Pre-mRNA splicing in yeast 1. Mutations in conserved intronic sequences affect 36 multiple steps in the yeast splicing pathway. especially spliceosome assembly. The extensive genetic repertoire of the yeast Saccharomyces cerevisiae allows the isolation and characterization of mutants in the splicing pathway. Sequences in pre-mRNAs recognized for spliceosome formation are found near intron boundaries.
Point mutation in the conserved AG sequence of yeast intron affects only the second step of the splicing reactions (Vijayraghavan eta/., 1986). The length of the pre-mRNA per se affects later stages of spliceosome assembly (Rymond et al., 1987). A fraction of the labeled protein does associate with 40S spliceosomes; this association is dependent on the presence of splicing signals in the pre-mRNA.
These follow-up experiments also established a requirement for A TP in the second step of the splicing reaction. Mutations in conserved intron sequences affect multiple steps in the yeast splicing pathway, particularly spliceosome assembly.
1 REACTION2
Mutations in conserved intron sequences affect several steps in the yeast splicing pathway, particularly assembly of the spliceosome. We previously reported that this sequence can act as a branch point in the absence of the authentic TACTAAC box (Cellini et al., 1986). These include: 1) changing the first base of the intron from G to A or C (referred to as A1 and C1);
In the latter case, we can thus also conclude that the position of the 5' cleavage is unchanged as a result of mutation in the indicated positions. We first analyzed the ability of the mutant substrates to be spliced in vitro. Consistent with this observation, T1 oligonucleotide from the intron-exon2 junction ACACG was not seen in the T1 fingerprint of the mutant intron (Figure 7b).
These results are in dramatic contrast to the behavior of the mutant C303/305 transcript at the 3' splice site. In the second step, the 3' exon joins the 5' exon, which is accompanied by the release of the intronic lariat. An example for this experiment is the oligonucleotide, 5' AATTCITCTTACAGTTAAATGG 3', which hybridizes to the intron 46 nucleotides 3' 5' of the splice site (see scheme).
The primer for this experiment is the 24mer, 5' CTAAACATATAATATAGACACAAA 3', which hybridizes to the 3' end of the intron.
Most complementation groups share a phenotype of pre-mRNA accumulation, a phenotype also observed in all prp (rna)2-11 mutants. One class consisting of two complementation groups shows accumulation of the lariat splicing intermediate without changes in pre-mRNA levels. Except for two complementation groups, all other groups contain alleles in which co-segregation of the ts defect and splicing phenotype is observed.
The formation of the spliceosome is necessary for the splicing reaction, and its assembly requires the presence of appropriate splicing signals in the pre-mRNA. An important aspect of research in pre-mRNA splicing is the identification and determination of the function of the splicing machinery. These experiments confirm the accumulation of the lariat intermediate of the actin transcript (Fig. 3B, lanes d and e).
Co-segregation of the splicing phenotype with the ts defect was also analyzed for all the new complementation groups. Presence of the splicing defect in the ts spores is indicative of co-segregation of the two phenotypes. An analysis of the RNA in diploids similar to that done for the intron mutants was performed.
One class accumulates a lariat splicing intermediate, and the other accumulates a relaxed lariat intron, with no significant increase in pre-mRNA. Most of the new complementation groups had the same phenotype of pre-m.RNA accumulation as seen in prp2-11 mutants. These mutations, which result in pre-mRNA accumulation, may define components that are themselves part of the splicing machinery.
Finally, we have isolated more splicing mutants that affect various stages of the splicing pathway. In cases where necessary, complementation of the rna phenotype in the diploids was assessed by northern analysis. The detection of the mRNA and the pre-mRNA was done with the labeled fragment of the actin clone.
PRP 18
We have previously shown that at the restrictive temperature in vivo an accumulation of the lariat cleavage intermediate occurs. The isolation of this mutant as a temperature-sensitive lethal agent has also facilitated the cloning of the wild-type allele by complementation. The specificity of splice junction selection and exon juxtaposition is achieved by the recognition of these cis-acting conserved elements in the intron by cellular factors that include proteins and small nuclear ribonucleoprotein particles (snRNPs) (reviewed in Sharp, 1987; Maniatis and Reed 1987).
The development of in vitro splicing systems has led to considerable progress in the elucidation of the pathway of nuclear pre-rnRNA splicing (reviewed in Padgett et al., 1986; Green 1986). First, the pre-mRNA is cleaved at the 5' splice junction and this leads to the formation of a lariat intron-exon2 structure in which the first base of the intron is covalently linked to a specific adenosine near the 3' splice site. The spliced exon1 and the lariat intron exon2 are the intermediate products of the splicing reaction.
The second reaction involves cleavage at the 3' splice site and splicing of the two exons to produce the mature mRNA and lariat intron. The complexity of the splicing reaction and the large particle within which the reactions occur suggests the need for multiple functions. Such an approach has taken advantage of the availability of a series of temperature-sensitive mutations ( rna2 toll ) that affect pre-mRNA splicing in vivo (reviewed in Warner 1987 ; Vijayraghavan and Abelson 1988 ).
Consistent with the in vivo observation of pre-mRNA accumulation at non-permissive temperature in all the prp 2- 11 strains, inactivation of both steps of splicing was observed upon heating of splicing extracts from several groups (Lustig et al., 1986 ). In addition, it has been demonstrated that most of the PRP gene products are required for spliceosome formation itself (Lin et al., 1987). Further analysis of the PRP gene products will likely reveal their precise role in the splicing machinery and determine whether they are homologues of protein factors required in higher eukaryotic spliceosomes.
A combination of biochemical and molecular analysis has been initiated to investigate the role of PRP 18 in splicing. We report that a mutation in one of the previously hypothesized yeast splicing factors results in lariat intermediate accumulation. The isolation of this new mutation as a temperature-sensitive lethal allowed the cloning of the wild-type PRP 18 locus.
RESULTS
Mixing the treated wild-type extract and the inactivated prp18 extract restores splicing activity ( Fig. 2 , lane 5). This experiment demonstrates the need for A TP in the second step of the cleavage reaction. The close association of the lariat accumulation phenotype with the ts lethality in the prp18 strains (Vijayraghavan, Company, and Abelson; manuscript submitted) allows cloning of the wild-type gene product.
Retransformation of the prp18 strain with these plasmids from the yeast library after propagation in E. Transformation of the clone into a ts prp strain other prp18 does not result in complementation of other mutation. Selection was made for URA colonies after transformation of the linearized DNA into the wild-type temperature-resistant strain SS330.
This analysis shows the integration of the cloned DNA with the homologous chromosomal locus of PRP 18. The chase of splicing intermediates is achieved with some inefficiency in the presence of complementary factors. This component must be interchangeable with the mutated protein even after the assembly of the spliceosome.
Experiments with prpl8 spliceosome trapping reconfirmed the requirement of the PRP 18 gene product for splicing completion. The correlation between the appearance of the mRNA and the reduction of the lariat intermediate supports our belief that trapping of intermediates occurs. These studies indicated that the cloned DNA is the wild-type PRP 18 locus and not a suppressor of the ts and splicing phenotype.
The conversion of the lariat intermediate and exon into products - lariat intron and mRNA was characterized as a capture reaction. The RNAJJ protein is associated with the yeast spliceosome and is localized at the periphery of the cell nucleus. The migration position of the lariat intermediate (IVS*E2), lariat intron (IVS*), spliced exons (mRNA) and exon (El) is shown in the figure.
I -IVS*
The hunting of the intermediates in the spliceosome was performed as described in Materials and Methods. The products of the chasing reaction, the lariat intron (IVS*) and the spliced exons (mRNA), are indicated in the figure. However, in vitro some of the lariat intron is associated with snRNPs in large complexes that resemble the spliceosome.
The release of the intron as a particle explains the protection of in vitro generated intron against the effective debranchase present in HeLa cell extracts. This suggested to us that some of the excised introns are missing nucleotides 3' to the branch site. The excised intron consisted of four different shapes: two branched molecules and two linear forms of the intron.
They revealed the presence of three different forms of the actin intron in this mutant strain (Fig. 1B). The presence of the circular intron is likely due to nucleolytic digestion of the nucleotides 3' to the branch site. The stabilization of the branched intron in the cell where it is normally degraded suggests that it exists in an intracellular complex.
A second gradient of an in vitro splicing reaction with labeled pre-mRNA provided a marker for the position of the 40S spliceosome. The presence of all forms of the intron in the same region of the gradient suggested that they may exist in the same complex. The detection of mostly branched intron in the mutant strain prp26, in large complexes, reinforces the theory that the stabilization of the intron is due to association with spliceosomal snRNPs.
These analyzes imply that the stabilization of the intron in this mutant strain occurs through association in a large post-splicing complex. In the mutant extracts, this ratio is almost equal to one, due to the stabilization of the intron. Xhol-Clal fragment of the actin intron tagged by random primer extension (Feinberg and Vogelstein 1983).
IVS*E2 -IVS*
