INTRODUCTION
Malaria is a serious mosquito-borne disease that accounted for 429,000 deaths in 2015 across the globe, according to WHO estimates1. After bite of Plasmo- dium infected mosquito, the sporozoite enters the blood stream and reaches liver, where it divides and releases merozoites into blood stream infecting the RBCs2-3. The symptoms of the disease like fever, anaemia, and neuro- logical pathology, etc. appear during the blood stages of the infection4. Plasmodium falciparum causes more deaths as compared to other human malarial parasites1. Plasmodium resides in the host RBC, protecting itself from immune system5 and thrives on nutrients it trans- ports6-8. It also utilizes the amino acids by degrading the haemoglobin9 and converting it into haemozoin10, which is non-toxic to parasite11. One of the disease manifesta- tions in malaria is hypoarginemia. The level of L-arginine
varies with the disease severity12. L-arginine, a semi-es- sential amino acid, is known to play an important role in cell division, growth and immune regulation13-14. It acts as substrate for arginase and nitric oxide synthase (NOS) required for the production of L- citrulline and ni- tric oxides15. L-citrulline, a non-protein amino acid, can be recycled back to L-arginine, in vivo in the presence of cytoplasmic enzymes, argininosuccinate synthetase (ASS) and argininosuccinate lyase (ASL); thus, replen- ishing the arginine pool16-17. Like L-arginine, L-citrulline can be utilized by macrophages without affecting their functions18-19.
Arginase converts L-arginine into ornithine and urea15. Production of ornithine helps cell proliferation and growth20. During immune activation the requirement of L-arginine increases and hence, its supplementation boosts immune system21. It increases the phagocytic ac- tivity of neutrophils22 . When the availability of arginine
Effect of L-arginine on the growth of Plasmodium falciparum and immune modulation of host cells
Vikky Awasthi
1, Rubika Chauhan
1, Debprasad Chattopadhyay
2& Jyoti Das
11Immunology Division, ICMR-National Institute of Malaria Research, New Delhi; 2ICMR Virus Unit, ID & BG Hospital, Kolkata, India
ABSTRACT
Background & objectives: Malaria is a life-threatening disease caused by Plasmodium parasites. The life-cycle of Plasmodium species involves several stages both in mosquito and the vertebrate host. In the erythrocytic stage, Plasmodium resides inside the red blood cells (RBCs), where it meets most of its nutritional requirement by degrad- ing host’s haemoglobin. L-arginine is required for growth and division of cells. The present study was aimed to demonstrate the effect of supplementation of different concentrations of L-arginine and L-citrulline on the growth of parasite, and effect of the culture supernatant on the host’s peripheral blood mononuclear cells (PBMCs).
Methods: To examine the effect of supplementation of L-arginine and L-citrulline, Plasmodium falciparum (3D7 strain) was cultured in RPMI 1640, L-arginine deficient RPMI 1640, and in different concentrations of L-arginine, and L-citrulline supplemented in arginine deficient RPMI 1640 medium. To have a holistic view of in vivo cell activation, the PBMCs isolated from healthy human host were cultured in the supernatant collected from P. falciparum culture.
Results: Growth of the parasite was greatly enhanced in L-arginine supplemented media and was found to be concentration dependent. However, parasite growth was compromised in L-citrulline supplemented and L-arginine deficient media. The supernatant collected from L-arginine supplemented parasite media (sArg) showed increased FOXP3 and interleukin-10 (IL-10) expression as compared to the supernatant collected from L-citrulline supple- mented parasite media (sCit).
Interpretation & conclusion: The in vitro culture results showed, decreased parasite growth, and decreased expression of programmed cell death-1 (PD-1) (a coinhibitory molecule) and IL-10 in the L-citrulline supplemented media as compared to L-arginine supplemented media. Hence, it was concluded that L-citrulline supplementation would be a better alternative than L-arginine to inhibit the parasite growth.
Key words L-arginine; induced nitric oxide synthase (iNOS); interleukin-10; L-citrulline; malaria; Plasmodium falciparum;
programmed cell death-1
is low, there is downregulation of CD3 zeta chain that hampers the downstream signalling and impairs T-cells functions23.
Role of arginase I and II on immune system has been demonstrated in different diseases24-26. During malaria infection, the arginase enzyme in blood increases which results in low level of L-arginine in blood12. Low level of L-arginine is directly related to disease severity and parasitic load27. The Plasmodium parasite has arginase en- zyme and is capable of metabolizing L-arginine28-29, but it cannot utilize L-citrulline28.
In malaria, L-arginine have been shown to reverse endothelial dysfunction30-31.To increase arginine level in blood and to reverse the endothelial dysfunction, the administration of nitric oxide donor like L-arginine, is useful27, 32. The effect of L-arginine on Plasmodium and immune modulation in malaria has not been explored yet.
The activation of immune system is marked by expression of several costimulatory molecules. Pro- grammed cell death-1 (PD-1), an inhibitory co-stimula- tory molecule is not expressed on resting T-cells, but an activated T-cell up-regulates its expression33. In malaria, several studies have reported that PD-1 plays a critical role in immune system modulation and inhibition of T- cell activation34-35. Cytokines play a decisive role in out- come of any disease. Interleukin-10 (IL-10) secreted by T-regulatory helper cells is a suppressive cytokine that downregulates the immune activation. Interferon gamma (IFNγ) is a pro-inflammatory cytokine, which activates the immune system against different infections.
In the present study, the effect of supplementa- tion of L- arginine and L-citrulline on the growth of P.
falciparum culture has been demonstrated. The growth of parasite was rapid in L-arginine supplemented media while its growth was stunted in L-citrulline supplemented media and arginine deficient media. To get an overview of the cell activation (in vivo), the peripheral blood mono- nuclear cells (PBMCs) were cultured in the supernatant collected from P. falciparum culture, in RPMI 1640, L- arginine deficient RPMI 1640, and in different concen- trations of L-arginine, and L-citrulline supplemented in L-arginine deficient RPMI 1640 media.
MATERIAL & METHODS Parasite culture and parasitaemia
The P. falciparum (strain 3D7) reference strains, were obtained from parasite bank of the ICMR-National Insti- tute of Malaria Research, New Delhi and were cultured in RPMI-1640 medium supplemented with 10% AB+ se- rum. Fresh blood collected through venipuncture from a
healthy subject was washed and used for in vitro P. fal- ciparum culture. The synchronized P. falciparum cul- ture, with 1% parasitaemia was used for the experiments.
Plasmodium falciparum was cultured in RPMI 1640, L-arginine deficient RPMI 1640 (Himedia Laboratories, India), different concentration of L-arginine, and L-ci- trulline (1.15 mM; 200 mg/l), (2.30 mM; 400 mg/l), (4.6 mM; 800 mg/l), and (11.5 mM; 1000 mg/l), supplement- ed in arginine deficient RPMI 1640 media, respectively.
The P. falciparum culture supernatant was collected and stored at –80°C until further use.
To determine the parasitaemia, thin smear of the para- sitized blood was made and slides were stained with Jas- want Singh Bhattacherji (JSB I and II) .The PBMCs were cultured in RPMI 1640 and the culture was supplemented with collected supernatant from the Plasmodium culture (Day 4) in 20:80 (v/v). The cells were harvested and then assayed for viability, surface staining, intracellular stain- ing and quantitative PCRs. All the experiments were per- formed in triplicates.
Preparation of parasite crude lysate
Parasite culture was collected, centrifuged and su- pernatant was discarded. The pellet was lysed by keep- ing it in 0.05% of saponin for 30 min at 37°C. The cells were washed thrice with PBS. Protease inhibitor cocktail (Thermo Fisher Scientific, USA) was added and stored at –80 °C until use.
Peripheral blood mononuclear cells isolation and culture A 5 ml blood was drawn from healthy individual.
PBMCs were isolated using lymphocyte separation me- dium, (LSM) (MP Biomedical, CA, USA) as per instruc- tions of the manufacturer. In brief, blood was diluted with equal volume of PBS and layered over 3 ml of LSM, and centrifuged at 400 g for 25 min. PBMCs were collected from the interface and washed twice with PBS. Then they were suspended in PBS, and counted and cultured. The cells were stimulated with Plasmodium crude extract (50 mg) for 8–10 h36.
Surface staining and analysis
The PBMC cells were harvested after eight hour and were labelled with antibody as per manufacturer’s instruction for flow cytometric analyses, and were re- suspended in 50 µl of FACS buffer [PBS, 2% foetal calf serum (FCS)] and surface-stained at 4 °C with antihuman CD4, PD-1(MIH4), CD69 (BD Biosciences, CA, USA).
Stained cells were acquired with a LSR Fortessa (BD Bio- sciences, CA, USA) cell analyser and analysed by FlowJo LLC software42.
Intracellular staining
The PBMCs (1×106 ml) treated or untreated were suspended in FACS buffer (PBS with 2% FCS). Surface staining was carried out by incubating with the fluoro- chrome-labelled antibodies, anti-CD4-FITC (fluorescein isothiocyanate) at 4°C for 30 min in the dark. Cells were fixed for 30 min at room temperature in dark with 2%
paraformaldehyde, and then treated with Perm/Wash so- lution at 4°C for 1 h pre-incubation with phycoerythrin (PE)-conjugated anti-FOXP3, anti-IL-4, and anti-IFNγ antibody (e-Bioscience, USA). Thereafter, cells were washed in Perm/Wash solution and in FACS buffer and then suspended in FACS buffer. The cells were acquired using a LSR Fortessa cell analyser.
Quantitative PCR
The PBMCs were stimulated with P. falciparum crude extract and cultured in the supernatant collected from P. falciparum cultured in RPMI 1640, L-arginine or L-citrulline and arginine deficient media. The cultured cells were harvested after overnight incubation at 37 °C.
The harvested cells were lysed with TRIzol (Invitrogen, USA) according to the manufacturer’s instruction. RNA was isolated by chloroform-isopropanol method or Qia- gen kitand converted to cDNA by reverse transcriptase (Thermo Fisher Scientific, USA). The qPCR was set up with the primer set depicted in Table 1. The relative ex- pression of gene was analysed by methods described by Pfaffl37.
Statistical analysis
All statistical analysis was performed in MS Excel 2003. Student t-test was used as indicated in Figs. 1a and b and considered significant when p ≤ 0.05.
Ethical Approval: The approval of human ethical committee of the National Institute of Malaria Research was obtained (ECR/NIMR/EC/2015/267) for the collec- tion of blood from a healthy individual.
Table 1. Set of the primers used for qPCR.
Primer's name Primer's sequence
h-iNOS-F GCTCTACACCTCCAATGTGACC
h-iNOS-R CTGCCGAGATTTGAGCCTCATG
h-arginase 1-F TCATCTGGGTGGATGCTCACAC
h-arginase 1-R GAGAATCCTGGCACATCGGGAA
h-arginase 2-F CTGGCTTGATGAAAAGGCTCTCC
h-arginase 2-R TGAGCGTGGATTCACTATCAGGT
h-β-actin-F CACCATTGGCAATGAGCGGTTC
h-β-actin-R AGGTCTTTGCGGATGTCCACGT
hIL-10 F GTGATGCCCCAAGCTGAGA
hIL-10 R CACGGCCTTGCTCTTGTTTT
Fig. 1: Growth of Plasmodium falciparum (3D7) in RPMI 1640, L- arginine deficient RPMI 1640, and in different concentrations of L-arginine, and L-citrulline supplemented in arginine defi- cient RPMI 1640 medium on different days: (a) Parasitaemia level of P. falciparum cultured in different concentration of L-arginine; and (b) L-citrulline; (c) Growth trend in the para- sitaemia of P. falciparum cultured in different media vs days;
and (d) Plasmodium falciparum stages in different media (im- ages taken by NIKON Model: TiU at 100x). Culture experi- ments were repeated thrice and statistical significance was calculated using unpaired t–test (**p≤0.001 and *p≤0.005).
(d)
RESULTS
Parasite growth and L-arginine supplementation
L-arginine and L-citrulline are nitric oxide donors.
L-arginine is required for growth and proliferation of cells. In order to observe the effect of these nitric oxide donors on parasite’s growth P. falciparum (3D7 strain) was cultured in RPMI 1640 (200 mg/l of arginine), argi- nine deficient RPMI 1640 and different concentrations of L-arginine and L-citrulline supplemented in L-arginine deficient RPMI 1640. Parasite cultured in RPMI 1640 served as control. It was found that parasite growth was more vigorous in media supplemented with L-arginine and the parasitaemia increased with increase in L-arginine concentration. The parasitaemia in 800 and 1000 mg/l did not vary significantly (p>0.06). To ascertain if fur- ther increase in the concentration of L-arginine increases the parasitaemia, the L-arginine concentration was in- creased to 1200, 1500 and 2000 mg/l. The growth of par- asite was lower in higher concentrations as compared to 1000 mg/l (p>0.07). The growth of the parasite was great- ly inhibited in L-citrulline supplemented media (Figs. 1a and b). At a concentration of 1000 mg/l of L-citrulline, slight increase in parasitaemia was observed, but it was not significant. Even supplementation of L-citrulline at higher concentration (1200, 1500, 2000 mg/l) did not as- sist parasite growth. The different stages of parasite in thin smear were counted in RPMI 1640, L-arginine de- ficient media L-arginine and L-citrulline supplemented media. It was observed that parasite cultured in RPMI 1640 (control media) were mainly in trophozoite stage whereas in L-arginine, deficient and L-citrulline supple- mented media parasite was mainly confined to ring stage.
On the other hand, supplementation of L-arginine further enhances the growth of the parasite to schizont stage as summarized in Table 2.
Table 2. Different stages of parasite (after 72 h) cultured in different media, counted in 10 different settings
Media (mg/l) Rings Schizonts Trophozoites Gametocytes
Arg (200) 11 2 7 0
Arg (400) 16 8 3 0
Arg (800) 17 16 2 0
Arg (1000) 26 14 9 0
RPMI 6 1 13 0
Arg– 10 3 0 0
Cit (200) 8 2 0 0
Cit (400) 9 1 1 0
Cit (800) 7 2 2 0
Cit (1000) 14 4 3 0
Fig. 2: Surface and intracellular staining of stimulated PBMCs in different media (a) Expression of inhibitory marker, PD-1 on CD4 cells; and (b) Expression of FOXP3 and IFN-g on CD4 cells. The data were analysed using FlowJo Software. The figure is representative of four independent experiments.
Effects of parasite culture supernatant on PBMCs As the culture supernatant contained several soluble factors secreted by parasite, it was important to inves- tigate the effect of these supernatant on PBMCs. The PBMCs cultured with the supernatant of different media were analysed for the expression of PD-1, an inhibitory co-stimulatory molecule (Fig. 2). The expression of PD-1 was found to be increased in all the different media. How- ever, its expression was significantly higher in the PBMC cultured in supernatant collected from L-arginine supple- mented parasite media (sArg) followed by supernatant collected from L-citrulline supplemented parasite me- dia (sCit)while its expression was similar in supernatant collected from parasite cultured in RPMI (sRPMI) and supernatant collected from arginine deficient parasite medias Arg– media (Fig. 2a). The PBMCs were further checked for the intracellular cytokines cultured in pres- ence of different supernatant. The PBMC cultured in sArg had marginally increased expression of FOXP3 as com- pared to sCit, sArg and sRPMI media (Fig. 2b). The analy- sis of the expression of IFNγ showed that cells cultured in sArg had the highest induction of IFNγ expressing CD4+ T-cell, while cells cultured in sCit, sArg and sRPMI had similar induction of IFNγ.
Effect on nitric oxide synthase and arginase in PBMC Further to know the effects of supernatant, in the in- duction of induced nitric oxide synthase (iNOS), arginase I, arginase II and IL-10, qPCR was carried out (Fig. 3).
About 6-folds and 4-folds increase was observed in induc-
ened. Also, the number of schizonts were more in arginine supplemented media as compared to RPMI which had more trophozoites. The parasite in arginine deficient and L-citrulline supplemented media was mostly in ring stage.
However, formation of gametocytes was not observed in any of the cases. Presence of gametocytes in culture is a sign of parasite in stress39. The inability of parasite to utilize L-citrulline inhibits the growth of parasite. L-ci- trulline can be utilized by macrophages to produce nitric oxide without hampering its phagocytic activities40.
Expression of various co-stimulatory molecules on T-cells and cytokine secreted by these cells, defines the outcome of a disease. Studies have shown that the ex- pression of inhibitory molecules like PD-1 weakens the immune activation leading to severity of the disease and generation of regulatory T-helper cells also supresses the immune system by secretion of IL-10. PD1 expression, secretion of IFNγ and induction of IL-10, iNOS, Arg I and II was investigated in PBMCs cultured in different media.
As evident from the results, stimulation of PBMCs and expression of PD-1 was highest in sArg. The high expres- sion of PD-1 in sArg– suggests the presence of more para- site antigens or higher amount of soluble factors, which might be a result of increased parasite growth. Similarly, the expression of PD-1 was higher in sCit as compared to sRPMI and sArg–, which might be the result of the stress conditions when parasite was cultured in L-citrulline sup- plemented media. The expression of PD-1 was similar in sRPMI and sArg–. The results suggested that when argi- nine is supplemented during Plasmodium infection it aids parasite growth and drives the immune system towards suppression.
PBMC culture results indicated that CD4+FOXP3+ cells were greatly induced when cultured in sArg suggest- ing that the increased parasite antigen in the supernatant leads to the induction of T-regulatory cells. The induc- tion of CD4+FOXP3+ cells was similar in sRPMI, sCit and sArg– media. The evaluation results of the secretion of IFN by T-cells, suggested that the IFNγ secreting CD4+ cells was greatly induced when cultured in sArg but in other media, the percentage of these cells remained almost similar. The induction results of arginase I and II gene clearly indicated that the parasite was able to induce both Arg I and II by >4-folds, when cultured in sArg. Induc- tion of arginase enzyme has been linked to immune sup- pression. The induction of these genes were significantly reduced in sCit and lowest in sArg–. Interestingly, the induction of iNOS was only 4- folds in sRPMI, while, it was 6- folds in sArg. This result further supports that the P.
falciparum antigen drives arginase induction suppressing iNOS induction. In various studies, iNOS induction has
Fig. 3: Relative quantification of genes induced in stimulated PBMCs.
tion of both arginase I and II in sArg and sRPMI respec- tively. The induction of these genes was much lower in case of sCit and sArg. It was also observed that induction of inducible nitric oxide was highest in case of sRPMI fol- lowed by sArg. The sCit and sArgshowed lower induction of nitric oxide. The induction analysis of IL-10 indicated 4-folds increase in sArg, while the induction of IL-10 was 2-folds in sCit and sRPMI. It was lowest in sArg media.
DISCUSSION
L-arginine is a semi-essential amino acid which is generated in urea cycle. L-citrulline is not required by our body and it is not a part of any protein16. It plays an important role in urea cycle. It can help in replenishment of L-arginine by action of ASS an ALT within cell. The effect of administration of arginine to malaria patient has been shown to reverse the endothelial dysfunction and increase in nitric oxide level27. Arginine supplementation has been tried in cerebral malaria (CM) cases. A study by Alkaitis et al38 has demonstrated that the hypo-arginemia in children with CM is linked with decreased rate of plas- ma arginase appearance. They also observed decrease in citrulline, ornithine and other components of urea cycle.
However, its effect on Plasmodium parasite has not been explored yet. Besides the effect of L-citrulline, which is also a nitric oxide donor, has not been studied in malaria.
In this study, the effect of supplementation of these amino acids in parasite culture media was shown. Growth of parasite was enhanced in presence of L-arginine and the parasitaemia increases with increase in concentration of arginine in media. However, at concentration beyond 1000 mg/l the growth of the parasite was not significant.
The increase in parasitaemia on L-arginine supplementa- tion suggests that parasite uses it for its growth and prolif- eration. It was observed that in media supplemented with L-arginine the erythrocytic cycle of parasite was short-
been linked with immune activation while induction of arginase has been linked to immune suppression21. Higher induction of IL-10 in sArg suggests that the parasite an- tigen suppress the immune system. Induction of IL-10 was low in sCit and sArg–. In this study, it was shown for the first time that L- citrulline, a nitric oxide donor, might be used as a supplement in chemotherapy as it re- tards the parasite growth and revives the immune system from immune-suppression by decreasing PD-1 and IL-10 expression.
CONCLUSION
The exogenous supply of arginine favoured the growth of the parasite in concentration dependent man- ner; but, beyond 1000 mg/l, no increase in parasitae- mia was observed. However, the growth of the parasite was low in L-citrulline supplemented media and the supernatant collected from L-citrulline did not induce higher amount of IL-10 and arginase I and II. Increased parasitaemia causes higher secretion or accumulation of parasite antigens, resulting in induction of inhibitory mol- ecules like PD-1, IL-10 and induction of arginase I and II. These factors collectively contribute to suppression of immune system. Hence, it was concluded that L-citrulline supplementation would be a better alternative than L-ar- ginine to inhibit the parasite growth and prevent immune suppression. Further, studies are underway to confirm the results in animal models.
Conflict of interest: None.
ACKNOWLEDGEMENTS
The authors would like to thank the Indian Council of Medical Research (ICMR), New Delhi for providing necessary financial support for carrying out the study.
REFERENCES
1. World Malaria Report 2016. Geneva: World Health Organi- zation 2016. Available from: http://apps.who.int/iris/bitstre am/10665/200018/1/9789241565158_eng.pdf?ua=1(Accessed on December 15, 2016).
2. Kappe SH, Kaiser K, Matuschewski K. The Plasmodium spo- rozoite journey: A rite of passage. Trends Parasitol 2003. 19:
135–43.
3. Cowman AF, Berry D, Baum J. The cellular and molecular basis for malaria parasite invasion of the human red blood cell. J Cell Biol 2012; 198: 961–71.
4. Wipasa J, Elliott S, Xu H, Good MF. Immunity to asexual blood stage malaria and vaccine approaches. Immunol Cell Biol 2002;
80: 401–14.
5. Deroost K, Pham TT, Opdenakker G, Van den Steen PE. The immunological balance between host and parasite in malaria.
FEMS Microbiol Rev 2015; 40(2): 208–57.
6. Dhangadamajhi G, Kar SK, Ranjit M. The survival strategies of malaria parasite in the red blood cell and host cell polymor- phisms. Malar Res Treat 2010; 2010: 973094.
7. Kirk K, Saliba KJ. Targeting nutrient uptake mechanisms in Plasmodium. Curr Drug Targets 2007; 8: 75–88.
8. Martin RE, Kirk K. Transport of the essential nutrient isoleucine in human erythrocytes infected with the malaria parasite Plas- modium falciparum. Blood 2007; 109: 2217–24.
9. Pishchany G, Skaar EP. Taste for blood: Hemoglobin as a nutri- ent source for pathogens. PLoS Path 2012; 8: e1002535.
10. Boura M, Frita R, Gois A, Carvalho T, Hanscheid T. The hemo- zoin conundrum: Is malaria pigment immuneactivating, inhibit- ing, or simply a bystander? Trends Parasitol 2013; 29: 469–76.
11. Fong KY, Wright DW, Hemozoin and antimalarial drug discov- ery. Future Med Chem 2013; 5: 1437–50.
12. Lopansri BK, Anstey NM, Weinberg JB, Stoddard GJ, Hobbs MR, Levesque MC, et al. Low plasma arginine concentrations in children with cerebral malaria and decreased nitric oxide pro- duction. Lancet 2003; 361: 676–8.
13. Munder M, Arginase: An emerging key player in the mamma- lian immune system. Br J Pharmacol 2009. 158: 638–51.
14. Albina JE, Caldwell MD, Henry WL, Jr., Mills CD. Regulation of macrophage functions by L-arginine. J Exp Med 1989; 169:
1021–9.
15. Morris SM Jr. Regulation of enzymes of the urea cycle and arginine metabolism. Annu Rev Nutr 2002; 22: 87–105.
16. Curis E, Crenn P, Cynober L. Citrulline and the gut. Curr Opin Clin Nutr Metab Care 2007; 10: 620–6.
17. Osowska S, Moinard C, Neveux N, Loi C, Cynober L. Citrul- line increases arginine pools and restores nitrogen balance after massive intestinal resection. Gut 2004 53 (12): 1781–6.
18. Qualls JE, Subramanian C, Rafi W, Smith AM, Balouzian L, DeFreitas AA, et al. Sustained generation of nitric oxide and control of mycobacterial infection requires argininosuccinate synthase 1. Cell Host Microbe 2012; 12: 313–23.
19. Bryk J, Ochoa JB, Correia MI, Munera-Seeley V, Popovic PJ.
Effect of citrulline and glutamine on nitric oxide production in RAW 264.7 cells in an arginine-depleted environment. J Par- enter Enteral Nutr 2008 32: 377–83.
20. Mamont PS, Bohlen P, McCann PP, Bey P, Schuber F, Tardif C.
Alpha-methyl ornithine, a potent competitive inhibitor of orni- thine decarboxylase, blocks proliferation of rat hepatoma cells in culture. Proc Natl Acad Sci USA 1976; 73: 1626–30.
21. Kang K, Shu XL, Zhong J X, Yu TT. Effect of L-arginine on im- mune function: A meta-analysis. Asia Pac J Clin Nutr 2014; 23:
351–9.
22. Moffat FL Jr., Han T, Li ZM, Peck MD, Jy W, Ahn YS, et al.
Supplemental L-arginine HCl augments bacterial phagocytosis in human polymorphonuclear leukocytes. J Cell Physiol 1996;
168: 26–33.
23. Rodriguez PC, Quiceno DG, Ochoa AC. L-arginine availabil- ity regulates T-lymphocyte cell-cycle progression. Blood 2007;
109: 1568–73.
24. Ghosh S, Navarathna DH, Roberts DD, Cooper JT, Atkin AL, Petro TM, et al. Arginine-induced germ tube formation in Can-
dida albicans is essential for escape from murine macrophage line RAW 264.7. Infect Immun 2009; 77: 1596–605.
25. Lewis ND, Asim M, Barry DP, de Sablet T, Singh K, Piazuelo MB, et al. Immune evasion by Helicobacter pylori is mediated by induction of macrophage arginase II. J Immunol 2011; 186:
3632–41.
26. Feun LG, Kuo MT, Savaraj N. Arginine deprivation in cancer therapy. Curr Opin Clin Nutr Metab Care 2015; 18: 78 –82.
27. Weinberg JB, Lopansri BK, Mwaikambo E, Granger DL. Argi- nine, nitric oxide, carbon monoxide, and endothelial function in severe malaria. Curr Opin Infect Dis 2008; 21: 468–75.
28. Olszewski KL, Morrisey JM, Wilinski D, Burns JM, Vaidya AB, Rabinowitz JD, et al. Host-parasite interactions revealed by Plasmodium falciparum metabolomics. Cell Host Microbe 2009; 5: 191–9.
29. Cobbold SA, Llinas M, Kirk K. Sequestration and metabolism of host cell arginine by the intraerythrocytic malaria parasite Plasmodium falciparum. Cell Microbiol 2016; 18(6): 820–30.
30. Barber BE, William T, Grigg MJ, Parameswaran U, Piera KA, Price RN, et al. Parasite biomass-related inflammation, endo- thelial activation, microvascular dysfunction and disease sever- ity in vivax malaria. PLoS Path 2015; 11: e1004558.
31. Anidi IU, Servinsky LE, Rentsendorj O, Stephens RS, Scott AL, Pearse DB. CD36 and Fyn kinase mediate malaria-induced lung endothelial barrier dysfunction in mice infected with Plasmo- dium berghei. PLoS One 2013; 8: e71010.
32. Yeo TW, Lampah D A, Gitawati R, Tjitra E, Kenangalem E, McNeil YR, et al. Impaired nitric oxide bioavailability and L- arginine reversible endothelial dysfunction in adults with falci- parum malaria. J Exp Med 2007; 204: 2693–704.
33. Agata Y, Kawasaki A, Nishimura H, Ishida Y, Tsubata T, Yag- ita H, et al. Expression of the PD-1 antigen on the surface of
stimulated mouse T and B lymphocytes. Int Immunol 1996; 8:
765–72.
34. Butte MJ, Keir ME, Phamduy TB, Sharpe AH, Freeman GJ, Programmed death-1 ligand 1 interacts specifically with the B7-1 costimulatory molecule to inhibit T-cell responses. Immu- nity 2007; 27: 111–22.
35. Iwai Y, Terawaki S, Ikegawa M, Okazaki T, Honjo T. PD-1 in- hibits antiviral immunity at the effector phase in the liver. J Exp Med 2003; 198: 39–50.
36. Kaveh DA, Whelan AO, Hogarth PJ. The duration of antigen- stimulation significantly alters the diversity of multifunctional CD4 T-cells measured by intracellular cytokine staining. PLoS One 2012; 7: e38926.
37. Pfaffl MW. A new mathematical model for relative quantifica- tion in realtime RT-PCR. Nucleic Acids Res 2001; 29: e45.
38. Alkaitis MS, Wang H, Ikeda AK, Rowley CA, MacCormick IJ, Chertow JH, et al. Decreased rate of plasma arginine appearance in murine malaria may explain hypoargininemia in children with cerebral malaria. J Infect Dis 2016; 214:
1840–9.
39. Trager W, Jensen JB. Human malaria parasites in continuous culture. Science 1976; 193(4254): 673–5.
40. Choi BS, Martinez-Falero IC, Corset C, Munder M, Modolell M, Muller I, et al. Differential impact of L-arginine deprivation on the activation and effector functions of T cells and macro- phages. J Leukoc Biol 2009; 85: 268–77.
41. Mohapatra MK, Dash PC, Mohapatro SC, Mishra RN. Delayed gastric emptying time in adult cerebral falciparum malaria. J Vector Borne Dis 2012; 49(4): 230–3.
42. Thakur RS1, Tousif S, Awasthi V, Sanyal A, Atul PK, Punia P, Das J. Mesenchymal stem cells play an important role in host protective immune responses against malaria by modulating regulatory T-cells. Eur J Immunol 2013; 43(8): 2070–7.
Correspondence to: Dr Jyoti Das, Scientist 'E', Immunology Division, ICMR-National Institute of Malaria Research, Sector–8, Dwarka, New Delhi–110 077, India.
E-mail: jyoti@mrcindia.org
Received: 6 December 2016 Accepted in revised form: 19 April 2017
