.
Supp. Fig. 12. Reduced kidney damage after anti-PDGF-B antibody treatment.
Supplementary Tables
Supp. Table 1. Probes and opals used for FISH.
Supp. Table 2. Primers for reverse transcription-quantitative PCR.
Supp. Table 3. Blood pressure, body and kidney weight with blood and urine laboratory parameters of 35 weeks old male and female Thy1.1 mice.
Supp. Table 4. Comparison of parameters in 35 weeks old male and female Thy1.1 mice in cortex.
Supp. Table 5. Comparison of parameters in 35 weeks old male and female Thy1.1 mice in juxtamedullary area.
Supp. Table 6. Body, kidney weight and Blood pressure with parameters of male and female mice in Thy1.1 FSGS time course.
Supp. Table 7. Parameters of protein expression in tubulointerstitium for male and female mice in Thy1.1 FSGS time course.
Supp. Table 8. Comparison of podocin and glomerulosclerosis between male and female mice in Thy1.1 FSGS time course.
Supp. Table 9. Comparison of collagen IV and CD44 for male and female in Thy1.1 FSGS time course.
Supp. Table 10. Comparison of ki67, α-SMA and PDGFR-β expression in glomeruli for male and female mice during FSGS time course.
Supp. Table 11. mRNA expression of Pdgfb in podocytes and Pdgfrb in PECs in 5/6 Nx mice.
Page 59 of 72
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
Supplementary Figure 1. No changes of blood count and kidney function in 35 weeks old Thy1.1 mice.
(A-H) Blood count. No differences in body weight (I), kidney weight to body weight ratio (J), and blood pressure (K, L) were detected. (M) Proteinuria tended to be increased in Thymus cell antigen 1 (Thy1.1) mice (“Thy1.1”), while (N, O) serum urea and 24 hours urine volumes did not differ between Thy1.1 mice and wild type littermates (“WT”). (P) 24 hours creatinine clearance tended to increase in the Thy1.1 mice.
Red dots = female mice, blue dots = male mice. RBC = red blood cells, WBC = white blood cells, PLT = platelet count, HGB = hemoglobin, HCT = hematocrit, MCV = mean corpuscular volume, MCH = mean corpuscular hemoglobin, MCHC = mean corpuscular hemoglobin concentration.
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Supplementary Figure 2. Mild kidney injury in 35 weeks old Thy1.1 mice.
(A, A’) Representative images of a PAS-stained kidney section with annotations of the cortical region in which the glomeruli were analyzed. When analyses included all the glomeruli in the whole cortex, the number of glomeruli with sclerosis was significantly increased in Thymus cell antigen 1.1 (Thy1.1) mice (“Thy1.1”) compared to the wild-type mice (“WT”) (B), while there Page 61 of 72
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
Glomeruli with Cluster of Differentiation 44 positive (CD44+) parietal epithelial cells(PECs) tended to be increased. When the analyses were limited to the glomeruli in the juxtamedullary area, Thy1.1 mice exhibited more glomerulosclerosis (A’) and the collagen IV (B’) in the tuft.
(D’) Podocin expression in the Thy1.1 mice was also non-significantly reduced (p = 0.061). (E’) The glomeruli with CD44 expressed in the PECs were significantly increased in the Thy1.1 transgenic mice. Scale bars represent 20 µm. * P<0.05, ** P<0.01 vs wild-type mice. Red dots
= female mice, blue dots = male mice.
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Supplementary Figure 3. Tubulointerstitial fibrosis and inflammation in the Thy1.1 FSGS model.
(A) Quantification of staining in the cortex and (A’-A’’’’) representative immunohistochemistry images showed the increase of collagen III expression in the tubulointerstitium during the disease. Collagen IV (B) and Platelet-derived growth factor receptor β (PDGFR-β) (C) expanded in the cortex, which is also shown in the immunohistochemistry pictures (B’-B’’’’, C’- C’’’’). (D) The macrophage marker F4/80 was significantly upregulated in the cortex during the disease. (D’-D’’’’) Immunohistochemistry pictures for F4/80 in the time course. Scale bars represent 20 µm. * P<0.05, ** P<0.01, # P<0.0001 vs day0. Red dots = female mice, blue dots
= male mice.
Page 63 of 72
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
Supplementary Figure 4. Characteristics of the Thy1.1 FSGS model.
(A) Diastolic blood pressure (“BP”) during Thy1.1 time course. (B) Morphological changes of podocin expression at day1 after injection of anti-Thy1.1 antibody. (C) The number of podocin+ glomeruli was significantly decreased from day7. Parietal epithelial cells (PECs) vacuolization (D) and hypertrophy (D’) were observed in PAS-stained section at day1 and day3, respectively.
(E) The number of glomeruli with collagen IV (“col. IV”) expression in Bowman’s space was significantly increased during the time course. Arrows point the PECs. * P<0.05, ** P<0.01 vs day0. Red dots = female mice, blue dots = male mice.
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Supplementary Figure 5. Ultrastructural analyses of the glomerular damage of the Thy1.1 FSGS model.
(A-E) Podocyte foot processes are lining the glomerular basement membrane at day0 and they were fused from day1 until day100. PECs were lining in the bowman’s capsule (F,G) and got hypertrophic at day3 (H, arrow) with increased nuclear size (I, arrow). Tip lesions with connections between PECs and the glomerular tuft were present from day7 (I, arrowhead). (F- J). PEC vacuolization was detected at day1 and day7 (K, L asterisk), and Bowman’s space was full with many small black dots indicating podocyte stress (K, asterisk). Podocyte surface was not smooth but irregular (M, arrow). Scale bars represent 1 µm (A-E, M), 2.5 µm (G, K), 5 µm (J, L) and 10 µm (H, I).
Page 65 of 72
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
Supplementary Figure 6. Activation and proliferation of PECs during FSGS in Thy1.1 mice.
(A) A representative picture from Cluster of differentiation 44 (CD44) immunostaining from day3 of the disease shows activation of PECs (arrow). (B) The number of the glomeruli (“glom.”) with CD44 positive parietal epithelial cells (PECs) was significantly increased. (C) Double staining of CD44 and Ki67 confirmed that activated PECs proliferated during the disease (arrows). Glomeruli with the Ki67+ PECs were significantly increased (D) and there were more glomeruli with more than three proliferating PECs at day3 and day7, while more glomeruli with less than three proliferating PECs were counted at day0, day1 and day 100 (E). Scale bars represent 100 µm or 20 µm. * P<0.05, # P<0.0001 vs day0. Red dots = female mice, blue dots
= male mice.
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Supplementary Figure 7. PECs produced extracellular matrix during FSGS in Thy1.1 mice.
Representative pictures from LKIV69 immunostaining. LKIV69 positivity was only detected in Bowman’s capsule at day0 and day1 (A-B). LKIV positive matrix was upregulated and de novo expressed by PECs in bowman’s space from day3 to day100 (C-G, arrows). Scale bars represent 20 µm.
Page 67 of 72
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
Supplementary Figure 8. Scheme of FSGS progression in Thy1.1 mice. Parietal epithelial cells (PECs) were undergoing three phases during development of FSGS, i.e., activation reflected by CD44+ PECs glomeruli (day0-day3), proliferation reflected by Ki67+ PECs glomeruli (day3-day7), and phenotype switch reflected by α-smooth muscle actin positive (α- SMA+) and Platelet-derived growth factor receptor β positive (PDGFR-β+) PECs glomeruli (day7-day100) leading adhesions and FSGS formation (day7-day100). The kidney function was progressive decreased reflected by decline of creatinine clearance (day1 to day100).
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Supplementary Figure 9. Glomerular mRNA expression of Pdgfb and Pdgfrb in Thy1.1 FSGS mice.
(A) Picture showing FISH of Pdgfb and Pdgfrb for glomeruli at day100. Podocytes expressed low Pdgfb (B), while parietal epithelial cells (PECs) still expressed Pdgfrb (C) but not as much as during early time points. (D) Nuclear mRNA dots of Pdgfb in podocyte was significantly increased at day3 and day7. (E) Pdgfrb nuclear dots was significantly increased at day7 and day14. Three mice were analyzed per time point and five glomeruli were counted for each mouse. The same color represents the same mouse. Arrows point the podocyte or PEC. Scale Bars represent 20 µm or 10 µm.
Page 69 of 72
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
Supplementary Figure 10. Glomerular mRNA expression of Pdgfb and Pdgfrb in Col4-/- Alport mice.
(A) Representative picture of one sclerotic glomerulus in PAS stain and the same glomerulus stained by in situ hybridization (B). mRNA expression of Pdgfb in podocyte (B, B’, arrow) and Pdgfrb in PECs (B, B’’, arrow) were upregulated in Alport mice. Scale Bars represent 20 µm or 10 µm.
Supplementary Figure 11. Deletion of Pdgfb in podocytes reduces PEC activation in 5/6Nx mice.
Transgenic mice with genetic deletion of Pdgfb in podocytes were generated using the Cre- LoxP system (A). The number of glomeruli with CD44+ PECs was significantly reduced in these mice after 5/6Nx compared to 5/6Nx mice with normal PDGFB expression (WT). * P<0.05.
5/6 WT = 5/6 nephrectomy in wild type mice, 5/6 -/- = 5/6 nephrectomy in mice with podocyte- specific Pdgfb deletion, sham -/- = sham operated mice with podocyte-specific Pdgfb deletion, blue dots = male mice.
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Supplementary Figure 12. Reduced kidney damage after anti-PDGF-B antibody treatment.
For the short-term therapy (day7), no difference of urine albumin-creatinine ratio was detected between both groups. The number of glomeruli (“glom.”) with Cluster of Differentiation 44 (CD44) positive parietal epithelial cells (PECs) (B) and Ki67+ PECs (C) as well as α-SMA in Bowman’s space (D) was significantly reduced in the anti-PDGF-B antibody therapy group (“Anti-B”) compared to the IgG control group (“IgG”), respectively. For the long-term therapy (day21), the urine albumin-creatinine ratio was decreased after anti-PDGFB therapy. The number of glomeruli with CD44+ PECs (F), Ki67+ PECs (G) and α-SMA in Bowman’s space (H) was significantly reduced after anti-PDGF-B treatment, respectively. * P<0.05, ** P<0.01,
$ P<0.001, vs control IgG. Red dots = female mice, blue dots = male mice.
Page 71 of 72
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
Supplementary Table 1: Probes and opals used for FISH.
Pdgfb (platelet-derived growth factor b), Pdgfrb (platelet-derived growth factor receptor beta).
Probes Channel Supplier
Mouse Pdgfb probe C1 Bio-Techne (Minneapolis, USA) Mouse Pdgfrb probe C2 Bio-Techne (Minneapolis, USA) Human PDGFB probe C1 Bio-Techne (Minneapolis, USA) Human PDGFRB probe C2 Bio-Techne (Minneapolis, USA)
Opals Wavelength
OpalTM 520 520 nm Bio-Techne (Minneapolis, USA) OpalTM 690 690 nm Bio-Techne (Minneapolis, USA)
Supplementary Table 2: Primers for reverse transcription-quantitative PCR.
Cd44 (Cluster of Differentiation 44), Cldn1 (Claudin 1), Gapdh (Glyceraldehyde 3-phosphate dehydrogenase).
Gene Forward primer Reserve primer
Cd44 TCCGAATTAGCTGGACACTC CCACACCTTCTCCTACTATTGAC Cldn1 TTCGTACCTGGCATTGACTGG TTCGTACCTGGCATTGACTGG Gapdh GGCAAATTCAACGGCACAGT AGATGGTGATGGGCTTCCC 3
4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Supplementary Table 3: Blood pressure, body and kidney weight with blood and urine laboratory parameters of 35 weeks old male and female Thy1.1 mice.
35 weeks old male (n=3) and female (n=6) wild-type mice and Thy1.1 male (n=5) and female (n=5) mice were analyzed. * P < 0.05 male vs. female (same genotype). BP (blood pressure), SD (standard deviation)
Wild-type male (Mean ± SD)
Wild-type female (Mean ± SD)
Thy1.1 male (Mean ± SD)
Thy1.1 female (Mean ± SD)
RBC [x106/ul] 5.8 ± 2.0 8.1 ± 0.7 9.6 ± 3.0 8.4 ± 0.8
WBC [x103/ul] 2.3 ± 0.7 2.7 ± 1.1 7.6 ± 5.8 2.8 ± 1.0
PLT [x103/ul] 636 ± 327 920 ± 132 995 ± 95 997 ± 146
HGB [g/dl] 5.8 ± 2.0 8.1 ± 0.7 8.2 ± 1.0 8.4 ± 0.8
HCT [x103/ul] 25.3 ± 7.7 34.7 ± 4.0 35.2 ± 3.2 35.6 ± 2.7
MCV [pg] 43.9 ± 3.5 42.7 ± 1.6 43.1 ± 2.0 42.5 ± 0.8
MCH [fl] 14.8 ± 0.8 15.1 ± 0.7 15.1 ± 0.7 15.2 ± 0.4
MCHC [g/dl] 33.7 ± 1.0 35.3 ± 0.7 34.9 ± 0.6 35.8 ± 0.6
Body weight [g] 38.7 ± 4.3 30.1 ± 6.6 36.0 ± 8.1 29.4 ± 5.4
Kidney/body weight 0.006 ± 0.0004 0.006 ± 0.001 0.006 ± 0.0007 0.006 ± 0.0007 Systolic BP [mmHg] 122.3 ± 8.5 * 154.0 ± 11.1 136.4 ± 18.5 151.4 ± 8.8 Diastolic BP [mmHg] 88.3 ± 9.7 * 117.5 ± 15.3 99.4 ± 17.9 116.4 ± 8.0 Proteinuria [mg/24h] 0.8 ± 0.6 0.3 ± 0.5 1.6 ± 2.0 0.9 ± 0.8 Serum urea [mmol/l] 13.0 ± 1.2 12.1 ± 1.9 11.3 ± 2.7 12.0 ± 2.1
Urine [ml/24h] 1.8 ± 0.8 1.0 ± 0.5 1.4 ± 1.2 2.6 ± 2.6
Creatinine clearance [ml/24h]
307 ± 26 * 205 ± 69 312 ± 144 297 ± 98
Page 73 of 72
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
Supplementary Table 4: Comparison of parameters in 35 weeks old male and female Thy1.1 mice in cortex.
Collagen IV deposition in tuft was significantly increased in Thy1.1 male mice compared with Thy1.1 female mice. 35 weeks old male (n=3) and female (n=6) wild-type mice and Thy1.1 male (n=5) and female (n=5) mice were analyzed. * P < 0.05 male vs. female (same genotype);
# P < 0.05 wild-type vs. Thy1.1 (same gender).
Wild-type male (Mean ± SD)
Wild-type female (Mean ± SD)
Thy1.1 male (Mean ± SD)
Thy1.1 female (Mean ± SD) Sclerotic glomeruli [%] 1.0 ±1.2 # 2.1 ± 3.6 8.3 ± 4.9 2.8 ± 2.4 Collagen IV in tuft [%] 10.9 ± 0.1 * # 15.4 ± 1.3 # 17.1 ± 2.3 * 10 ± 4.1 Podocin in tuft [%] 23.8 ± 7.0 16.6 ± 9.5 18.0 ± 8.1 13.9 ± 6.3 Glomeruli with CD44 in PECs [%] 3.1 ± 4.2 3.3 ± 4.1 10.2 ± 5.8 4.3 ± 3.1
Supplementary Table 5: Comparison of parameters in 35 weeks old male and female Thy1.1 mice in juxtamedullary area.
The number of sclerotic glomeruli was significantly increased in Thy1.1 male mice in comparison to Thy1.1 female mice. 35 weeks old male (n=3) and female (n=6) wild-type mice and Thy1.1 male (n=5) and female (n=5) mice were analyzed. * P < 0.05 male vs. female (same genotype); # P < 0.05 wild-type vs. Thy1.1 (same gender).
Wild-type male (Mean ± SD)
Wild-type female (Mean ± SD)
Thy1.1 male (Mean ± SD)
Thy1.1 female (Mean ± SD) Sclerotic glomeruli [%] 1.0 ± 1.2 # 2.8 ± 4.3 9.1 ± 4.7 * 2.9 ± 2.3 Collagen IV in tuft [%] 14.9 ± 2.6 # 18.2 ± 6.2 27.3 ± 7.8 18.5 ± 7.2 Podocin in tuft [%] 23.7 ± 4.5 # 20.7 ± 5.0 17.0 ± 2.1 18.9 ± 4.1 Glomeruli with CD44 in PECs [%] 7.5 ± 13.0 11.2 ± 13.2 40.2 ± 21.0 21.1 ± 17.6 3
4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Supplementary Table 6: Body, kidney weight and Blood pressure with parameters of male and female mice in Thy1.1 FSGS time course.
Body weight of male mice were higher compared with female mice at day1, day7 and day100.
Kidney weight and body wight ratio in male mice was increased compared with female mice at day1. Serum urea was significantly increased in male mice at day1 and day100 in comparison to female mice. day0: male (n=2) female (n=2); day1, 3, 7, 14, 21: male (n=3), female (n=3);
day100: male (n=5), female (n=5). * P <0.05 male vs. female (same time point). Blood pressure could not be measured at day1 and no urine were collected for 3 male mice at day1.
Body weight [g]
(Mean ± SD)
Kidney/body weight [x 10-3] (Mean ± SD)
Diastolic blood pressure [mmHg] (Mean ± SD)
Male Female Male Female Male Female
d0 21.0 ± 1.6 16.1 ± 0.1 7.6 ±0.1 6.5 ±0.1 105 ± 13 97 ± 1
d1 24.6 ± 1.1 * 18.9 ± 0.6 10.1 ± 1.0 * 7.2 ± 0.6
d3 20.3 ± 0.6 18.2 ± 3.3 8.2 ± 2.3 6.8 ± 1.3 111 ± 18 95 ± 5
d7 20.3 ± 1.1 * 14.4 ± 1.0 9.5 ± 0.5 9.3 ± 1.2 111 ± 11 103 ± 4
d14 20.1 ± 0.5 16.4 ± 2.6 7.5 ± 1.2 6.6 ± 1.7 113 ± 19 110 ± 2
d21 20.7 ± 1.2 18.4 ± 2.0 6.5 ± 0.5 6.0 ± 1.0 119 ± 6 123 ± 23
d100 23.0 ± 1.3 * 21.1 ± 1.7 5.2 ± 0.5 5.3 ± 0.8 114 ± 21 133 ± 18 Serum urea [mmol/l]
(Mean ± SD)
Proteinuria [mg/24h]
(Mean ± SD)
Creatinine clearance [ml/24h]
(Mean± SD)
Male Female Male Female Male Female
d0 13 ± 1.9 12 ± 0.07 8.9 ± 3.0 2.2 ± 0.6 308 ± 144 315 ± 30
d1 55 ± 9.1 * 22 ± 0.9 41 ± 25 143 ± 39
d3 34 ± 23 21 ± 7.6 20 ± 7.7 15 ± 3.5 66 ± 31 74 ± 52
d7 19 ± 6.7 35 ± 39 26 ± 3.0 21 ± 11 94 ± 48 78 ± 64
d14 17 ± 2.6 37 ± 38 16 ± 1.0 11 ± 13 127 ± 31 121 ± 98
d21 21 ± 8.5 21 ± 3.3 12 ± 6.1 5.3 ± 4.4 123 ± 37 94 ± 37
d100 25 ± 6.3 * 15 ± 2.5 4.4± 4.0 2.1± 3.4 150 ± 68 135 ± 49
Page 75 of 72
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
Supplementary Table 7: Parameters of protein expression in tubulointerstitium for male and female mice in Thy1.1 FSGS time course.
Male mice expressed more PDGFR-β in tubulointerstitium at day100 compared with female mice. No differences of tubulointerstitial inflammation between male and female mice was detected during FSGS. day 0: male (n=2) female (n=2); day 1, 3, 7, 14, 21: male (n=3), female (n=3); day 100: male (n=5), female (n=5).
Collagen III [%]
(Mean ± SD)
Collagen IV [%]
(Mean ± SD)
PDGFR-β [%]
(Mean ± SD)
F4/80 [%]
(Mean ± SD)
Male Female Male Female Male Female Male Female
d0 1.2±0.4 1.9±0.8 6.1±0.4 3.9±0.0 5.1±3.7 3.5±2.4 0.00 ±0.00 0.01±0.00 d1 0.8±0.1 1.3±0.8 4.2±2.2 7.0±2.8 5.3±0.9 5.1±1.7 0.05±0.01 0.04±0.01 d3 0.6±0.1 2.2±1.1 9.2±3.9 9.9±1.2 6.6±2.5 7.0±2.7 0.17±0.15 0.13±0.07 d7 3.8±3.0 2.6±1.9 13.5±4.3 11.8±3.7 8.2±1.5 12±5.0 0.22±0.00 0.12±0.07 d14 6.6±2.6 5.6±2.6 14.2±4.9 16.5±5.0 5.3±3.4 11±5.2 0.57±0.22 0.18±0.14 d21 4.0±0.3 3.3±1.8 12.9±5.5 12.3±1.0 9.3±2.0 7.7±2.9 0.51±0.40 0.38±0.17 d100 7.7±7.4 6.3±4.2 20.8±15.8 11.1±6.2 12±2.9 * 8.4±2.3 1.6±1.2 0.52±0.41
Supplementary Table 8: Comparison of podocin and glomerulosclerosis between male and female mice in Thy1.1 FSGS time course.
No differences of podocin expression in glomeruli and FSGS between female and male were found during FSGS in Thy1.1 time course. day 0: male (n=2) female (n=2); day 1, 3, 7, 14, 21:
male (n=3), female (n=3); day 100: male (n=5), female (n=5).
Podocin in tuft [%]
(Mean ± SD)
Podocin+ glomeruli [%]
(Mean ± SD)
Sclerotic glomeruli [%]
(Mean ± SD)
Male Female Male Female Male Female
d0 18 ± 1.7 24 ± 7.5 99 ± 1.4 100 ± 0.0 0.6 ± 0.8 0.5 ± 0.7 d1 14 ± 2.9 16 ± 1.4 100 ± 0.6 99 ± 1.0 0.3 ± 0.5 0.0 ± 0.0 d3 15 ± 3.2 14 ± 4.5 100 ± 0.0 100 ± 0.0 0.8 ± 0.9 3.5 ± 1.8
d7 11 ± 4.3 10 ± 8.6 63 ± 40 91 ± 8.6 15 ± 6.5 34 ± 32
d14 16 ± 8.4 11 ± 9.7 69 ± 20 57 ± 35 42 ± 13 44 ± 44
d21 9.9 ± 0.6 11 ± 2.4 66 ± 14 59 ± 14 51 ± 6.3 44 ± 9.6
d100 11 ± 5.9 16 ± 6.8 74 ± 18 73 ± 33 59 ± 16 35 ± 24
3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60
Supplementary Table 9: Comparison of collagen IV and CD44 for male and female in Thy1.1 FSGS time course.
The number of CD44+ glomeruli was significantly increased at day100 compared with female mice. day 0: male (n=2) female (n=2); day 1, 3, 7, 14, 21: male (n=3), female (n=3); day 100:
male (n=5), female (n=5). * P <0.05 male vs. female (same time point).
Collagen IV in tuft [%]
(Mean ± SD)
Glomeruli with collagen IV in Bowman’s space [%]
(Mean ± SD)
CD44 per glomerulus [score] (Mean ± SD)
CD44+ glomeruli [%]
(Mean ± SD)
Male Female Male Female Male Female Male Female
d0 19 ± 2.7 2.5 ± 1.0 0.7 ±0.6 0.0 ± 0.0 0.03 ± 0.01 0.00 ± 0.00 1.2 ± 0.9 0.0 ± 0.0 d1 18 ± 6.1 9.2 ± 6.0 2.7 ± 0.5 0.6 ± 0.6 0.07 ± 0.04 0.02 ± 0.04 3.5 ± 1.0 1.4 ± 2.4 d3 15 ± 2.1 17 ± 4.2 3.0 ± 1.8 9.0 ± 11 0.39 ± 0.27 0.78 ± 0.19 26 ± 16 38 ± 6.7 d7 18 ± 2.1 20 ± 9.4 25 ± 16 35 ± 36 1.7 ± 0.77 1.0 ± 0.80 51 ± 11 54 ± 35 d14 24 ± 8.5 28 ± 8.3 42 ± 18 51 ± 40 1.1 ± 0.23 1.2 ± 0.96 49 ± 15 53 ± 40 d21 24 ± 12 31 ± 1.1 50 ± 13 50 ± 8.9 1.2 ± 0.41 0.67 ± 0.06 56 ± 17 39 ± 3.4 d100 33 ± 9.4 34 ± 16 61 ± 23 35 ± 27 1.0 ± 0.67 0.35 ± 0.42 54 ± 23 * 18 ± 17
Supplementary Table 10: Comparison of Ki67, α-SMA and PDGFR-β expression in glomeruli for male and female mice during FSGS time course.
Ki67 expression per glomerulus and Ki67+ glomeruli were significantly increased at day14 in comparison to female mice. day 0: male (n=2) female (n=2); day 1, 3, 7, 14, 21: male (n=3), female (n=3); day 100: male (n=5), female (n=5). * P <0.05 male vs. female (same time point).
Ki67 per glomerulus (Mean ± SD)
Ki67+ glomeruli [%]
(Mean ± SD)
Glomeruli with α- SMA in Bowman’s
space [%]
(Mean ± SD)
Glomeruli with PDGFR- β in Bowman’s space
[%] (Mean ± SD)
Male Female Male Female Male Female Male Female
d0 0.18±0.02 0.03±0.03 14±5.1 2.1±1.6 1.3±0.0 0.0±0.0 3.1±1.1 1.9±0.2 d1 0.15±0.11 0.04±0.01 12±7.9 3.9±0.5 1.3±1.2 1.2 ±2.1 2.4±1.5 0.6±0.5 d3 0.52±0.44 1.1±0.04 26±21 43±5.6 3.7±2.8 5.0±6.7 0.9±0.4 3.1±3.3
d7 1.7±0.82 1.2±0.9 48±15 43±17 35±23 43±33 18±8.9 23±26
d14 0.61±0.11 * 0.30±0.03 32±2.4 * 18±4.2 50±16 54±37 33±6.8 37±24 d21 0.47±0.09 0.26±0.12 30±3.2 19±6.6 53±12 40±7.3 37±3.6 32±6.8 d100 0.20±0.07 0.11±0.08 12±5.1 7.1±4.3 23±19 43±14 57±19 33±19 Page 77 of 72
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58
Supp. Table 11: mRNA expression of Pdgfb in podocyte and Pdgfrb in PECs in 5/6 Nx mice.
Nuclear mRNA dots of Pdgfb in podocytes and Pdgfrb in PECs were increased in 5/6Nx (n=5) compared with sham (n=3) mice.
WT (mouse) 5/6Nx (mouse)
No. 1 No. 2 No. 3 No. 1 No. 2 No. 3 No. 4 No. 5 Pdgfb in podocyte
(Mean ± SD)
1.6±
0.63
1.0±
0.57
1.1±
0.48
1.0±
0.54
4.2±
2.98
0.90±
0.40
2.8±
1.41
2.1±
0.76 Pdgfrb in PECs
(Mean ± SD)
0.86±
0.49 0.73±
0.55 1.1±
0.72 0.45±
0.43 3.2±
1.87 0.36±
0.25 1.2±
0.71 1.7±
1.83 3
4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60