7. Chapter 2
7.2. Materials and Methods
Cell Culture
Human ovarian cancer cell line SKOV-3 expressing G9a or N799Q mutant were kindly provided by Professor Jong-Wan Park. They were cultured in RPMI1640 supplemented with 10% FBS (Gibco) and 1% penicillin- streptomycin (Gibco) and grown in a humidified atmosphere containing 5%
CO2 at 37℃. Human acute monocytic leukemia THP-1 cell line was maintained in RPMI media containing 10% FBS (Gibco) and differentiated into macrophages by incubation with 100 nM PMA (Sigma) for 24 h at 37℃ with 5%
CO2.
Isolation and Differentiation of Bone Marrow-derived Macrophages (BMDM) Bone marrow cells were obtained from C57BL/6J male mice of 7-12 wks of age and differentiated for 7 days in RPMI 1640 media containing 10% FBS, 1%
penicillin/streptomycin, and 2 mM of L-glutamine (Gibco), supplemented with fresh recombinant murine M-CSF (25 ng/ml; Miltenyi Biotec) every three days, into bone marrow derived macrophages (BMDMs). Cells were cultured at 37℃ in a humidified incubator containing 5% CO2.
Lentiviral Infection
The lentiviral G9a shRNA constructs were purchased from Dharmacon (RHS4533-EG10919, Dharmacon Research, Chicago, IL, USA). The FIH shRNA construct was kindly provided by Professor Jong-Wan Park.
Lentiviruses were produced by transfecting into 293FT cells by using the Lentivral packaging kit (OriGene, Rockville, MD, USA). Viral supernatants were harvested and used to infect SKOV-3 Control or G9a-WT cells with 8
μg/mL polybrene. Cells were selected using 1.5 μg/mL puromycin and used for the downstream experiments.
Zebrafish Morpholino Injection
Pu.1 morpholino oligonucleotide was purchased from Gene Tools, LLC (Corvalis, OR, USA). The morpholino oligomer target sequences were from 5′
to 3′, as follows: Pu.1 MO: GATATACTGATACTCCATTGGTGGT, Con MO:
CCTCTTACCTCAGTTACAATTTATA. For Pu.1 knockdown as previously published [102, 103], 1 mM Pu.1MO was injected into 1-4 cell embryos, as described [104]. Embryos from the same matings were injected with an equal volume of phenol red/nuclease-free water mixture as a control and some embryos served as uninjected controls.
Western Blotting
The cells were harvested with the 1X sample buffer (Biosesang) containing a protease inhibitor and phosphatase inhibitor cocktail (GenDepot). The total cell lysates were sonicated for 30 sec and heated to 100℃ for 10 min. The proteins were separated on 8% polyacrylamide gels followed by transfer onto polyvinylidene difluoride (PVDF) membranes (Merck Millipore). Mouse anti- FIH (A-5; Santa Cruz Biotechnology Inc.), rabbit anti-G9a/EHMT2 (C6H3;
Cell Signaling Technology), and mouse anti-β-actin (Santa Cruz Biotechnology Inc.) were used at 1/2000 dilutions.
RNA Isolation and Real-Time RT-PCR
Total RNA was extracted from cells with Trizol (Invitrogen) following the manufacturer’s instructions. RNA concentration/quality was assessed by NanoDrop spectrophotometer (NanoDrop Technology). Equal amounts of RNA were reverse transcribed into cDNA with Reverse Transcription kits (Enzynomics) and gene expression was determined by quantitative real-time PCR using SYBR Green PCR Master Mix (Applied Biosystems) on an ABI PRISM 7900 (Applied Biosystems). The relative mRNA expressions of each sample were normalized by β-actin and Student’s unpaired t-test was used for statistical analysis. Sequences of primers used for amplifications were as follows: β-actin: FP, 5’-ATTGCCGACAGGATGCAGAA-3’; RP, 5’- GCTGATCCACATCTGCTGGAA-3’; FIH: FP, 5’-GCCAGCACCCACAAGTTCTT-3’;
RP, 5’- CCTGTTGGACCTCGGCTTAA-3’; G9a: FP, 5’-
CATTTCCGCATGAGTGATGATGT-3’; RP, 5’-GGCAGAACCTAACTCCTCCGA-3’.
Transwell Migration Assay
Cancer cells were seeded onto a 12-well plate at a density of 8.0 × 105 on day 0, and the culture supernatants were harvested on Day 2. A total of 600 μL of supernatant was applied to the bottom of the Transwell chamber. This was followed by the addition of 250 μL of 5 × 104 THP-1 monocytes on the top of the polycarbonate membrane inserts (8-μm-pore-size, Corning).
After 4-6 h incubation at 37℃ in a CO2 incubator, the inserts were transferred to a new 24-well plate. The top of the insert membrane was washed with a cotton swab, and 1 ml of methanol was used to fix the cells for 5 min at room temperature. After washing with PBS, the membranes were stained with hematoxylin for 8 min and eosin for 30 sec. After washing with
PBS, finally, the membranes were dried and scanned underneath the membranes using a light microscopy (Labophot; Nikon)
Immunofluorescence Staining
After fixed with 4% paraformaldehyde for 15 min at room temperature, THP- 1 macrophages were washed with PBS containing 0.3% Triton X-100 (PBST) three times and blocked at 37℃ for 1 h in PBST supplemented with 5% FBS (Gibco). Then, the cells were incubated with the following primary antibody at 4°C overnight: mouse anti-CD206 (BioLegend, San Diego, CA, USA). Cells were washed 3 times for 5 min with PBST and incubated with Alexa Fluor 635-labeled goat anti-mouse IgG (Molecular Probes) and DAPI for 1 h at room temperature. Stained cells were examined under Olympus FV1000 Confocal Scanning Scope (Olympus).
Flow Cytometry
THP-1 cells differentiated with 100nM PMA for 24 h were treated with cancer supernatant for 3 days. After fixation, cells were stained with PE- conjugated anti-CD206 (clone: MR6F3; eBioscience). Labeled cells were analyzed using LSR-II cytometer (BD Biosciences), and the data were analyzed using FlowJo Software (version 7.6.2).
Wound Scratch Assay
SKOV-3 control cells were seeded onto a 24-well plate at a density of 105 and allowed to achieve 95% confluency. Then, a scratch extending the length of each well was made using a standard 200 μL pipette tip. After washed with
PBS solution, THP-1 conditioned media (CM) harvested with the addition of 1%
FBS for 24 h was treated. The plate was incubated at 37℃ in 5% CO2 for 24 h and media was not changed during this time. Three photomicrographs of each scratch were obtained at the initial time of wound creation and the same location was photographed every 6 h thereafter until completion of the study.
Image analysis software (ImageJ) was used to quantify the area of the wound remaining. This number was then converted to a percentage of the wound closure at each time point.
Preparation of CM for Secretome Analysis
SKOV-3 control or G9a-NQ cells were seeded onto a 100-mm dish tissue culture plate (2 × 106 cells per well; Corning) and incubated with 10 mL of serum-free RPMI1640 for 48 h in a humidified chamber kept at 37℃ in 5%
CO2. The CM was harvested and centrifuged at 3,000 rpm for 10 min to remove large particulates. Then, the CM was concentrated to about 400 μL by ultrafiltration (3-kDa cutoff membrane; Amicon Corporation, Danvers, MA, USA). The CM was stored at -80℃ for the downstream secretome analysis.
Nano LC-MS/MS analysis
LC-MS/MS analysis methods were performed using Quadrupole Orbitrap mass spectrometers, Q-exactive plus (Thermo Fisher Scientific) coupled to an Ultimate 3000 RSLC systems (Dionex, Sunnyvale, CA, USA) with a nano electrospray source as previously described with some modifications [105, 106]. Peptide samples were separated on the 2-column setup with a trap column (75 μm I.D. × 2 cm, C18 3 μm, 100 Å) and an analytical column
(50 μm I.D. × 15 cm, C18 1.9 μm, 100 Å). Prior to sample injection, the dried peptide samples were redissolved in solvent A (2% acetonitrile and 0.1%
formic acid). After the samples were loaded onto the nano LC, a 90-min gradient from 8 to 30% solvent B (100% acetonitrile and 0.1% formic acid) was applied to all samples. The spray voltage was 2.0 kV in positive ion mode and the temperature of the heated capillary was set to 320℃. Mass spectra were acquired in data-dependent mode using a top 15 method on a Q Exactive.
The Orbitrap analyser scanned precursor ions with a mass range of 300–
1650 m/z and resolution of 70,000 at m/z 200. Higher-energy collisional dissociation (HCD) scans were acquired on the Q Exactive at a resolution of 17,500. HCD peptide fragments were acquired at a normalised collision energy of 28. The maximum ion injection times for the survey and MS/MS scans were 20 and 120 ms, respectively.
Bioinformatics Analysis
Statistical analysis for nano LC-MS/MS data was performed using the Perseus software [31]. Protein quantification data was analyzed using gene set enrichment analysis (GSEA) by ranking gene products according to a differentiability statistic using GSEA’s Molecular Signature Database and shown with density plots depicting the abundance of a gene set relative to the entire dataset (https://www.gsea-msigdb.org/gsea/msigdb/collections.jsp).
Multiplex Membrane-based Immunoassay
SKOV-3 control or G9a-NQ cells were seeded onto a 6-well cell culture plate (1.6 × 105 cells per well; Corning) and incubated with serum-free
RPMI1640 for 24 h in a humidified chamber kept at 37℃ in 5% CO2. The CM was harvested and centrifuged at 3,000 rpm for 10 min to remove large particulates. Then, the human cytokine array (ARY005, R&D Systems, MN, USA) was conducted according to the manufacturer instructions.
Statistical Analysis
All statistical analyses were run using GraphPad Prism 6.07 software and displayed as the mean ± S.E.M. The statistical significance of the difference was assessed using Student t-test. A significant difference was considered when the p-value was less than 0.05 and was represented by *, p < 0.05, **, p
< 0.01 and ***, p < 0.001, ****, p < 0.0001.