!
"#$
%&'(
)
*+,
%-
$
%-!
%-
Vimba vimba persa
(pallas, 1814)
! "! #
$%&
'*
*
! "
#
$ %&
'
()
*
! "#
$
% & '( &
)
$*+
,& &-% ,& ,./0
) 2&
3(&
: 45 / 7 / 849;
&
2
<=
:
>5 / 8>
/ 849;
(
&-% ,& /0 * 3@AB )
Vimba vimba persa (
&-% ,& C'B D "E' &
) F "%& /- GH
I J & KL (
3(I &L "@/E & M& ) &*-& NJ C .
PAQ &
8R4 '! & D/
SI .
D/ @ TJC ! * ,*
8U B & D/
TJA0 CA3 4
B & D/
Z8145 B * & / T "0 C
V/
U 3C .
&WJ & ! * JJ* T < "C
U;
/ 5 UV / 5 C . ,&* X@ M FY' JC Z
& [\' .
! "\
,& '@ ]E & Fst (p≤0.01)
D & ,&-% /0 * 3@AB
& &-% ,& C'B .
$J. P' ^N TJ(I W & C %_ ,C ) 3!C "I T 3`N ,C 3 TC'C
"a
! .
+, '-. '/
: ,&-% /0 Vimba vimba persa
&-% ,& &*-& 3@AB bJ.
* :
:
: E-mail: Samohamadian@yahoo.com
!" #$
%& %
# ' ( #' % ' )* +
,!- .% /01 23 %' 4 5* )!- 6. - 7 8%3 %
"
) :;% <=3 >" !$
?@AA (.
D
' E% FGH+
#,I' # ,!;,!' J
%' " ' KL %
) Park and Moran, 1995;
Allenford et al., 1987 (
# ,!;,!' . . %
M+ 3 !' 5 %N7 ! . OH' P .
%N7 D 5
%N7 Q R!I. 3 % !%'S DNA
% ' :7 T!' 5 )
Zhao et al., 2005 (
D
U!+ ;V U!+ !' KQ J*=W X %N7
# L 3 N %' 5, 8G %
% X 3 D#+
) Neigel, 1997;
Beacham et al., 2000; Ward et al., 2001; Salini., et al, 2004 .(
,!3 . N7Y 8%3 !+
S )
Vimba vimba persa (
FZW !" D
GZW IUCN1
+ [#' ;
. K=* S )
Kiabi et al., 1999 .(
$1 FGH+
0. : . +GGH+ D,
\]+
]V 7 % )
!%'S (
%' ^!_
S ,!3 . )
Vimba vimba persa (
. KL
#,I' FGH+ D E%
,!;,!'
# ;V
!" `!' ,1 S ,!3 .
' W!' ;V %N7 #' D4%
.
1- International Union for Conservation of Natural
#+
a?
>' S ,!3 . %' ! b@
,S cQ+ !
?A F!1 d_' !
e - 0. :=" :. eX (
.
f +
@ 7 , K"
! e % (
E % c!+
g ml /
? >+ 1 ia
% N
;7%& V!,!;+! N7'( J#,I' KL >G' . eX S .
N7'(
! '!V DNA k 0. 7 , %
>
l K5 )
Hillis and Moritz, 1990 (
mn.
"
. 0 mn. DNA
0.
"( )V !], '!!
? op. D#+ -
' fq l N 0. :' + N.
.
!" D !%'S -_ %"r( ; !+
V 2 )
GenBank (
!
?i "r( 0
!" -_ !%'S ' %
! F5#
:%'!p3 0.
. !%'S %"r( J_n7'
,!+ >' 0. !' E!' 5 2 ) %"r( )_+ ' V
? (
. .
!"
#$
% &
'(
)**
+,
"
- )/0 1 234 5*
678 9 1 9-
:
!" #$
+0 &
(12 $ 34$ '%
, 5 +"
GGACAGTGAGGGACGCAGAC CA3 TCTAGCCCCCAAATTTTACGG
AF277575
ACACGGGCTCAGAGCTAGTC CA7 CAAATGTCAGGAGTTCTCCGA
AF277579
CACGGGACAATTTGGATGTTTAT Lco1 AGGGGGCAGCATACAAGAGACACTA
AY318777
GCAGGAGCGAAATCATAAAT Lco3 AAACAGGCAGGACACAAA
AY318779
Lid-11 CTCCTGATTCTTTGTCTGACT
TTATTATTTCCTGTGGTGATTG
AB112736
Rru-2 TTCCAGCTCAACTCTAAAGA
GCACCATGCAGTAACAAT
AB112738
Z21908 CTCCTGATTCTTTGTCTGACT
TTATTATTTCCTGTGGTGATTG
G40277
Z8145 TTCCAGCTCAACTCTAAAGA
GCACCATGCAGTAACAAT
G40625
CTCCTGATTCTTTGTCTGACT Z7,8 TTATTATTTCCTGTGGTGATTG
Shimoda et al., 1999
Z9,10 TTCCAGCTCAACTCTAAAGA
GCACCATGCAGTAACAAT
Shimoda et al., 1999
KL E% :V s]+ PCR
?qq K"!
DNA
n.
? % ,]' )
)!'!] 30 (
=#
g / q ,]' ) dNTP
?q Q!' 5' (
f / q ,]'
TS(
Polymerase Taq
)DNA u/μ g ( g / f ,]'
) PCR
?qX ( A / q ,]' MgCl2
) gq Q!' 5' (
0.
IG' c( :( TL1 fg
t!+ V!0. M Y . ,]' %
5].!'+
) (PCR X
"
. )!_H' 0. PCR
'( >3( 5 )V A
J' -
@ V, *.
150
' % W ) DNA
pBR322 DNA/AluI Marker,
20, MBI Fermentas (
>-1 J#IX !;,
op. u G J 0. )V PCR )!_H' ,!;,!' : 8L.
0 d1 PCR
v+!V D#+ (bp) S K %
UVDuc 0.
"
. w !' .!N% 5, U!+ .
%7' (He) % )#+ (Ho)
l xZ (HWE)
;V %Z 5- (Nei, 1978)
G' Fst
' 0. # S+ y-!+ 3 : !
V (Nm) S K 0.
\V Gene Alex 6.2
" Z.H' (Peakall and Smous, 2005
.(
!+ . D )!_H' !;, z
?i "r( 0 E!' 5 % "r( 0
"r( 0 . )
Lco5, Lid1, MFW2 (
%
3 ,!+ E!'!!' .
s31 '( . z 6.
>, #+
! GI' % N
CA3
N :( >X1 >, 16 Z8145
@ >, .
) !+
f
! 5, s31 GI' %
,S cQ+
a?a / q N `!' Z8145
:( >X1
q?f / q N %
CA3, CA7
. ! Z7,8
! 5, s31 D4%
F!1 %
ag / q N :( >X1 Lco3
q?i / q N %
CA3, Rru-2
Z21908 '( . .
%
&'( (()
! *+, -#$
(
67
87 +0 &
9 *$
! 7 ;<%
9 *$
! 7 ;<%
Ca3 / /
/ /
/ Ca7
/ /
/
Lco1 / /
/
/
Lco3 / /
/
/
Lid11
/ /
/ /
Rru2 /
/ /
/
Z21908 /
/ /
/
Z8145
/
/ /
/
Z78 /
/ /
/
Z910 /
/
/
/
. $/
" 0 1#$
) (Ho 4(
) (He
&'( 5 67(
) (Na 8 ) (Ne (9$ #$
:;1)
! *+, (
; ;=>
'%
9 *$
! 7 ;<% +0 &
Ne Na
He Ho
Ne Na
He Ho
CA3 /
**
/
/
***
/
/
CA7 /
***
/
/ .
*
/ /
/ Lco1
***
/ /
.
**
/
/
Lco3 / ns
/
/ .
/ /
Lid-11
/
*
/
/ .
***
/
Rru-2
/
***
/
/ .
*
/
/
Z21908 /
***
/
/ .
*
/
/
Z8145
/
***
/
.
***
/
Z7,8 /
***
/
.
***
/
Z9,10
/
**
/
.
ns /
/
/
/
/
/
/
/
/
***
/ (P<0.001)
. **
(P<0.01)
.
*
(P<0.05)
.
! ns .
!"
#$
% &
'(
)**
+,
"
- )/0 1 234 5*
678 9 1 9-
3
)
@ ' :7
>, #+ D7 3 % M!' %
>, %7' %
! ,S cQ+ GI' %
d++
fb /
??
?a :( D3 qbb
/ f
@
! .
!
>, #+ D7 S F!1 % M!' %
>, d++ %7' % 10
?f D3 :(
qb?
/ f
! 3 . ' :7 ) 3 !N%
%
! FW' '+
G' %N K+
Ne
' 3 Na
. %7' .!N% '
! FW' D D N
?q / q + qqq /
?
! . FW' w !' .!N% '
! D g?q
/ q + {??
/ q
! . G' D7
! w !' .!N%
F!1 %
. %7' .
N SL
! Lco3 ,S cQ+ %
F!1 Z9,10 % )#+ m F!1 l
N % xZ %
) p≤0.01 ( )
)
.(3 G'
! D Fst F!1 ,S cQ+ %
d++
qgf / q q@@
/ q V : )
Nm=4/52 (
" Z.H' %Z >-! o+' Z.H' .
]V 5- #' 0. ]V Nei (1978)
:7
! D ;V %Z ;V 5- 3 %
d+ F!1 ,S cQ+ GI' fbi
/ q
iA?
/ q ' .
S ,!3 . ;V U!+ . D Vimba
vimba persa
N
!%'S
cQ+ GI'
#,I' !' :=" :. eX F!1 ,S
" X .
6.
#+ DN' '( . z
>, %7' % a@
e ! (
#,I' !' FW' a/
i H+ J G' D 3 !
! #+ M+
' % . D% . 3 >X #+ :!"!" J7'( 3 ! :;' D
!
#+ J0' %
>, 2 05n' #X %
#+ >X1 ! ( ' . D#' N
@q !
>, #+ !+ ' !%'S % . #X %
% :7 )
Goldstein and Scholotter, 1999; Silva and
Russo, 2000; Peakall and Smous., 2005 .(
DN'
7' .!N%
! % F!1 %
! 7 ' ,S cQ+ %
+ !+ ' 3
Z 1 D U!+ :! Q N 1 DY :!+ ' Q1 3 ,S cQ+ # F!1 - 7 8%3 5* = - : ' #ZW s;+ 7
. !3
y5n' R!I. # S+ y-!+ 3 : Fst . ' ;V
. kS" !+
Wright
).
?{iA :S' "%
3 '( . Fst qg
/ q
D G' T3 S+ ! % :7 qg
/ q +
?g / q
:7
% .!' S+
D G' O
?g / q +
fg / q :7
% Q G' Q S+
fg / q :7 S
# D Q 5 ;V S+ %%
%
'
! % ;S | w 3 %
;V S+ 7 %Z S ;V w :;' !+ . #' 2S |
' :7 z D ! | :;' 3 %
:7
%
% T% SL' # .
;L(
!" :'(
S `!' % J= 8
# :' ;V N; Z %
' eIX !W D %' :' :!+ '
`Z+ !" | >-! V : w ! X )
Beacham et al., 2004 .(
V : :S'
(Nm) N GI' GI' 2 ' D,!' #+
' }=W 7 GI' D :S' D Y% 3 !
3 . #' D GI' D J'
;V U!+ :S' 3 ;V E= . 7 ' 7 GI' !
) Rezvani Gilkolaei, 2009;
Beacham et al., 2004 .(
kS" 6.
). Li
fqqi "%
Nm>1 >'* D+ 5- V :
"% . ;V S+ L Nm<1
V 8
' ;V S+ L 5- >'*
z D !
D ;V S+ L >'* 3 % :7 $1
# :S' V : % ! 5* ! 4/52
: ! :!+ ' !" D D Q ;V U!+
# D V %
.
% )#+ . l
N 7 GI' % xZ )#+ EH %
:7 )
P<0.001 .(
Israel et al. (2004) K*
3 #' ! >, #' )#+
Tn+ # Y 2 ! % :7 J*=W D . S Zhao et al. (2005)
! EH D
>, P J!- ( "!5 3 0- %
Shao et al. (2002) kS'( ! ,!' :%' J'
!" D 7! % Dahle et al. (2006)
! #+ :! 3 )#+ EH I %
! K=*
. )#+ m #,I' D
! -_ r %"r( 0. >, :!'
>,
! T3 #+ 0- %
! I %
. ;V U!+ N !" 2 ~01 5- E%
' /01 ' !" 2 G ". . :(
!
!!' ;V U!+ 3 D
) Meffe and Carool,
(1997 ' "
!" 2 . % ' %
J!- D % X !+ !' ;V '+
' /01 # 2
! .
# . 0. ' %
+ ;V + !+ ' .
. D
:7
%
# !
' SL' % "
' ( . X ~01 ' %
# . P J!- !" D 5H' %
! !+
.
L :!*
!" 3 ! : :!+ ' "
Vimba vimba persa F!1 ,S cQ+ eX
:!* % ' >;7+ T% S' # /01 Q 1 ! ;V U!+ :4% 71 !"
! .
$ !" D . % ,#
2 % :! >G' !+ .
# ' 7 F!1 ,S cQ+ % !
( ' KL .% %
%' 4 %
" ,!+ :% ' D,!' %
! .%
D 0' J*=W . D 3
. ! T% ' .
3 :7 #,I' D D4%
!" !%' S %N7 :!+ ' %
! 0. 2S 7!
.
!
,' e' D'+ : J= JGGH+ .!' V!,!3 ;7%& %N7'( J;' JSL+
S V!,!3 ;7%& o< K=r! 3 S :! T% N7'( : X W J;' !LH' T ;% 'X
e :7,W 3 :X( N7'(
! ( %
' X ;7+
"
.
!"
#$
% &
'(
)**
+,
"
- )/0 1 234 5*
678 9 1 9-
9
References
- Allendorf, F., Ryman, N. and Utter, F. 1987. Genetics and fishery management. University ofWashington.
Wasgington.
- Beacham, T.D., Pollard, S., Le, K.D. 2000. Microsatellite DNA population structure and stock identification of steelhead trout (Oncorhynchus mykiss) in the Nass and Skeena rivers in Northern British Columbia. Marine Biotechnology. 2: 587–602.
- Beacham, T.d., Mcintosh, M. and MacConnachie., C. 2004. Population structure of lake-type and river-type sockeye salmon in Transboundary rivers of northern British Columbia. Journal of Fish. Biology, 65: 389-402.
- Dahle, G.., Jorstad, K. E., Rusaas, H. E. and Ottera, H. 2006. Genetic characteristics of brood stock collected from four Norwegian coastal cod (Gadus morhua) populations. ICES Journal of Marine Science. 63, 209-215.
- Goldstein, D.B. and Schlotterer, C. 1999. Microsatellites: Evolution and Applications. Oxford University Press, New York, 368 p.
- Hillis, D. M. and Moritz, C. 1990. Molecular taxonomy, Sinauer associate, publishers. Masschusetts. 588 pp - Israel, J., Cordes, J. F., Blumberg, M. A and May, B. 2004. Geographic pattern of genetic differentiation among collections of green sturgeon, North America Journal of Fisheries Management. 24: 922-931.
- Kiabi, B.H., Abdoli, A., and Naderi, M. 1999. Status of the fish fauna in the south Caspian basin of Iran.
Journal of Zoology in the Middle East, 18: 57-65.
- Li, D., Kang, D., Yin, Q., Sun, Z. and Liang, L. 2007. Microsatellite DNA Marker Analysis of Genetic Diversity in Wild Common Carp (Cyprinus carpio L.) Populations. Genetics and Genomics, 34: 984-993.
- Meffe, G. K., and Carroll, C. R. 1997. Genetic conservation of diversity within species in principles of conservation biology, eds. G. K. Meffe C. R. Carrol, pp. 161-21. Sunderland, Ma: Sinauer Associates, Inc:
Publisher.
- Nei, M. 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals.
Genetics, 89: 583-590.
- Neigel, J.E. 1997. A compairson of alternative strategies for estimating gene flow from genetic markers.
Annual Review of Ecology and Systematic, 28: 105-128.
- Park, L.K. and Moran, P. 1995. Developments in molecular genetic techniques in fisheries. Molecular Genetics in Fisheries. London.
-Peakall, R., Smouse, P. E., 2006. Gene Alex 6: Genetic Analysis in Excel. Population genetic software for teaching and research. Molecular Ecology and Systemic. 28: 105-128.
- Rezvani Gilkolaei. K., Salari Aliabadi, M. A., Zolgharnain, H., Nabavi, S.M.B. 2009. Population genetic structure of Cobia, Rachycentron canadum revealed by microsatellite markers. Iranian journal of Fisheries science, 3:61-69.
- Salini, J.P., Milton, D.A., Rahaman, M.J., Hussein, M.G. 2004. Allozyme and morphological variation throughout the geographic range of the tropical shad, hilsa Tenualosa ilisha. Fish Research. 66: 53–69
- Shao, ZJ., Zhao, N., Zhu, B., Zhou, FL., Chang, JG. 2002. Application of microsatellite primers developed from shovelnose sturgeon in Chinese sturgeon. Acta Hydrobiologyca Siniea, 26: 577-584.
- Shimoda, N., Knapik, E.W., Ziniti, J., Sim, C., Yamada, E., Kaplan, S., Jackson, D., Sauvage, F.D., Jacob, H and Fishman, M. C. 1999. Zebrafish genetic map with 2000 Microsatellite markers. GENOMIC Journal: 58, 218-232
- Silva, E.P., Russo, C.A.M. 2000. Techniques and statistical data analysis in molecular population genetics.
Hydrobiologia, 420: 119–135.
- Ward, R.D., Appleyard, S.A., Daley, R.K., Reilly, A. 2001. Population structure of pink ling (Genypterus blacodes) from south-eastern Australian waters, inferred from allozyme and microsatellite analyses. Mar.
Freshwater Research. 52: 965–973.
- Wright, S. 1978. Evolution and the genetics of populations variability within and among natural populations.
University of Chicago Press. 2nd Ed., University of Chicago Press, Chicago.
- Zhao, N., Ai, W., Shao, Z., Zhu, B., Brosse, S and Chang, j. 2005. Microsattelite assessment of Chinese sturgeon (Asipenser sinenis gray) genetic variability. Ichthyology. 21:7-13
A Study on Population Genetics of Vimba vimba Persa (Pallas, 1814) Using Microsatellite Markers in Gilan Province, the
Southern Caspian Sea
S. Mohamadian*1, S. Rezavani Gilkolaei2, M. Kazemian1, A. Kamali1, Sh. Rouhollahi3, M. Javad Taghavi4 and F. Laloei4
1 Islamic Azad University, Science and Research Branch, Department of Fisheries, Tehran, I.R. Iran
2 Iranian Fisheries Research Organization, Tehran, I.R. Iran
3 Khoramshahr Marine Science and Technology University, Khoramshahr, I.R. Iran
4 Ecology Research Center of the Caspian Sea, Sari, I.R. Iran (Received: 21 July 2010, Accepted: 10 March 2011)
Abstract
Population of Vimba vimba persa was investigated using microsatellite markers originated from two regions along the Iranian coastline of Southern Caspian Sea (Anzali Lagoon and Havigh River in Gilan province). Totally 153 alleles were identified. The highest number of alleles per CA3 loci was 17 and the lowest 3 in Z8145 loci with means of 7.6. Observed and expected heterozygosity averages were 0.79 and 0.76, respectively. Most cases deviated significantly from Hardy-Weinberg equilibrium (p≤0.01). The estimation of Fst (p≤0.01) identified significantly two populations of Vimba vimba persa in the Caspian Sea. Studies of this kind assist conservation of this species, sustainable harvest and restocking of the populations.
Keywords: Vimba vimba persa, Population genetic, Microsatellite, Caspian Sea
