Ecotoxicology and Environmental Safety 208 (2021) 111742
Available online 7 December 2020
0147-6513/© 2020 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
Research paper
Impact of redox-mediators in the degradation of olsalazine by
marine-derived fungus, Aspergillus aculeatus strain bpo2: Response surface methodology, laccase stability and kinetics
Paul Olusegun Bankole
a,*,1, Kirk Taylor Semple
b, Byong-Hun Jeon
c, Sanjay Prabhu Govindwar
caDepartment of Pure and Applied Botany, College of Biosciences, Federal University of Agriculture, P.M.B. 2240 Abeokuta, Ogun State, Nigeria
bLancaster Environment Centre, Lancaster University, Lancaster LA1 4YQ, United Kingdom
cDepartment of Earth Resources and Environmental Engineering, Hanyang University, Seoul 04763, South Korea
A R T I C L E I N F O Edited by Dr Yong Liang Keywords:
Olsalazine Laccase Redox-mediators Box-Behnken design (BBD)
Polycyclic non-steroidal anti-inflammatory drugs
A B S T R A C T
The indiscriminate disposal of olsalazine in the environment poses a threat to human health and natural eco- systems because of its cytotoxic and genotoxic nature. In the present study, degradation efficiency of olsalazine by the marine-derived fungus, Aspergillus aculeatus (MT492456) was investigated. Optimization of physico- chemical parameters (pH. Temperature, Dry weight) and redox mediators {(2,20-azino-bis(3-ethyl- benzothiazoline-6-sulfonic acid) diammonium salt (ABTS), p-Coumaric acid and 1-hydroxybenzotriazole (HOBT)} was achieved with Response Surface Methodology (RSM)-Box-Behnken Design (BBD) resulting in 89.43% removal of olsalazine on 7th day. The second-order polynomial regression model was found to be sta- tistically significant, adequate and fit with p <0.0001, F value=41.87 and correlation coefficient (R2=0.9826).
Biotransformation was enhanced in the redox mediator-laccase systems resulting in 99.5% degradation of olsalazine. The efficiency of ABTS in the removal of olsalazine was more pronounced than HOBT and p-Coumaric acid in the laccase-mediator system. This is attributed to the potent nature of the electron transfer mechanism deployed during oxidation of olsalazine. The pseudo-second-order kinetics revealed that the average half-life (t1/2) and removal rates (k1) increases with increasing concentrations of olsalazine. Michaelis-Menten kinetics affirmed the interaction between laccase and olsalazine under optimized conditions with maximum removal rate, Vmax=111.11 hr-1 and half-saturation constant, Km=1537 mg L-1. At the highest drug concentration (2 mM);
98%, 95% and 93% laccase was remarkably stabilized in the enzyme-drug degradation system by HOBT, ABTS and p-Coumaric acid respectively. This study further revealed that the deactivation of laccase by the redox mediators is adequately compensated with enhanced removal of olsalazine.
1. Introduction
Tremendous rise in sales and distribution of pharmaceuticals tar- geted at meeting global health demands has led to a surge in presence of polycyclic non-steroidal anti-inflammatory drugs (PNSAIDs) in the environment. PNSAIDs, as emerging contaminants, get into wastewater treatment plants (WWTPs), sewage treatment plants (STPs), municipal waste dumpsites, ground and surface water through indiscriminate disposal, unregulated, illicit and uncontrolled circulation (Hanamoto et al., 2018; Barroso et al., 2019). In recent times, their detection has
raised serious health, environmental and global concerns due to their toxicity in soil and aquatic ecosystem. Owing to their chemical struc- tures, reactive functional groups and active sites, pharmaceuticals remain recalcitrant and highly stable in nature thus exhibiting acute and sub-acute toxicity on humans (Sharma and Kaushik, 2017; Chinnaiyan et al., 2018). In addition, a vast number of PNSAIDs remain in the environment for a long period of time due to their high boiling point and solubility in water. The removal of PNSAIDs through known conven- tional physical and chemical methods such as ionization, volatilization, photolysis, floatation, activated sludge and flocculation have proven to
* Corresponding author.
E-mail address: [email protected] (P.O. Bankole).
1 ORCID: 0000-0003-3182-2990
Contents lists available at ScienceDirect
Ecotoxicology and Environmental Safety
journal homepage: www.elsevier.com/locate/ecoenv
https://doi.org/10.1016/j.ecoenv.2020.111742
Received 10 September 2020; Received in revised form 15 October 2020; Accepted 26 November 2020
be ineffective, costly and eco-unsafe (Ahmed et al., 2017). The lethal effect of PNSAIDs was evident in the elimination of vultures in Northern India through an indirect administration of a particular drug on cattle (Cuthbert et al., 2007).
Carrying out batch experiments on the removal of emerging con- taminants using conventional means could be enormous, laborious, costly, time-consuming and cumbersome (Sharma et al., 2019). Nowa- days, efficient removal of pollutants, optimization of process conditions and culture media constituents is achieved through the deployment of statistical and experimental designs. The biotransformation of PNSAIDs in the environment depends largely on their concentration and other physicochemical variables such as contact time, pH, temperature and adsorption coefficients (Esplugas et al., 2007).
In quest for novel strains with unique enzymes systems, microbial diversity has been discovered in different environments such as marine (Miao et al., 2019) and explored for different purposes by several re- searchers (Cui et al., 2018; Duarte et al., 2018). Fungi isolated from diverse substrates such as seawater, wastewater and mangrove sedi- ments typically dissipate extensive enzymes systems with special char- acteristics for different purposes (Beygmoradi et al., 2018). Fungi derived from marine origin have been explored for biotransformation of several pollutants because of their capacity to produce different degra- dative intracellular and extracellular enzymes such as cytochrome P450s, laccases, lignin peroxidases, manganese peroxidases, cellulases, keratinases, glucosidase, lyases and chitinases (Bonugli-Santos et al., 2015). Marine fungi are well adapted to high saline environment con- taining considerable amount of PNSAIDs. Enzymes derived from marine fungi exhibit great tolerance for high salt concentration, light intensity, pressure, temperature, pH, heavy metals and trace organic contaminants (Birolli et al., 2019). To date, enzymes derived from diverse microor- ganisms are largely less explored in the biotreatment and removal of organic pollutants and contaminants such as PNSAIDs. The marine compartment is endowed with microorganisms, vast number of enzymes and biomolecules. However, the marine environment is constantly being bedevilled with pollution which in turn causes depletion and extinction of microbial diversity (Lima and Porto, 2016). Exploring the diversity of marine organisms give insight into different enzymes with unique fea- tures for future applications (Barzkar et al., 2018). Even though, there are few studies on biotransformation of PNSAIDs by different fungal classes and genera such as basidiomycetes (Bjerkandera, Trametes, Pha- nerohaete), zygomycetes (Cunninghamella) and entomopathogenic (Beauveria) (Domaradzka et al., 2015). Rodarte-Morales et al. (2012) reported the efficiency of Phanerochaete chrysosporium in the removal of naproxen and a drug mixture (containing diclofenac, ibuprofen and carbamazepine) within 4 days. However, microbial biotransformation of PNSAIDs such as olsalazine by different marine-derived fungal species has been poorly investigated and under-explored.
Olsalazine belong to the mesalamine (5-aminosalicylic acid; 5-ASA) group linked together by an azo bond. It is generically called 3,3’ diazosalicylic acid and commonly referred to as dipentum (Domaradzka et al., 2015). The drug is commonly used in treating ulcerative lacera- tions in the bowel. The drug is highly lethal and toxic if found beyond the permissible concentration limit of 5 g kg-1 in humans and animals.
However, trace quantities of the drug are sometimes found in municipal wastewater, solid waste landfills and dumpsites due to indiscriminate usage, handling and disposal especially in developing countries. Efforts geared towards outright eliminating the drug in an eco-friendly way have proven to be quite arduous because of the recalcitrant nature of the azo bond in its structure. The aromatic compound in the drug ensures its stability against conversion by oxygenases (Keck et al., 1997). Razo-- Flores et al. (1997) reported 89% removal of olsalazine by a methano- genic consortium with 5-aminosalicylic acid and acetate as major metabolites.
Low molecular weight redox-mediators are sometimes introduced in the enzyme systems for enhanced removal of PNSAIDs. Typically, highly reactive free radicals are produced in redox-mediator catalyzed system
due to oxidation by laccase. Enhanced removal of PNSAIDs in largely promoted when free radicals serve as electron transfer connector be- tween laccase and PNSAIDs (Tran et al., 2010; Ashe et al., 2016). Redox mediators in drug degradation mechanism help in overcoming the ki- netic limitations thereby acting as electron bridge on laccase active sites and thus increasing radicals needed for oxidation of target pollutant.
However, there is a research lacuna at exploring redox mediator enhanced PNSAIDs degradation by fungi isolated from seawater in the removal of pharmaceuticals present or detected in marine environment.
Moreover, since the traditional physicochemical methods of PNSAIDs treatment proved to be ineffective leaving traces of sludge. The study seeks to investigate enhanced, innovative and eco-friendly degradation of olsalazine by laccase from A. aculeatus strain bpo2 with the addition of redox mediators (ABTS, HOBT and p-Coumaric acid). To the best of our knowledge, this is the first report of olsalazine degradation by the marine-derived fungus, A. aculeatus in laccase-mediator enzyme system.
2. Materials and methods
2.1. Reagents, materials and culture maintenance media
Olsalazine (>99% purity) was purchased from Supelco-Apex Scien- tific Inc., Bellefonte, Pennsylvania, USA. HPLC grade methanol, veratryl alcohol and azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) was purchased from Chemico Chemicals, New Delhi, India. Other chemicals used in this study were procured from Sigma-Aldrich, United Kingdom. The fungus was routinely grown in potato dextrose medium (HiMedia, India) with olsalazine.
2.2. Isolation by enrichment and screening of multiple PAH degrading isolate
For the isolation olsalazine degrading fungus, samples were collected from saline rich soil along the coast of Atlantic-ocean, Lagos, Nigeria (7◦60’41’’N; 4◦09’19’’E). The beach coast is widely known for plastic pollution as a result of indiscriminate disposal by tourists and fun- seekers. The samples were enriched in Mineral Salt Medium (MSM) (6.0 g L−1 KH2PO4, 1.0 g L−1 Na2SO4, 0.2 g L−1 MgSO40.7 H2O, 0.05 g L−1 yeast extract and 0.3 g L-1 glucose) supplemented with olsalazine (100 mg L-1) at pH 7 and temperature 30◦C (Philp and Atlas, 2005). After five days of culture, 200µL of enrichment medium was spread in malt extract agar plates. The plates were thereafter incubated at ambient temperature for seven days in dark. The growth of mycelia in plates showed the capacity of the fungus to degrade olsalazine and this was further explored in subsequent experiments after being kept in the refrigerator at 4◦C.
2.3. Fungal identification by internal transcribed spacer (ITS) sequence analysis and phylogenetic analysis
The isolate’s pure genome was extracted using Doyle (1990) method.
The Internal Transcribed Spacer (ITS) 1 and 4 regions were amplified using 100 nM of forward (1F) and 500 nM of reverse (4R) primers respectively. The ITS 1 and 4 primer sequences were “TCCGTAGGT- GAACCTGCGG” and “CAGACTTGTACATGGTCCAG”. The Polymerase Chain Reaction (PCR) process was kick-started with an initial denatur- ation step performed at 98◦C for 2 min. This was strictly followed by 35 cycles of denaturation at 98◦C for 10 s, annealing at 45◦C for 15 s, polymerization at 72◦C for 15 s, and a final extension at 72◦C for 5 min.
PCR products were analysed using 1.5% agarose gel electrophoresis. The actual sequencing of purified PCR products obtained was achieved at International Institute of Tropical Agriculture (IITA), Nigeria. A sequence analysis was conducted to determine homologous similar- ities/identities with previous submissions using Basic Local Alignment Search Tool (BLAST) available on the National Centre for Biotechnology Information (NCBI) portal. The molecular sequence data was later
documented in the GenBank (NCBI) database and Accession Number was thereafter assigned. Twenty-five (25) other sequences of high sim- ilarities and homologous identities to the strain were retrieved from NCBI portal and sequence alignment was performed using ClustalW facility on MEGA X Software (Kumar et al., 2018). Phylogenetic typing analyses were conducted using the maximum-like hood method and Tamura-Nei model (Tamura and Nei, 1993).
2.4. Optimization of physicochemical parameters and redox mediators’ by RSM using box-behnken design (BBD) during olsalazine degradation
Response surface methodology is a statistical and experimental design technique used in determining relationships and effect of selected variables on a particular response (Das and Mishra, 2017). The method was deployed to study the interactions of physicochemical variables and redox mediators with the aim of determining the best optimal conditions
Table 1
Box-Behnken design for the degradation of olsalazine by A. aculeatus.
Run pH Olsalazine concentration Dry weight Temperature ABTS p-Coumaric acid HOBT Degradation efficiency (%)
(mg L-1) (g) (◦C) (mM) (mM) (mM)
1 6 100 0.50 30 1.25 1.50 1.50 75.71
2 4 55 1.25 30 1.25 1.50 0.50 64.86
3 8 100 1.25 40 1.25 0.85 1.50 82.86
4 4 100 1.25 40 1.25 0.85 1.50 74.71
5 6 10 0.50 30 1.25 1.50 1.50 87.43
6 6 55 1.25 30 1.25 0.85 1.50 88.86
7 8 55 2.00 30 2.00 0.85 1.50 86.43
8 6 55 0.50 20 1.25 0.85 2.50 78.86
9 8 55 2.00 30 0.50 0.85 1.50 78.14
10 6 100 2.00 30 1.25 0.20 1.50 78.86
11 6 10 1.25 30 2.00 0.85 0.50 87.57
12 6 55 1.25 20 0.50 0.20 1.50 73.57
13 6 100 0.50 30 1.25 0.20 1.50 79.71
14 6 100 1.25 30 2.00 0.85 0.50 82.86
15 6 55 2.00 20 1.25 0.85 2.50 78.00
16 8 55 0.50 30 2.00 0.85 1.50 87.29
17 8 100 1.25 20 1.25 0.85 1.50 78.29
18 6 10 2.00 30 1.25 0.20 1.50 83.57
19 4 55 1.25 30 1.25 1.50 2.50 74.00
20 6 55 1.25 20 0.50 1.50 1.50 76.57
21 6 55 0.50 20 1.25 0.85 0.50 74.14
22 6 55 2.00 20 1.25 0.85 0.50 73.29
23 6 55 1.25 40 0.50 0.20 1.50 78.14
24 6 10 1.25 30 0.50 0.85 2.50 84.00
25 4 55 2.00 30 0.50 0.85 1.50 70.00
26 4 55 0.50 30 0.50 0.85 1.50 70.86
27 6 100 1.25 30 0.50 0.85 0.50 74.57
28 6 100 1.25 30 2.00 0.85 2.50 87.57
29 8 55 1.25 30 1.25 1.50 0.50 77.43
30 6 55 1.25 30 2.00 1.50 1.50 89.43
31 6 55 0.50 40 1.25 0.85 2.50 83.43
32 4 55 0.50 30 2.00 0.85 1.50 79.14
33 4 55 1.25 30 1.25 0.20 2.50 71.00
34 6 55 1.25 40 0.50 1.50 1.50 81.14
35 6 55 1.25 30 1.25 0.85 1.50 88.86
36 4 55 1.25 30 1.25 0.20 0.50 66.29
37 6 55 1.25 20 2.00 1.50 1.50 84.86
38 6 55 1.25 20 2.00 0.20 1.50 81.86
39 6 10 0.50 30 1.25 0.20 1.50 84.42
40 6 10 2.00 30 1.25 1.50 1.50 86.57
41 6 10 1.25 30 2.00 0.85 2.50 89.29
42 6 55 1.25 30 1.25 0.85 1.50 88.86
43 6 55 1.25 30 1.25 0.85 1.50 88.86
44 6 55 2.00 40 1.25 0.85 2.50 82.57
45 8 55 1.25 30 1.25 1.50 2.50 82.14
46 8 10 1.25 40 1.25 0.85 1.50 87.57
47 4 10 1.25 40 1.25 0.85 1.50 79.43
48 6 55 2.00 40 1.25 0.85 0.50 77.86
49 4 10 1.25 20 1.25 0.85 1.50 74.86
50 6 55 1.25 40 2.00 0.20 1.50 86.43
51 8 10 1.25 20 1.25 0.85 1.50 83.00
52 6 55 1.25 30 1.25 0.85 1.50 88.86
53 6 10 1.25 30 0.50 0.85 0.50 79.29
54 8 55 1.25 30 1.25 0.20 0.50 74.43
55 4 100 1.25 20 1.25 0.85 1.50 70.14
56 8 55 0.50 30 0.50 0.85 1.50 79.00
57 6 55 0.50 40 1.25 0.85 0.50 78.71
58 4 55 2.00 30 2.00 0.85 1.50 72.71
59 6 100 2.00 30 1.25 1.50 1.50 81.86
60 8 55 1.25 30 1.25 0.20 2.50 79.14
61 6 100 1.25 30 0.50 0.85 2.50 79.29
62 6 55 1.25 30 1.25 0.85 1.50 88.86
for high degradation efficiency. After preincubation periods, 1 mL stock solution of olsalazine in methanol was added into flasks to give the desired final concentration of pharmaceutical (10 mg L-1). The degra- dation set up was prepared in 500 mL-Erlenmeyer flasks containing 250 mL mineral salt medium (MSM) and suspended mycelia (1 mL) of A. aculeatus. BBD is a three factorial second order- rotatable design deployed to determine the influence of important physicochemical pa- rameters on the potency of A. aculeatus in the degradation of olsalazine (Lloret et al., 2013). Optimization of media components and redox mediators was achieved with Box-Behnken design (BBD) with variations in incubation temperature (20–40◦C), pH of the medium (4− 8) through the addition of H2SO4 and NaOH to the mixture, fungal mycelia dry weight (0.2–2 g), concentration (10–100 mg L-1), ABTS (0.5–2 mM), p-coumaric acid (0.2–1.5 mM) and HOBT (0.5–2.5 mM) Table 1. The physicochemical parameters and redox mediators are the independent variables while olsalazine degradation efficiency which represents response was taken as the dependent variable. The independent vari- ables were studied at three levels (1, 0, and+1) with 62 experimental runs. The design, regression and graphical analysis were performed using Design-expert software v. 12.0.1.0 Stat-Ease, Inc. Minneapolis, USA (Sutar et al., 2019). Analysis of variance (ANOVA) was used in evaluating the effect of each variable and goodness of fit (p<0.05). The set up was carried out in the dark to curb photo-metabolization. Each experiment was prepared triplicate with control groups containing dead fungus cells (heat activated). All the experimental flasks were incubated at 30◦C with a rotary shaker at 150 rpm. After 7 days of incubation, experimental cultures were later filtered with Whatman filter paper to remove the solid and extract the pharmaceuticals in the mixture. The resultant drug was thereafter extracted with dichloromethane in ratio 20:80. The filtrate was thereafter dried overnight with sodium tetraox- osulphate (VI) salt. The absorbance of the filtrates (experimental and control) containing suspended solids were taken with UV-Vis spectro- photometer (Shimadzu, Japan) at wavelength (ʎmax=560 nm) (Bankole et al., 2020).
2.5. Crude laccase preparation
A. aculeatus strain bpo1 was inoculated in a 500 mL Erlenmeyer flasks 100 mL of mineral salt medium. Sodium tetraoxosulphate VI was used in adjusting the pH to 5. The mixture was placed in orbital shaker at 100 rpm for 7 days at ambient temperature. The crude enzyme (laccase) was thereafter extracted and separated from the medium biomass after full growth. The crude enzyme extract was stored in sterile McCartney bottles at 4◦C.
2.5.1. Evaluation of laccase activities
Laccase activity was evaluated from the 3 mL sample withdrawn from the mixture of enzyme extract (0.5 mL), sodium acetate buffer (1.5 mL) and guaiacol (1 mL). After 2 h incubation, the absorbance was taken ShimadzuUV-1603 spectrophotometer set at ʎmax=450 nm sam- ple. The laccase enzyme activity has been expressed in international units per liter of enzyme extract (U L-1) (Sandhu and Arora, 1985).
2.6. Impacts of redox mediators in laccase-enzyme system
Three redox mediators namely, 2,20-azino-bis(3-ethylbenzothiazo- line-6-sulfonic acid), p-Coumaric acid and 1-hydroxybenzotriazole (HOBT) were used to compare the potency of the mediators in the degradation of olsalazine. Prior screening was done with the addition of crude laccase extract (5 mL) to 1 mM concentrations of each of the mediators. Controls were made of 100 mg L-1 olsalazine and 5 mL lac- case solution with no mediator. Experiments were conducted in tripli- cates at 29◦C for 48 h. Further assessments of the effect of the redox mediators for enhanced olsalazine degradation were carried out at mediator concentration (0.5, 1.0, 1.5, and 2.0 mM) and incubation time (12, 24, 36 and 48 h).
2.7. First-order kinetic model
The analysis was carried out to evaluate the time {half-life (t1/2)}
required to remove olsalazine at different concentrations and rates (k1) (Bankole et al., 2020). The experimental data for olsalazine degradation were subjected to pseudo-first-order kinetics:
S=S0 exp− k1t;t1/2=In2
k1 (1)
where S0 =initial olsalazine concentration (%).
S=olsalazine concentration (%) at time t,
t=Time (Day)While k1=Olsalazine degradation rate constant (d-1).
The percentage of remaining olsalazine derived by dividing residual olsalazine by initial olsalazine concentration (Ting et al., 2011).
Similarly, Michaelis-Menten type rate model was used for the ki- netics study of the rates of enzymatic conversion of the drug at different concentrations by A. aculeatus cells. Kinetic study was carried out to determine the enzyme-drug system functions and is described by the Lineweaver-Burk double reciprocal plot in a hyperbolic equation:
V0= dS
dt= Vmax[S]
[S] +Km (2)
1 V0
= [S] +Km
Vmax[S] (3)
1 V0
= Km
Vmax
.1 [S]+ 1
Vmax (4)
Where, V0 = initial rate of olsalazine degradation (L/mol*s).
Km=degree of olsalazine-laccase binding capacity (Michaelis-Menten constant) (mg L-1). and Vmax is the maximum rate of olsalazine degra- dation (hr-1). Values of Vmax and Km is deducible from the plot between degradation rate and olsalazine concentrations. The reciprocal plot of y- (1/V) versus x-(1/S) yields a straight line with V1m as the intercept and KVmm as the slope (Das and Mishra, 2017).
2.8. HPLC analysis
Olsalazine was extracted after 12 days of metabolic culture with ethyl acetate in ratio 80:20 in a test tube. The mixture was dried over- night with sodium tetraoxosulphate VI. The dried sample was recon- stituted with 2 mL high-performance liquid chromatography (HPLC) grade methanol. The samples were thereafter centrifuged at 15,000 ×g and 30◦C for 10 min, and the supernatants were used for HPLC (Sri- sailam and Veeresham, 2010). A 10µL aliquot of the supernatant was analysed on Agilent Model 1100 series HPLC machine equipped with ODS Hypersil column (4×250 mm). The mobile phase was made of methanol/water in ratio 85:15 and held at a flow rate of 1 mL min-1. The UV detector was set at 450 nm wavelength.
2.9. Statistical analysis
The means of experiments done in triplicates were separated at p<0.05 level of significance. Data were presented as mean±standard error of means. Normality of the experimental data on laccase induction were determined using one-way Analyses of Variance (ANOVA). Graphs were drawn with GraphPad Prism software version 8.4.2 (2020) at level of significance (P≤0.05).
3. Results and discussion
3.1. Molecular identification of the isolate
The fungus was characterized molecularly using ITS 1 and 4 se- quences. BLASTn analysis revealed that the ITS gene sequences had
homologous similarities with Aspergillus aculeatus (KF493861)− 96.55%, Aspergillus aculeatus strain AN5 (KY859793)− 95.66%, Aspergillus acu- leatus (KY848352)− 96.55%, Aspergillus aculeatus (MH368116)− 96.02%, Aspergillus aculeatus strain A1.9 (EU833205)− 96.55% and Aspergillus aculeatus (KJ439163)− 96.2%. The sequence data was thereafter documented and deposited on National Center for Biotech- nology Information (NCBI) portal with accession number MT492456 and designated name Aspergillus aculeatus strain bpo2. Fig. 1 shows the phylogenetic tree of A. aculeatus strain bpo 2 with closely related twenty-five (25) fungal species and strains. Neighbour joining method was used to infer the evolutionary history from a bootstrap consensus having 500 replicates.
3.2. Model adequacy, fitting of second-order polynomial equation and statistical analysis
The influence of redox mediators (ABTS, p-Coumaric acid and HOBT) and vital physicochemical variables (pH, concentration, dry weight and temperature) to determine optimal conditions to achieve enhanced degradation of olsalazine by A. aculeatus. In addition, the study was conducted to evaluate the interactions of the variable and mediators in the degradation system. Table 1 shows BBD along with experimental values of olsalazine degradation on 4th day. The ANOVA for olsalazine degradation by A. aculeatus through BBD is as shown in Table SM1. Maximum degradation efficiency (89.43%) was observed at pH-6, concentration-55 mg L-1, dry weight-1.25 g, temperature- 30◦C, ABTS-2 mM, p-Coumaric acid-1.5 mM and HOBT-1.5 mM. The lowest degradation efficiency (66.29%) was observed at pH-4, con- centration-55 mg L-1, dry weight-1.25 g, temperature-30◦C, ABTS- 1.25 mM, p-Coumaric acid-0.2 mM and HOBT-0.5 mM (Table 1). The F-value (41.87) obtained after ANOVA were found to be large which depicts that the regression equation is sufficient to measure the response to interactions between parameters during degradation Table SM1. The associated p-values for all the parameters and redox mediators studied were found to be far less than (p<0.05) Table SM1 (Zhang and Zheng, 2009). The lack of fit F-value of 1.94 implies the
lack of fit is not significantly relative to the pure error. There is a 98.90% chance that a lack of fit which implies that there is the model is adequate, appropriate and sufficient to determine relationship be- tween variables and degradation efficiency (Montgomery, 2008).
ANOVA shows that all seven linear terms (A-G) are significant at p<0.05 and thus were added to the coded equation to maintain model hierarchy (Anderson and Whitcomb, 2005).
Diagnostic plots were used to further check the model’s goodness of fit of the experimental results obtained. The straight-line graph obtained in a probability plot between % normality and studentized residuals affirmed the normality of the data (Fig. SM1a). The plot between pre- dicted and actual values of the response (degradation efficiency) (Fig. SM1b) revealed accuracy and appropriateness of the model. The best lambda (2.7) obtained falls between the minimum and maximum lambda values (0.57 and 4.96) in Box-Cox plot for power transforms (Fig. SM1c). This suggests that the transformation is sufficient to obtaining the response variable. Furthermore, the leverage versus run plot revealed that the experimental data falls within the standard limits (0− 1) (Fig. SM1d) which affirmed the goodness of fit of the regression model. The Cook’s distances plot values are less than 1 which implies that there are no outliers in the response of normal distribution and residuals plot (Fig. SM1e). The perturbation plot (Fig. SM1f) showed the interactive effect of process parameters on the degradation systems. The steep slopes indicated high influence of the process variables to olsala- zine degradation efficiency (Y). The slope of substrate concentration (E) is steeper than variables E-ABTS, D-Temperature, C-Dry weight, G- HOBT, F-p-Coumaric acid, B-concentration and A-pH. The order of steepness indicates the degree of impacts of olsalazine degradation (response) by A. aculeatus.
F-value this large could occur due to noise. In this study, the coeffi- cient of variation (C.V) which is the percentage of the ratio of standard deviation and means of responses is 1.50%. The model is very reliable and reproducible since the C.V is less than 10% indicates the reliability and reproducibility of the model. The accuracy of the model is eluci- dated by the low standard deviation (1.25) obtained after experimen- tation (Table SM2). The coefficient of determination (R2=0.9826) is
Fig. 1.Phylogenetic analysis of A. aculeatus strain bpo 2 inferred through neighbour-joining tree method. The tree analysis of sequence data was drawn with a scale bar of 0.020 indicating the genetic distance.
Fig. 2. 3D surface plots of interaction between process variables (a1) pH vs. Concentration), (a2) pH vs. Dry weight (a3) pH vs. Temperature (b1) pH vs. ABTS (b2) pH vs. p-Coumaric acid (b3) pH vs. HOBT (c1) Concentration vs. Dry weight (c2) Concentration vs. Temperature (c3) Concentration vs. ABTS (d1) Concentration vs.
p-Coumaric acid (d2) Concentration vs. HOBT (d3) Dry weight vs. Temperature (e1) Dry weight vs. ABTS (e2) Dry weight vs. p-Coumaric acid (e3) Dry weight vs.
HOBT (f1) Temperature vs. ABTS (f2) Temperature vs. p-Coumaric acid (f3) Temperature vs. HOBT (g1) ABTS vs. p-Coumaric acid (g2) ABTS vs. HOBT (g3) p- Coumaric acid v. HOBT.
greater than 0.8 which further affirmed best goodness of fit of the model.
The R-squared value 0.9826 suggests great degree of correlation be- tween predicted and experimental degradation efficiencies. In this study, the adequate precision (25.6944) which is the ratio of signal- to- noise is greater than 4. The implies that the ratio is desirable and suf- ficient to produce adequate signal in the design space (Imron and Titah, 2018). In addition, the negligible difference observed between the pre- dicted R2 (0.9826) and adjusted R2 (0.9591) portend that the experi- ment is devoid of fundamental fault in design and. The adjusted R2 affirmed 95.91% accuracy of the model predicted degradation effi- ciencies. The equation in terms of coded factors is presented in eq. SM1.
3.3. Optimization of process variables and redox mediators during olsalazine degradation by A. aculeatus
The 3D surface plots showed significant influence and interactions of each parameters and mediators on the degradation efficiency of PNASIDs by A. aculeatus (Fig. 2). In regression model 3D plots, one variable is kept constant while the other two are altered to observe their effects on olsalazine degradation by A. aculeatus. Among all, A,B, C,D, E,F,G, BC, CF, EG, A2,C2,D2,E2,F2,G2 were found to be significant model terms (p<0.05) (Table SM1). The interaction between the variables EF (p-Coumaric acid vs. ABTS), EG (HOBT vs. ABTS) and FG Fig. 2. (continued).
(HOBT vs. p-Coumaric acid) was found to be significant as shown in Fig. 2. The interaction between the variables; AB (pH vs. Concentra- tion), AC (pH vs. Dry weight), AD (pH vs. Temperature), AE (pH vs.
ABTS), AF (pH vs. p-Coumaric acid), AG (pH vs. HOBT), BC (Concen- tration vs. Dry weight), BD (Concentration vs. Temperature), BE (Concentration vs. ABTS), BF (Concentration vs. p-Coumaric acid), BG (Concentration vs. HOBT), CD (Dry weight vs. Temperature), CE (Dry weight vs. ABTS), CF (Dry weight vs. p-Coumaric acid), CG (Dry weight vs. HOBT), DE (Temperature vs. ABTS), DF (Temperature vs. p-Cou- maric acid), DG (Temperature vs. HOBT), EF (ABTS vs. p-Coumaric acid), EG (ABTS vs. HOBT), and FG (p-Coumaric acid v. HOBT) also showed significant influence in the degradation of olsalazine using A. aculeatus strain bpo1 (p<0.05) (Fig. 2) (Table SM1). The effect of interactions between all the process variables is obtained as elliptical shape plots, which signifies significant interaction between corre- sponding terms, shown in Fig. 2. The perfect interactions between pH, redox mediators and other physicochemical parameters (Fig. 2a1–2a3, 2b1–2b3) is not unconnected to the fact that fungi thrive and perform better in laccase-catalysed system at acidic pH 4–6. Likewise,
(Fig. 2f1–2f3) revealed the impact of temperature on enhanced degradation (85–87%) of olsalazine at 30–35◦C. This is attributed to the optimal increase in reaction rates and activation energy between the fungal active sites and olsalazine. Elliptical 3D plots in Fig. 2a2, 2c1, 2d3, 2e1–2e3 showed the influence of biomass (fungal dry weight) increase in improved degradation of olsalazine at when higher biomass (fungal dry weight) was added to the degradation system. Increase in fungal biomass aids rapid proliferation of mycelia cells which in turn plays a vital role in the degradation of NSAIDS. Degradation effi- ciencies (89.29% and 89.43%) was observed at olsalazine concentra- tion of 10 and 55 mg L-1 respectively (Table 1). Significant interactions between concentrations, redox mediators and physicochemical pa- rameters is further elucidated by the elliptical plots in Fig. 2a1, 2c1, 2c2, 2c3, 2d1 and 2d2. However, the degradation efficiency (70.71%) was observed when the olsalazine concentration was set at 100 mg L-
1). Removal of persistent organic contaminants is mostly favoured at low concentrations (Ali and El-Mohamedy, 2012). The effect of in- teractions between the redox mediator on degradation of olsalazine would be discussed fully in the next section.
Fig. 3.Effect of (a) mediator concentrations on olsalazine degradation (b) reaction time on olsalazine degradation efficiency of laccase and mediators (c) redox mediator concentrations on laccase induction (d) reaction time on laccase induction. The error bars represent the standard error of means of triplicate samples.
3.4. Effect of mediator concentrations
Fig. 3(a) showed the relationship between mediator concentration and olsalazine degradation. It was observed that increase in degradation efficiency is proportional to increase in concentrations of the three mediators used in this study (Fig. 3a). Removal of contaminants in- creases with increase in mediator concentration till threshold value is reached. At threshold, no significant enhanced degradation of the pharmaceuticals would occur. Degradation threshold value is not un- connected to the enzyme source, pharmaceuticals and redox mediator type (Ashe et al., 2016). In this study, degradation of olsalazine was achieved with increase in concentration of HOBT from 0.5 to 2 mM, however, no substantial improvement was recorded when the concen- tration was raised above 2 mM. This result is similar to the report of Mizuno et al. (2009) although iso-butylparaben and n-butylparaben were used as contaminants. Conversely, Lloret et al. (2010) recorded 80% improvement in the removal of diclofenac when the mediator concentration was raised from 0.5 to 1 mM from the optimum concen- tration of 0.5 mM. Ashe et al. (2016) also recorded a decline in degra- dation efficiency of contaminants when HOBT was raised above 0.1 mM.
At threshold concentration (2 mM) of the redox mediators, 98.20%, 96.69% and 93.70% degradation efficiency of olsalazine was achieved when ABTS, p-Coumaric acid and HOBT were added to the experimental set up. Statistical significance difference was observed when the experimental data was subjected to one-way analysis of variance (P≤0.05) indicating the influence of redox mediator concentration in olsalazine degradation by laccase from A. aculeatus bpo1. At all con- centrations, ABTS showed significant influence in the degradation of olsalazine than p-Coumaric acid and HOBT (Fig. 3a). This result was in disagreement with Ashe et al. (2016) who reported low improvement (73%) in the degradation of atrazine on addition of ABTS. Overall, high degradation efficiency recorded in this study depicts that ABTS showed high proliferation of radical species which exerted greater influence on steric hindrances and solubility of the olsalazine’s function group. Our result showed slight improvement of 83.50% olsalazine degradation in comparison with 80% achieved in the degradation of naproxen by Ashe et al. (2016) at the highest mediator concentration (1 mM). At lowest redox mediator dose (0.5 mM), ABTS, p-Coumaric acid and HOBT ach- ieved 78.80%, 67.09% and 57.70% degradation efficiency of olsalazine.
The oxidation mechanism of the ABTS radicals follow an electron transfer (ET) pathway while p-Coumaric acid and HOBT oxidation mechanism follow hydrogen atom transfer (HAT) pathway. Both path- ways are very effective and potent in the removal of high redox potential contaminants (Kurniawati and Nicell, 2007). Redox mediators speed up enzymatic activities of extracellular ligninolytic enzymes as well as intracellular oxidative enzymes in the enhanced degradation of PNSAIDS by fungi.
3.5. Effect of laccase-catalyzed mediator system
Redox mediators in biodegradation mechanism act as electron link- age between laccase and pollutant in order to overcome steric hin- drances and kinetic limitations of laccase. This mechanism works effectively through the release of free radicals from redox mediator oxidation by fungal laccase which in turn oxidises the PNSAIDs. In achieving this, the molecular structure of the PNSAIDs, concentration of the mediator and redox potential of the fungal laccase are important parameters that to be considered in maximising degradation efficiency (Kurniawati and Nicell, 2007). The redox mediators ABTS, p-Coumaric acid and HOBT typically follow the electron transfer and hydrogen atom transfer mechanisms. Following the addition of the three mediators, enhanced oxidation of PNSAIDs was achieved through the production on radical species. Notably, different radicals produced by ABTS, p-Cou- maric acid and HOBT in a laccase-catalyzed system plays a crucial role in PNSAIDs degradation. Highest degradation efficiency (99.5%) was achieved with the addition of ABTS to the laccase mediator system.
Addition of p-Coumaric acid and HOBT led to 98% and 94% degradation efficiencies of olsalazine. However, less degradation efficiency (76.5%) of olsalazine was recorded on treatment with A. aculeatus (Fig. 3b). The order of degradation efficiency is Laccase+ABTS>Laccase+p-Coumaric acid>Laccase+HOBT>Crude laccase. The high laccase-catalyzed degradation of PNASIDs due to ABTS addition is in agreement with the report of Naghdi et al. (2018) who, however, used laccase derived from T. versicolor. High degradation rates recorded on addition of ABTS suggests the efficiency of electron transfer mechanism deployed during oxidation of contaminants. Typically, degradation of PNSAIDS is usually enhanced with the addition of redox mediators. However, the PNSAIDs degradation efficiency is largely dependent on the mediator type and laccase used. High degradation efficiency of contaminants is best ach- ieved when fungal laccase is laced with redox mediators (Nguyen et al., 2014). In addition, the degree of removal through addition of redox mediators is equally not independent of the contaminants’ functional groups and active sites. The deployment of different reactive groups by the redox mediators might have influence synthesis of radicals’ and in turn, the difference in degradation rates (Baiocco et al., 2003; d’Acunzo and Galli, 2003).
3.6. Effect of incubation time of laccase-mediator system
Experiments were carried out at different reaction times between 12 and 48 h to determine the effect of laccase-mediator system on olsala- zine degradation efficiency. For all mediators at 12 h reaction time, the degradation rate was slow (Fig. 3c). However, rapid improvements in olsalazine degradation rate were observed between 24 and 36 h which later peaked at 48 h for all the mediators used. The slow degradation rate experienced at the initial stage suggests passive oxidation of the mediators by laccase thus leading to slow proliferation of radical spe- cies. This result is in disagreement with the study of Ashe et al. (2016).
At the peak reaction time (48 h), highest degradation efficiency of 99.71%, 97.65% and 94.23% was achieved when the laccase was laced with ABTS, p-Coumaric acid and HOBT. The free radicals produced during oxidation of mediators usually distorts the enzyme system by reacting with contaminant’s active sites (Khlifi et al., 2010).
3.7. Effect of mediator type and concentration on laccase stability Enzyme deactivation is vital for determining the long-term stability and reproducibility of batch treatment process of contaminants in a laccase-mediator system. Hence, appropriate selection of redox media- tors and concentration is crucial to achieving effective degradation of olsalazine in a laccase mediator system. In this study, the addition of redox mediators (ABTS, p-Coumaric acid and HOBT) had huge influence on the induction of laccase (Fig. 3d). At all concentrations, ABTS and HOBT exerted negative impact on laccase induction. However, it was observed that HOBT distorted the laccase-mediator system better than ABTS. At the highest concentration (2 mM), 98%, 95% and 93%
remarkable decrease in laccase induction when HOBT, ABTS and p- Coumaric acid. These were in disagreement with earlier reports of Lloret et al. (2013) where ABTS was responsible for enzyme deactivation in the enhanced degradation of NSAIDs. The difference in enzyme stability is attributable to the species of fungi used. For instance, activation and deactivation of laccase by Pycnoporus cinnabarinus (Fillat et al., 2010) and Trametes trogii (Khlifi et al., 2010) was achieved on addition of syringaldehyde respectively. Moreover, the relative stability of the radicals generated by the mediators is dependent on the difference in the rate of enzyme deactivation (Ashe et al., 2016). Laccase was distorted by 85%, 90% and 94% on addition of HOBT, p-Coumaric acid and ABTS within 24 h respectively. However, at the end of the experiment (48 h), 97–99% distortion of laccase was recorded on the addition of all the redox mediators while crude laccase maintained its stability throughout the experimental period (Fig. 3d). While redox mediators destabilize laccase induction, it however, ensures improved and enhanced
degradation efficiency of PNSAIDs by fungi. Enzyme inactivation led to enhanced degradation efficiency of diclofenac and naproxen at the initial stages of the experiment (Lloret et al., 2013). On addition of HOBT, Hata et al. (2010) reported 90% reduction in enzyme activities within 8 h whereas 99% decline in laccase activities was observed in this study after 48 h of incubation. In most cases, the decline in enzymes activities is as a result of distortion or blockage of enzyme active sites by redox mediator radicals. Despite deactivation of enzymes due to the addition of redox mediators, mediators expiate and remunerate by improving reaction rates in achieving enhanced degradation of PNSAIDs. Therefore, to ensure sustainability, applicability and repro- ducibility of the laccase-mediator system, continuous supply of enzyme is required in a batch PNSAIDs biotreatment processes.
3.8. Kinetics in laccase-catalyzed system
The drug’s half-life (t½) increases with increasing concentration (Fig. 4). At 500 mg L-1, maximum half-life (3.1 day) was observed while 1.1 day half-life was recorded when the drug concentration was set at 100 mg L-1. In the same vein, the degradation rates (K1) increases with increasing drug concentrations (Fig. 4a). However, a sharp decline in degradation rate was observed at 500 mg L-1 concentration of the drug.
This suggests that the fungal cells in the enzyme-substrate system are supersaturated with the drug having reached degradation efficiency threshold. These results were in agreement with the report of Bankole et al. (2020).
The Lineweaver-burk plot of degradation efficiency against olsala- zine concentration was used to calculate Vmax and Km (Fig. 4b). The values obtained were Vmax=111.11 hr-1 and Km=1537 mg L-1. From this study, we could deduce that the maximum drug degradation rate was attained when the fungal active sites were saturated with the drug (Das and Mishra, 2017). The results further imply that maximum degradation efficiency is achievable at drug concentration (Km≥1537 mg L−1). The coefficient of correlation (R2=0.9837) of the regression plot showed best goodness of fit for the experimental data.
3.9. HPLC analysis
The HPLC elution profile obtained after olsalazine degradation experiment revealed the formation of new peaks in the chromatograms of the treated sample. A peak was observed in untreated olsalazine at retention time (Rt) 3.82 min after 11 min elution time. Two new peaks were eluted in the treated olsalazine sample at retentions times; (Rt)
4.21 and 4.91 min (Fig. SM2). The two new peaks observed in the degraded sample implies the presence of olsalazine metabolites (Razo-Flores et al., 1997). The formation of metabolites elucidated by new peaks is attributed to the action of fungal enzymes on the drug (Srisailam and Veeresham, 2010). In addition, the new peaks It is noteworthy that most of the metabolites are eluted after olsalazine peak which signifies its’ non-polar nature. The new peaks in the HPLC chro- matogram depicts the metabolites and are similar to peaks of the ultra-violet visible spectral pattern of olsalazine. This further suggests biotransformation through addition and removal of chemical bonds in the fingerprint and functional group regions of the drug during degra- dation process by A. aculeatus. These results were in agreement with the report of Zhang et al. (2006) on the metabolism of cyclobenzaprine and protriptyline.
4. Conclusion
The study affirmed the vital role played by the redox mediators (ABTS, HOBT and p-Coumaric acid) in enhanced degradation of olsa- lazine. Overall, ABTS achieved highest degradation of olsalazine than HOBT and p-Coumaric acid. Enhanced degradation was largely pro- moted when free radicals serve as electron transfer connector between laccase and olsalazine. The pseudo-second order kinetics revealed that the average half-life and degradation rates of olsalzine increases with increasing concentrations. At maximum concentration (500 mg L-1) of olsalazine, a sharp decline in degradation rate was observed which de- picts over saturation of the active sites in the enzyme-substrate degra- dation system. Although, the redox-mediators exerted negative influence on laccase stability in the following order: HOBT>p-Coumaric acid>ABTS. However, their addition to the laccase-substrate system ensured rapid degradation of olsalazine by A. aculeatus. The formation of new peaks at different retention times (Rt) in HPLC analysis elucidated olsalazine metabolites formed after degradation. It is recommended that more mediators should be investigated for enhanced degradation of PNSAIDs since their performance in laccase-mediator system is largely dependent on the mediator type. Carrying out drug degradation exper- iments could be quite cumbersome and complex. However, it is very efficient, economical and non-laborious.
CRediT authorship contribution statement
Paul Olusegun Bankole: Conceptualization, Experimental design, Methodology, Statistical analysis, Manuscript original draft. Kirk
Fig. 4. (a) Time course changes in olsalazine degradation rates (K1) and half-life (t12) (b) Lineweaver-burk plot of degradation efficiency against varying olsalazine concentrations on treatment with A. aculeatus.
