Phylogenetic Analysis of Sika Deer ( Cervus nippon ) in Songnisan National Park Using Mitochondrial Genetic Markers

(1)

Phylogenetic Analysis of Sika Deer ( Cervus nippon ) in Songnisan National Park Using Mitochondrial Genetic Markers

Bo-Yeon Hwang

¹

*, Bit-Na Lee

²

*, Tae-Heon Kim

³

, Ju-Hyung Lee

⁴

, Han-Wung Lee

⁴

, Sun-Guk Cho

⁴

, Yong-Hun Kim

⁴

and Gilsang Jeong

⁵

**

1National Geoparks Secretariat, Korea National Park Service, Seoul 121-803, Korea

2Department of Life and Science, Ewha Womans University, Seoul 120-750, Korea

3Korea National Park Research Institute, Korea National Park Service, Cheonnam 590-811, Korea

4Songnisan National Park, Korea National Park Service, Chungbuk 376-862, Korea

5Division of Ecoscience, Ewha Womans University, Seoul 120-750, Korea

미토콘드리아 유전자 표지를 이용한 속리산국립공원내 꽃사슴(Cervus nippon) 의 계통유전학적 분석

황보연

¹*·

이빛나

²*·

김태헌

³·

이주형

⁴·

이한웅

⁴·

조선국

⁴·

김용훈

⁴·

정길상

⁵**

1국립공원관리공단 국가지질공원사무국

2이화여자대학교 생명과학부

3국립공원관리공단 국립공원연구원

4국립공원관리공단 속리산국립공원사무소

5이화여자대학교 에코과학부

Abstract : Farm reared sika deer was released twelve individuals on 1987, six on 1998 and sixteen from 2001 to 2002 as an religious event by a Buddhist temple in Songnisan National Park, South Korea. After released, the sika deer population has dramatically increased through natural breeding and local adaptation. For controlling the population of the introduced sika deer in the Songnisan National Park, they have been captured with five net cages in several sites during winter season from 2010 to 2013. A total of 42 individuals were released in an isolated cage. This study was conducted to investigate genetic diversity of mitochondrial DNA of the captured sika deer in the Songnisan National Park. A total of 14 blood and tissue samples were collected and analysed. From the PCR amplification, 699bp sequences were obtained for CO1 and 660bp for Cytb. The 13 samples show no sequence variation in both CO1 and Cytb. For phylogenetic analysis, 25 nucleotide sites for CO1 and 43 for Cytb are parsimony informative. The conventional phylogenetic tree and the Bayesian tree for CO1 are almost identical. In these trees, 13 samples form a monophyletic group with C. n.

taiouanus. However, the sequence of one sample is completely accordant to C. n. hortulorum. The 13 samples, CY1- CY14 except CY11, are conformed to be C .n. taiouanus and clustered in the monophyletic group in the conventional tree. In the Bayesian tree, it also shows that these samples have the closest relationship with species C. n. taiouanus. However, CY11 is grouped with C. n. hortulorm like the mitochondrial CO1 phylogenetic trees and distinguished from C. n. taiouanus. However, in our case, resolution of these trees is low because genetic relationship between species is highly close. The phylogenetic analyses show that most Sika deer individuals are confirmed to be C. n. taiouanus. Therefore, it suggests that Sika deer living in Songnisan National Park were introduced into the country from Taiwan subspecies of Cervus nippon.

Key words : Sika deer, Mitochondrial DNA, Genetic diversity, CO1, Cytb

요 약 : 속리산국립공원의 사찰에서는 종교적 방생행사로 사육종인 꽃사슴을 1987년 12개체, 1998년 6개체 그리고

2001~2002년 사이 16개체를 각각 방사하였다. 방사 이후 속리산국립공원 내 꽃사슴은 자연적인 번식과 적응을 통하여

*The first two authors contributed to the article equally

**Corresponding author: [email protected]

(2)

개체군은 폭발적으로 증가하였다. 외래유입종인 꽃사슴의 개체군 조절을 위해 속리산국립공원에서는 2010년부터 2013 년까지 겨울철 동안 주요 지역에 5개의 포획시설을 설치하여 총 42개체의 꽃사슴을 포획하였고, 포획개체는 격리된 사 육시설에 재방사하였다. 본 연구는 속리산국립공원내 포획된 꽃사슴의 미토콘트리아DNA 유전적 다양성을 조사하는데 그 목적이 있다. 포획개체 중 총 14개체로부터 혈액과 조직 샘플을 수집하여 분석하였다. 샘플을 PCR증폭해 미토콘드 리아 DNA내 CO1 유전자 부위 699염기서열(bp)과 Cytb 유전자 부위 660염기서열(bp)을 각각 얻었다. 이중 13개의 샘 플에서 CO1과 Cytb 유전자의 열기서열 차이는 없었다. 계통분석에서, CO1의 25개 염기서열과 Cytb의 43개 염기서열 이 계통학적으로 유의한 정보를 제공하였다. CO1의 전통적 계통수와 Bayesian 계통수는 그 계통학적 가지가 거의 일치 하였다. 이 계통수에서 13개의 샘플은 C. n. taiouanus와 단계통군을 형성하였다. 그러나 CY11은 C. n. hortulorm과 단 계통을 형성하였으며, C. n. taiouanus와는 구분되었다. 그러나 본 연구의 계통학적 해상도는 낮은 편인데 이는 유전적 연관이 분석된 종간에 매우 가깝기 때문이다. 본 연구의 계통분석 결과 거의 모든 개체는 C. n. taiouanus로 판명되었다.

따라서 이는 속리산에서 포획된 개체는 Cervus nippon의 대만산 아종이 국내로 도입되었다는 것을 의미한다.

주요어 : 꽃사슴, 미토콘드리아 DNA, 유전적 다양성, CO1, Cytb

Introduction

The original range of Sika deer (Cervus Nippon Temminck 1983) is the southern Ussuri district of eastern Siberia; China, Japan, Korea, Manchuria, Taiwan, and parts of Vietnam (Feldhamer 1980). Groves (2006) reviewed the species’

taxonomy and concluded that it encompasses 4 species, ie.

Cervus nippon of southern Japan, C. yesoensis of central and northern Japan, C. taiouanus of Taiwan, and C. hortulorum of the mainland range, but some scientists and reports classified sika deer into 6 subspecies (Corbet 1978) or 11 subspecies (IUCN 2014) or 15 subspecies (Grubb 2005).

Sika deer is typically found in woodlands with dense undergrowth and adjacent open areas. It can occur up to 3000 m above sea level, but is sensitive to snow depth: more than 40 cm of snow is limiting. Peak activity is around dawn and dusk. It is moderately social, living in small groups or alone, even though both sexes are strongly segregated. In its native range, Sika deer is secure in Japan, but populations across many of their historical ranges in continental Asia have been extinct or endangered due to hunting for meat, hides, antler velvet, blood, and organs and habitat loss (Mattioli 2011).

Sika deer was common and widespread in north and central Korea but declined severely during the Japanese occupation of the country. After liberation, it proved im- possible to rebuild populations naturally from the surviving dispersed individuals in Hamgyungbuk-do province, As a result the Democratic People’s Republic of Korea (DPRK) government initiated a captive breeding program (Won 1968). The genetic purity of sika deer is unclear as is their relationship to the sika deer held captive in DPRK nowadays.

Sika deer is either very rare or extinct as a wild animal in DPRK. It no longer survives in the wild in South Korea, including Jeju Island (Won and Smith 1999).

Twelve farm reared sika deer were released twelve

individuals in 1987, six individuals in 1998 and sixteen individuals from 2001 to 2002 as a religious event by a Buddhist temple in Songnisan National Park, South Korea.

After released, the sika deer population has dramatically increased through natural breeding and local adaptation (National Park Service 2008). The population of wild sika deer was estimated more than 50 individuals through precise habitat monitoring in major habitats, around the regions of the Bupjusa temple and the Hwabuk in Songnisan National park in 2009.

Foreign invasive species have generally harmful influence on the endemic relevant and similar animals because of severe competition on resources such as foods, nesting sites etc. (Gustaffson 1988, Ministry of Environment 2006). The community of large number of species shows stronger resistance in general than that of small number of species. In case of birds and mammals, the impact of invasive species was difficult to evaluate and estimate with an objective method (Baker 1991; Hunter 1996).

For controlling the population of the introduced sika deer in the Songnisan National Park, they have been captured with five net cages in several sites during winter season from 2010 to 2013. A total of 42 individuals were released in an isolated cage. This study was conducted to investigate genetic diversity of mitochondrial DNA of the captured sika deer in the Songnisan National Park.

Materials and Methods

1. Collection of blood and tissue samples

Tissues and blood samples of 14 sika deer were collected during February, 2012 to January, 2013 in Songnisan National Park (Table 1). The DNeasy blood and tissue kit (Qiagen, Cat. No. 69506) were used for extracting genomic DNA from the samples. After extraction, they were stored at

−20^oC until further analysis.

(3)

2. Polymerase Chain Reaction (PCR) Amplification Genomic DNA of Sika deer was analyzed on two genes of mitochondrion, Cytochrome C oxidase subunit 1 (CO1) and Cytochrome b (Cyt-b). In our preliminary test, the existing primer sets proved improper for the two genes. Consequently we designed new sets of primers for the two genes of the organisms based on sequences of Artiodactyla in Genbank (CO1: CNTf: TCAGCCATTTTACCTATGTTCA, CNTr:

ATR TAGCCAAARGGTTCTTTTT, and Cyt-b: BN-CNTf:

AGCAATACACTATACATCCGACACA, BN-CNTr: GAG ACTAGGGCTAAGACTCCTCCTA).

A total volume of 20 µl PCR including 0.5 µl of each primer and 1 µl of genomic DNA were added in the PCR premix (Enzynomics). The PCR amplification condition for both mt CO1 and Cytb was denaturing at 95ôC for 10 min, followed by 35 cycles at 95ôC for 30s, 55ôC for 30s, and 72ôC for 1min and a final extension at 72ôC for 5 min. After PCR, the reaction mixture was kept at 4ôC.

The PCR products were separated by electrophoresis for 20 min at 100 V in on 1% agarose gel in 1 × TAE buffer stained with Etidium Bromide and visualized under UV light.

After checking DNA fragmentation on gel, they were puri- fied using Qiaquick PCR purification kit (Qiagen, Cat. No.

28106) and were sequenced.

3. Sequence analysis

The result of sequencing was aligned using Clustal W at MEGA (ver.5.2) (Tamura et al., 2011). The original Cervus nippon taiouanus sequences were analyzed with other sequences of allied species of Cervus nippon retrieved from Genbank. The two genes of Taurotragus derbianus and Equus caballus were selected as an out-group among the Artiodactyla.

Sequence analyses were implemented in the two methods, MEGA and BEAST (v1.75) software. Phylogenetic trees were constructed using three algorithms-Maximum likelihood (ML), Neighbor-joining (NJ), and Maximum parsimony (MP) with the bootstrap analysis with 500 bootstrapping for higher reliability. An optimal substitution model for lineage estimation was TIM+G for CO1 and K81uf+1 for Cytb of Akaike Information Criterion in Modeltest3.7.

Three phylogenetic trees were combined to one in order of ML/NJ/MP in TreeGraph2 (Stöver and Müller 2010). For Bayesian inference, the models were not installed on the BEAST software (Drummond and Rambaut 2007). The GTR model was adopted instead of them. It was set up to 10,000,000 times for length of chain and 1,000 times for log parameter and the number of 2500 burn-in in order to construct a tree. It was compared and analyzed with the ML/

NJ/MP tree.

Results

From the PCR amplification, 699bp sequences were obtained for CO1 and 660bp for Cytb. Both the conventional phylogenetic trees and the Bayesian tree show largely similar topology. This may most likely be due to sequence similarity among them, in spite of different tree building algorithms between the methodologies. Especially, sample 1~13 do not show sequence differences in both CO1 and Cytb. Among sequences for phylogenetic analysis, 25 nucleotide sites for CO1 and 43 for Cytb are parsimony informative. Nucleotide compositions of genus Cervus including Formosan deer are on average T (31.7%), C (25.2%), A (26.9%), and G (16.3%) in CO1 and on average T (27.4%), C (27.3%), A (30.6%), and G (14.7%) in Cytb (Tables 2, and 3).

Table 1. Collection of blood and tissue samples.

Sample Number Date Sex Sample type GenBank accession No. of CO1

1 17-Feb.-2012 M blood KM047653

2 04-April-2012 M tissue KM047654

3 12-April-2012 F blood KM047655

6 10-May-2012 F blood KM047658

7 10-May-2012 F blood KM047659

8 15-May-2012 F blood KM047660

9 28-June-2012 Unknown tissue KM047661

10 12-Dec.-2012 M blood KM047662

11 15-Sept.-2012 M blood KM047663

12 29-Dec.-2012 M blood KM047664

13 17-Jan.-2013 M tissue KM047665

14 12-June-2012 M blood KM047666

(4)

Table 3. Nucleotide composition of mitochondrial Cytb in genus Cervus.

Species T (%) C (%) A (%) G (%)

CY1 – CY10, CY12 – CY14 27.3 27.4 30.6 14.7

CY11 27.4 27.3 30.8 14.5

Cervus nippon taiouanus 27.3 27.4 30.6 14.7 Cervus nippon hortulorum 27.4 27.3 30.8 14.5 Cervus nippon kopschi 27.0 27.7 30.8 14.5 Cervus nippon sichuanicus 27.0 27.7 30.8 14.5 Cervus nippon centralis 27.4 27.3 30.6 14.7 Cervus nippon yesoensis 27.4 27.3 30.6 14.7 Cervus nippon yakushimae 27.1 27.6 30.6 14.7 Cervus elaphus songaricus 27.9 26.7 30.6 14.8 Cervus elaphus xanthopygus 28.2 26.4 30.8 14.7 Cervus unicolor swinhoei 28.6 26.1 30.6 14.7

Mean 27.4 27.3 30.6 14.7

Note: CY1~14 indicate the sample individuals in mitochondrial Cytb gene.

Figure 1. ML/NJ/MP phylogenetic tree for CO1.

The branch support values are in order of ML/NJ/MP and it shows posterior probability.

Note: GenBank accession number : Cervus nippon taiouanus : EF058308, Cervus nippon hortulorum : HQ191428, Cervus nippon kopschi : JN389444, Cervus nippon sichuanicus: JN389443, Cervus nippon centralis : AB211429, Cervus nippon yesoensis : AB210267, Cervus nippon yakushimae : AB218689, Cervus elaphus songaricus : HQ191429, Cervus elaphus xanthopygus: GU457434, Cervus unicolor swinhoei : DQ989636, Taurotragus derbianus : EF536354, Equus caballus : NC 001640

Table 2. Nucleotide composition of mitochondrial CO1 in genus Cervus.

Species T (%) C (%) A (%) G (%)

CO1 – CO10, CO12 – CO13 31.8 25.1 26.9 16.2

CO11 31.3 25.5 26.8 16.4

CO14 31.6 25.1 26.9 16.4

Cervus nippon taiouanus 31.8 25.1 26.9 16.2 Cervus nippon hortulorum 31.3 25.5 26.8 16.4 Cervus nippon kopschi 31.1 25.8 26.6 16.5 Cervus nippon sichuanicus 31.1 25.8 26.6 16.5 Cervus nippon centralis 31.9 24.9 26.8 16.4 Cervus nippon yesoensis 31.6 25.1 26.8 16.5 Cervus nippon yakushimae 31.6 25.2 26.9 16.2 Cervus elaphus songaricus 31.8 25.1 26.8 16.4 Cervus elaphus xanthopygus 31.8 25.1 26.8 16.4 Cervus unicolor swinhoei 31.9 24.8 27.4 16.0

Mean 31.7 25.2 26.9 16.3

Note: CO1~14 indicate the sample individuals in mitochondrial CO1 gene.

(5)

1. Molecular phylogenetic analysis for CO1

Both the conventional phylogenetic tree and the Bayesian tree for CO1 display almost identical. In these trees, CO1- CO13 samples form a monophyletic group with C. n.

taiouanus. Although CO14 diverged from others earlier, it shows closet phylogenetic relationship with the group of C.

n. taiouanus. However, the sequence of CO11 is completely accordant to C. n. hortulorum. C. n. taiouanus exhibits neighbor relation with both C. n. kopschi and C. n. sichuanicus, on the other hand, C. n. hortulorum has closer relationship with the other species in the Bayesian tree (Figs. 1 and 2).

2. Molecular phylogenetic analysis for Cytb

The samples, CY1-CY14, are conformed to be C. n.

taiouanus and clustered in the monophyletic group in the conventional tree. In the Bayesian tree, it also shows that these samples have the closest relationship with species C. n.

taiouanus. However, CY11 is grouped with C. n. hortulorm like the mitochondrial CO1 phylogenetic trees and distinguished from C. n. taiouanus.

In case of the Cytb analysis, C. n. taiouanus and C. n.

Figure 2. The Bayesian tree for CO1.

The branch support values indicate the posterior probability.

Figure 3. ML/NJ/MP phylogenetic tree for Cytb.

The branch support values are in order of ML/NJ/MP and it shows posterior probability.

Note: GenBank accession number : Cervus nippon taiouanus : GU377258, Cervus nippon hortulorum : JF893492, Cervus nippon kopschi : JN389444, Cervus nippon sichuanicus : JN389443, Cervus nippon centralis : AB211429, Cervus nippon yesoensis : GU377256, Cervus nippon yakushimae : AB218689, Cervus elaphus songaricus : HQ191429, Cervus elaphus xanthopygus : GU457434, Cervus unicolor swinhoei : DQ989636, Taurotragus derbianus : EF536354, Equus caballus : D82932

(6)

hortulorum diverged lately followed by the two subspecies, C. n. sichuanicus and C. n. kopsch. The two subspecies have more neighboring relationship with C. n. taionanus rather than C. n. hortulorum. Therefore, it may be said that the Bay- esian tree and conventional tree exhibit analogous topology (Figs. 3 and 4).

Discussion

Mitochondrial genes display high phylogenetic resolution between species (Hoelzer and Meinick 1994). However, in our case, resolution of these trees is low because genetic relationship between species is highly close. The phylogenetic analyses show that most Sika deer individuals are confirmed to be C. n. taiouanus. Therefore, it suggests that Sika deer living in Songnisan National Park were introduced into the country from Taiwan subspecies of Cervus nippon.

Both mitochondrial CO1 and Cytb genes of 14 Sika deer specimens have little variation in the base sequences most probably due to inbreeding after introduction. In case of Cervus nipppon, there were several researches that incestu- ous inbreeding occurred in a limited range population because they have a promiscuous mating system at high population densities (Okada and Tamate 2000; Thevenon et al. 2004).

Such situation may eventually cause serious fitness problems from such mating conditions in the future. Consequently, it needs to investigate how genetic composition of this population will be changed in Songnisan National Park. This will help better understand the effect of introduced species on native ecosystems.

Regarding C. n. hortulorum called ‘Ussuri saseum’ in Korea, it is Pekin sika deer for common name. They distribute patch in Hamgyongbuk-do province North Korea, Ussuri, and Manchuria in small populations. Pekin sika deer are classified as critically endangered subspecies in general (Kwon 2011). However, species status of this group is phylogeneti- cally unclear in the genus Cervus. Thus, it is often confused as Cervus nippon mantchuricus that is also one of the endangered species living in North Korea. However, we must caution that IUCN regards C. n. hortulorum as particularly uncertain subspecies and excludes it when the entire Artio- dactyla classification is considered (IUCN 2014). As our data show, the phylogenetic relationship of the genus Cervus is intensely close. Genetic pollution of them is also high due to its hybridization frequently occurred (Lowe and Gardiner 1975; Goodman et al. 1999). The phylogenetic uncertainty made it difficult to classify them morphologically and geneti- cally. It is immature to make a conclusion at this stage. Our data could be a foundation of the deer phylogenetic in Korea.

More data need to be collected from their morphology and anatomy as well as other genetic markers prior to building up the most parsimonious phylogenetic relationships between them.

Acknowledgement

This study was conducted with monitoring in Songnisan National Park on 2012. G.Jeong was supported by Korea National Science Foundation (Project No.: C00027).

References

Baker AJ. 1991. A review of New Zealand ornithology. Power, DM. ed., Current Ornithology Vol. 8: 1-67. Plenum Press, New York.

Corbet GB. 1978. The mammals of the Palaearctic Region: a taxonomic review. Cornell Univ. Press, Ithaca, p. 314.

Drummond AJ; A Rambaut. 2007. BEAST: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology 7:

214.

Feldhamer GA. 1980. Cervus nippon. Mammalian Species 128:

1-7.

Goodman SJ, NH Barton, G Swanson, K Abernethy, JM Pemberton. 1999. Introgression through rare hybridization: a Figure 4. The Bayesian tree for Cytb.

The branch support values indicate the posterior probability.

(7)

genetic study of a hybrid zone between red and sika deer (genus Cervus) in Argyll, Scotland. Genetics 151: 355-371.

Groves C. 2006. The genus Cervus in eastern Eurasia. European Journal of Wildlife Research 52: 14-22.

Grubb P. 2005. Artiodactyla. In: DE Wilson, DM Reeder, eds., Mammal Species of the World. A Taxonomic and Geographic Reference (3rd ed), Pp. 637-722. Johns Hopkins University Press, Baltimore, USA.

Gustaffson L. 1988. Inter- and intraspecific competition for nest holes in population of the Collared Flycatcher Ficedula albicollis. Ibis 130: 11-16.

Hoelzer GA, DJ Meinick. 1994. Patterns of speciation and limits to phylogenetic resolution. Trends in Ecology and Evolution 9: 104-107.

Hunter ML. Jr. 1996. Fundamentals of conservation biology.

Blackwell, Oxford.

IUCN. 2014. IUCN Red List of Threatened Species. Available at:

http://www.iucnredlist.org. (Accessed on 26 May 2014).

Kwon GH. 2011, Conservation biological and systematic study on the sika deer from Northeastern Asia (Cervus nippon hortulorum) by analysis of mitochondrial DNA cytochrome b gene sequence. MSc thesis. Pp. 1-2. Chungbuk National University.

Lowe VPW, AS Gardiner. 1975. Hybridization between Red deer (Cervus ealphus) and Sika deer (Cervus nippon) with particular reference to stocks in N.W. England. Journal of Zoology 177: 553-566.

Mattioli S. 2011. Family Cervidae. in Handbook of the mammals of the world. Volume 2 Hoofed Mammals.

Wilson DE, Mittermeier RA. eds. Pp. 350-443. Lynx Edicions, Barcelona.

Ministry of Environment. 2006. The study of management method and monitoring system of ecological disturbing species. Pp.

219.

National Park Service 2008. The monitoring report of Songnisan National Park. p. 360.

Okada A, HB Tamate. 2000. Pedigree analysis of the sika deer (Cervus nippon) using microsatellite markers. Zoological Science 17: 335-340.

Stöver BC, KF Müller; 2010. TreeGraph 2: Combining and visualizing evidence from different phylogenetic analyses.

BMC Bioinformatics 11: 7.

Tamura K, D Peterson, N Peterson, G Stecher, M Nei, S Kumar.

2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28:

2731-2739.

Thevenon S, LT Thuy, LV Ly, F Maudet, A Bonnet, P Jarne, JC Maillard. 2004. Microsatellite analysis of genetic diversity of the Vietnamese sika deer (Cervus nippon pseudaxis). Journal of Heredity 95: 11-18.

Won CM, KG Smith. 1999. History and current status of mammals of the Korean Peninsula. Mammal Review 29: 3-36.

Won HK. 1968. Mammals of Korea. Science Institute Publishing House, Pyongyang.

(2014년 5월 1일 접수; 2014년 6월 1일 채택)