Research Note
16S rRNA Gene Sequence Analysis of Acetic and Lactic Acid Bacteria Isolated from Philippine Sugarcane Wine (Basi)
John Russel G. Sevilla, Michael Angelo S. Esteban, Honey Bhabes R. Iñigo, Audrey Mae V. Orillaza, and Baby Richard R. Navarro
*Institute of Food Science and Technology, College of Agriculture and Food Science, University of the Philippines Los Baños, College, Laguna, Philippines
*Author for Correspondence; email: [email protected]; Phone: (049)-501-8932 Received: 11 August 2020/ Revised: 05 February 2021/ Accepted: 28 February 2021
Basi, a traditional sugarcane wine of the Philippines, was studied. Here, we used molecular- and cultural- based methods to isolate, identify and characterize acid-producing bacteria, specifically acetic and lactic acid bacteria, from basi. Acid producers were focused on owing to the rapid spoilage of basi via acidification with air exposure. Two strains each of acetic and lactic acid bacteria were isolated. DNA was extracted from these isolates. PCR-amplified DNA products were subjected to 16S rRNA gene sequencing.
The sequences of the isolates were then aligned with BLAST database sequences and found to have high similarities to Acetobacter malorum (99%), Gluconobacter oxydans (97%), Lactobacillus paracasei (97%), and Enterococcus faecium (98%), which were supported by the relationships shown by phylogenetic trees constructed using the neighbor-joining method with MEGA 7 as well as by morphological, biochemical, and physiological characteristics. It is therefore unequivocal that basi harbors both acetic and lactic acid bacteria, surmised to play crucial roles in its fermentation and perhaps rapid spoilage. Thus, good manufacturing practices and food processing interventions such as ultrafiltration and pasteurization are recommended for basi shelf-life extension.
Keywords: acetic acid bacteria, basi, fermentation, lactic acid bacteria, spoilage, 16S rRNA gene sequencing
Abbreviations: AAB—acetic acid bacteria, BLAST— basic local alignment search tool, CTAB—
cetyltrimethylammonium bromide, EDTA— ethylenediaminetetraacetic acid, GYP— glucose yeast extract peptone, LAB— lactic acid bacteria, MEGA— molecular evolutionary genetics analysis, MRS— de Man Rogosa and Sharpe, PCR— polymerase chain reaction, PSS— physiological saline solution, TE— tris·EDTA
INTRODUCTION
The Philippines boasts of a wide variety of traditional fermented products widely distributed geographically (Elegado et al. 2016). One particular fermented beverage popular in the Ilocos region is sugarcane wine, locally known as basi. It has a unique aroma and taste not found in other alcoholic beverages (Sanchez 1981). However, it has a very short shelf-life of only a few days once opened since air exposure rapidly converts it to suk ang Iloko, a local vinegar that is a common by-product of the basi industry.
Previous studies of the microflora of basi have been conducted using only culture-dependent methods.
Traditionally, the bacterial diversity of fermented products was only characterized using conventional culture and physiological and biochemical tests, which are based on phenotypes (Dalmacio et al. 2011). To date, with technological advancements, molecular-based methods have been proved to be effective and efficient in comprehensively studying fermentative microorganisms, enabling more rapid and accurate identification than conventional physiological and biochemical methods (Meroth et al. 2003). However, the former and the latter together provide results that supplement each other.
March 2021
Thus, by applying combined cultural- and molecular- based methods in identifying microorganisms in local fermented products, the discovery of numerous unculturable organisms and novel microorganisms has become highly possible (Claridge 2004).
Basi making is a thriving industry in the Philippines, sugarcane being one of the major crops produced in the country (Sanchez 1981). In spite of this, basi is not yet mass-produced, and along with other Philippine fermented foods, is still not commercially available on a large scale. As a result, its market and consumption remain regional, perhaps also linked to its short shelf-life and inferior image as a result of the lack of basi standards and the unhygienic village-based processing involved.
Thus, basi should be carefully studied to enhance its image, which hopefully will improve its stability and quality, expand its market, and perhaps increase its competitiveness with other alcoholic beverages.
In this study, we primarily aimed to isolate fermentative microflora, specifically acetic (AAB) and lactic acid bacteria (LAB), from basi and to identify them using 16S rRNA gene sequencing. We also performed preliminary characterization of the identified strains of AAB and LAB by morphological, cultural, and biochemical tests. We hope that this study will serve as the first step towards basi improvement since by identifying the different acid-producing bacteria present in basi, we can posit the root cause of basi spoilage via acid production and perhaps provide a means by which to prevent such an undesired process by inhibiting the proliferation of the aforementioned microorganisms.
Indeed, this study has high potential to be the groundwork of future studies aimed at basi shelf-life extension.
MATERIALS AND METHODS
Basi Sampling
Basi samples were procured from Tabuk and Maledda, Kalinga, Philippines. The samples were aseptically transferred in sterilized containers (i.e., test tubes with cotton plugs and fermenting jars) and stored at room temperature until analysis.
Bacterial Isolation, Purification, and Storage A loopful each of the basi samples was aseptically streaked on glucose (2%)-yeast extract (0.2%)-peptone (0.3%) (GYP) agar slants and stab-inoculated into de Man Rogosa and Sharpe (MRS) agar for AAB and LAB isolations, respectively. The slant and stab cultures were then incubated at room temperature, and upon growth,
stored in an ice cooler. In the laboratory, the stab and slant cultures were spread-plated onto GYP agar with CaCO3 and pour-plated in MRS agar with bromothymol blue for AAB and LAB isolations, respectively. The cultures were then incubated at 30 and 37°C for 24-48 h for AAB and LAB isolations, respectively. Thereafter, single colonies that formed a clearing on GYP agar with CaCO3 were individually inoculated into GYP broth, and incubated again at 30°C for 24 h. On the other hand, single colonies in the MRS agar medium with a yellow halo were individually inoculated into MRS broth, and incubated again at 37°C for 24-48 h. The procedure of broth-agar-broth transfer was repeated three times to ensure microbial purity. Thereafter, all purified isolates were processed for Gram staining and catalase test. All Gram-negative, catalase-positive, and Gram-positive, catalase positive isolates were considered as AAB and LAB respectively. The cultures were then stored in glycerol at -20°C, revived to check for culture viability, and used in further experiments.
Bacterial Isolate Identification
CTAB DNA extraction (Wilson 2001) was performed.
Each isolate was inoculated into 5 mL of corresponding liquid culture medium and incubated at 30°C and 37°C for AAB and LAB isolates, respectively, for 24-48 h. Each culture was then centrifuged at 12,000 rpm at room temperature and the precipitate resuspended in 200 µL of TE buffer (p H 8.0) containing 10 mM Tris•HCl and 1 mM EDTA. 25 μL of 10% SDS and 5 μl of 20 mg mL-1 proteinase K were added to the suspension, which was then incubated at 37°C for 60 min. Then, 45 μL of 5 M NaCl was added to the mixture, which was then mixed thoroughly. Afterwards, 40 μL of CTAB (10% CTAB in 0.7 M NaCl) solution was added. Approximately equal volumes of chloroform and isoamyl alcohol (24:1) were added and the mixture was vortexed and centrifuged at 12,000 rpm for 10 min. The aqueous phase obtained was transferred to a fresh tube, extracted with 630 µL of cold isopropanol, and centrifuged at 8,000 rpm for 5 min at 5°C. The precipitate obtained was washed with 1 mL of 70% ethanol. The DNA pellet was dried in a laminar flow hood for 30 min and suspended in 100 μL of TE buffer.
The DNA collected was then quantified using a UV spectrophotometer (EpochTM, Swindon, UK).
PCR amplification was performed based on the method of Larcia et al. (2011). The V1-V8 region of the 16S rRNA gene was amplified using the universal primers 8f (5’ AGAGTTTGATCCTGGCTCAG 3’; Turner et al. 1999) and 1492r (5’ GGTTACCTTGTTACGACTT 3’; Turner et al. 1999) (Asiagel Corporation (Metro Manila, Philippines). The PCR mixture consisted of 2 μL of 1x
reaction buffer, 0.1 μL of Taq polymerase, 0.3 μL each of 8f and 1492r , 0.6 μL of 1.5 mM MgCl2, 0.4 μL of 2 mM dNTP, 1 μL of template DNA at 250.16, 194.58, 368.81, and 163.29 ng μL-1 for AAB1, AAB2, LAB1, and LAB2, respectively, and 15.3 μL of sterile water in 20 μL total volume. The PCR amplification used a VeritiTM thermal cycler (Applied Biosystems, California, USA) with the following program: initial denaturation of 94°C for 5 min;
35 cycles of denaturation at 94°C for 1 min, annealing at 53°C for 1 min, and elongation at 72°C for 105 s; and extension at 72°C for 5 min. Afterwards, the products were confirmed by electrophoresis on 2% (w/v) agarose gel viewed under a GelDocTM photo documentation system (Bio-Rad, California, USA).
The amplified DNAs of the samples were sent to First BASE Laboratories Sdn. Bhd. (Selangor, Malaysia) for 16S rRNA gene sequencing as contracted service. The obtained sequences were compared with sequences in a sequence library using Basic Local Alignment Search Tool (BLAST) (https://blast.ncbi.nlm.nih.gov). Phylogenetic trees were then constructed using Molecular Evolutionary Genetics Analysis (MEGA) software version 7 (Kumar et al. 2015).
Bacterial Isolate Characterization
The AAB isolates were tested for water-soluble brown pigment formation in GYP agar slants with 2% CaCO3, cellulose production, motility, γ-pyrone formation from D-glucose and D-fructose using FeCl3, and growth in various carbon sources (glucose, fructose, xylose, galactose, maltose, sorbitol, sucrose, and starch) based on culture turbidity.
On the other hand, the LAB isolates were characterized for acid production from different carbon sources (i.e., glucose, fructose, xylose, galactose, maltose, sorbitol, sucrose, and starch), growth under different conditions (temperature: 4, 27, and 45°C; pH: 2.5, 4.4, and 9.6; and salt concentration: 3, 6.5, and 10% NaCl) for 24 h based on culture turbidity.
RESULTS AND DISCUSSION
Bacterial Isolation, Purification and Partial Characterization
Using culture-based methods, several likely strains of AAB and LAB were isolated from basi. These isolates were confirmed by Gram staining, catalase test, and microscopic examination. Two isolates from the GYP medium were found to be Gram-negative, catalase- positive aerobic short rods, and hence considered to be AAB, in accordance with Kersters et al. (2020) review of
the family Acetobacteraceae. Kersters et al. (2020) described AAB as “Gram-negative, obligately aerobic rods” thriving in sugary, alcoholic, and acidic environments and exerting both good and deleterious effects on food and beverages. AAB are clearly distinguished from LAB as catalase-positive bacteria (Sievers and Swings 2005). On the other hand, two isolates from the MRS medium were found to be Gram- positive, catalase-negative anaerobes: one showed rod cells and the other showed coccal cells. These were considered LAB as per description of Pot et al. (1994). To confirm all four isolates, they were further identified using DNA extraction, PCR amplification, and 16S rRNA gene sequencing.
Bacterial Isolate Identification
Using molecular-based analyses, the sequence homologies of the four isolates with known species of AAB and LAB from BLAST were determined. AAB1 showed 99% homology to Aceto bacter m alorum (NR_113553.1), a strain first isolated in rotting apples but is commonly isolated from alcoholic fermentation musts of sak e, tequila, palm wine, and grape wine (Escalante et al. 2008). On the other hand, AAB2 showed 97%
homology to Gluconobacter oxyd ans (NR_118196.1), a species associated with the oxidation of sugars, alcohols, and acids (Gupta et al., 2001). LAB1 had 97% homology to Lactobacillus paracasei (NR_113337.1), a LAB commonly found in fermented dairy products. Note that some strains of L. paracasei serve as probiotics (Jones 2017).
Lastly, LAB2 showed 98% homology to Enterococcus faecium (NR_113904.1), a lactic acid bacterium commonly isolated from plants, food, and beverages, as well as from human and animal gastrointestinal tracts (Kim and Marco 2014). Although some of its strains may be pathogenic, E.
faecium produces antibacterial peptides called bacteriocins. It is also used in fermenting cheese and vegetables and serves as a probiotic to outcompete deleterious bacteria in the gastrointestinal tract (Kang & Lee 2005). From the BLAST sequence comparison results, the four isolates from basi are clearly species of AAB and LAB.
The phylogenetic relationships of the AAB (Fig. 1a) and LAB (Fig. 1b) isolates with the type species of all valid genera of the said bacterial groups were constructed by the neighbor-joining method with 1000 bootstrapping replicates. The phylogenetic trees unequivocally confirmed the BLAST homologous identities (with 100%
sequence similarity) of AAB1 as A. malorum, AAB2 as G.
oxydans, LAB 1 as L. paracasei, and LAB 2 as E. faecium, the former two perfectly clustering with all the valid genera of AAB and the latter two with LAB.
Bacterial Isolate Characterization
From Table 1, AAB1 and AAB2 showed characteristics that are generally in agreement with the basic characteristics of AAB. Our data show that the two basi isolates were correctly identified since, just like all genera in the family Aceto bacteraceae, Glucono bacter and Acetobacter are Gram-negative, catalase-positive aerobic short-rod-shaped bacteria (Ray 2004). The results of motility test, cellulose production, and water-soluble brown pigment formation corroborate previously reported characteristics of both genera that mentioned
Gluconobacter and Acetobacter species being non-motile and unable to produce cellulose or water-soluble brown pigment (Mamlouk and Gullo 2013). However, the result of γ-pyrone formation from D-glucose and D-fructose by AAB2 is in contrast to the result of Mamlouk and Gullo (2013). This might be explained by variations in characteristics among strains, which have often been observed in AAB. Table 1 also shows the growth of AAB isolates in different sugars used as the sole carbon source.
AAB2 is typical of G. oxyd ans, able to catabolize xylose and sorbitol owing to its membrane-bound dehydrogenase (Mamlouk and Gullo, 2013; Gupta et al.
2001). On the other hand, AAB1 shows different results from A. malorum, since Acetobacter species give interstrain variation in their utilization of most carbon sources (Mamlouk and Gullo 2013).
In alcoholic beverage production, AAB produce acetic acid from ethanol, which results in vinegary off-flavors, turbidity, and ropiness when incorrect basic hygienic and technical procedures are performed (Raspor and Goranovič 2008). Glucono bacter strains thrive in sugar- rich environments compared with Acetobacter strains, which prefer alcohol-rich environments. However, they both cause spoilage of wine and beer (Raspor and Goranovič 2008). It is highly probable then that AAB are a primary cause of basi spoilage, the bacteria being naturally present in sugarcane juice. However, owing to the addition of the bark, leaves or fruit of samak [parasol leaf tree, Macaranga tanarius (L.) Müll.Arg.], their growth is inhibited since samak has the antibacterial gallotanin, which suppresses the proliferation of acetic (also lactic) acid bacteria (Mura et al. 1996); moreover, AAB being aerobic in nature are suppressed of their growth under a sealed-bottled condition. However, when the bottle of basi is opened, air exposure promotes the growth of AAB, which immediately converts ethanol to acetic acid, the common culprit in basi spoilage and the main component of Table 1. Characteristics of AAB isolates from basi.
Characteristic AAB1 Acetobacter AAB2 Gluconobacter
Gram stain - - - -
Shape short rod short rod short rod short rod
Catalase + + + +
Cellulose production - - - -
Water-soluble brown
pigment formation + - + v
Motility - - - -
Formation of γ-pyrones from:
D-Glucose - - + v
D-Fructose - - - +
Growth on various carbon sources:
Glucose + V + +
Fructose - - + +
Xylose - V + +
Galactose v V - +
Maltose + V + +
Sorbitol - - + +
Sucrose v V + +
Starch w Nd - nd
(+) – positive; (-) – negative; (w) – weak growth; (nd) – not determined.
Data for Acetobacter and Gluconobacter were adapted from Mamlouk and Gullo (2013) and Manero and Blanch (1999).
a b
Fig. 1. Phylogenetic tree based on 16S rRNA gene sequences of (a) acetic and (b) lactic acid bacteria, and reference strains (accession numbers in parentheses) constructed by the neighbor-joining method. Leuconostoc mesenteroides strain L4 (EF579729.1) and Acetobacter malorum strain JCM 17274 (NR_113553.1) were respectively used as the outgroup.
Numerals at the nodes indicate bootstrap percentages derived from 1000 replicates. The scale bar represents sequence divergence.
sukang Iloko (local vinegar in the Ilocos region). Thus, it is recommended to conduct quality control measures like ultrafiltration and pasteurization prior to bottling/
packaging.
From Table 2, LAB1 and LAB2 were both found to be Gram-positive, catalase-negative rod and coccus, respectively. These results are in sync with the basic characteristics of LAB. LAB1 and LAB2 were both motile, grew at 20 and 45°C, and were unable to survive at pH 2.5. Both isolates grew at 3% salt concentration, but not at 10%. These results support the identity of LAB1 (from BLAST) as L. paracasei since this species has an optimal growth temperature between 10 and 37°C and does not grow above 40°C (Collins et al. 1989). Furthermore, Lactobacillus species do not grow well at pH 4.4 or 6.5% NaCl concentration (Ray 2004). Moreover, LAB2 showed growth typical of Enterococcus, which grows between 10 and 45°C in 6.5% NaCl broth at pH 9.6 (Morandi et al.
2005). LAB1 and LAB2 produced acid in monosaccharides such as glucose, fructose, and galactose. Also, they showed growth in the disaccharides such as maltose and sucrose. They both showed negative acid production from xylose, sorbitol, or starch. According to Ray (2004),
Lactobacillus species utilize lactose, sucrose, fructose, or galactose, and some can ferment pentoses. The results for LAB2 are in sync with the study of the acid production of E. faecium conducted by Manero and Blanch (1999).
In wine making, the common LAB genera isolated are Lactobacillus, Oenococcus, and Pediococcus (Fugelsang &
Edwards 2007). LAB can improve the quality and stability of wine when production is well controlled (Lonvaud- Funel 1999). However, LAB also depreciate wine quality since early growth of heterofermentative strains of LAB will ferment carbohydrates that have not been completely fermented by yeasts. Hence, the formation of acetic acid and L-lactic acid will increase the volatile acidity of wine (Lonvaud-Funel 1999). It is quite interesting that the LAB isolated from basi, i.e., L. paracasei and E. faecium, are either seldomly isolated from wine (Dicks and Endo 2009) or not associated with wine fermentation (Dundar 2016).
L. paracasei may be naturally present in sugarcane or may be acquired during post-harvest handling since if it is isolated in wine, it is found in the fermenting must of wine (University of California n.d). Mtshali et al. (2009) discovered that some strains of L. paracasei contain genes coding for wine-related enzymes that have a potential to hydrolyze wine precursors to improve wine aroma. For now, the role of L. paracasei in basi fermentation remains to be elucidated. Note that the metabolic potential of wine LAB is diverse and complex. However, it is clear that the evident presence of LAB in basi points to the possible role of these bacteria in basi flavor development if not in its spoilage prior to acetification.
On the other hand, Enteroco ccus species have been reported as important wine spoilage organisms owing to their potential to produce tyramine; they are not considered wine bacteria, implying contamination of E.
faecium due to winery equipment used for wine production (Capozzi et al. 2011). Thus, the Enteroco ccus isolate identified in basi may well be a contaminant of basi fermentation as a result of the unsanitary means of production of this local wine, highlighting the need to practice good manufacturing practices and food hygiene in basi making.
CONCLUSION
Basi harbors both AAB and LAB, which most definitely play a role in its fermentation and spoilage. From the results of 16S rRNA gene sequencing and BLAST sequence comparison, these acid-producing bacteria are A.
malorum, G. oxydans, L. paracasei, and E. faecium. Their identities are supported by morphological, cultural, and biochemical test results. Thus, although molecular-based Table 2. Characteristics of LAB isolates from basi.
Characteristic LAB1 Lactobacillus LAB2 Enterococcus
Gram stain + + + +
Shape rod rod coccus coccus
Catalase - - - -
Growth at different temperatures (°C)
4 - - - -
20 + + + +
45 - - + +
Growth at different pHs
2.5 - - - -
4.4 w w + +
9.6 + + + +
Growth at different salt concentrations
3% + + + +
6.50% w w + +
10% - - - -
Fermentation of (acid production from) sugars
Glucose + + + +
Fructose + + + +
Xylose - - - -
Galactose + + + +
Maltose + + + +
Sorbitol - - - -
Sucrose + + + +
Starch - nd - Nd
(+) – positive; (-) – negative; (w) – weak growth; (nd) – not determined.
Data for Lactobacillus and Enterococcus were adapted from Mamlouk and Gullo (2013), Gupta et al. (2001), Collins et al. (1989) and Morandi et al. (2005).
methods have been shown to be highly effective and efficient in identifying microorganisms, it remains true that using them in combination with culture-based methods for supplementary data is a fail-safe approach to bacterial systematics. In future studies, we will perform a PCR-DGGE analysis of the microbial succession during basi fermentation to identify the time points and conditions when acid-producing bacteria start to proliferate in the product in order to develop an appropriate preservative processing measure or intervention specifically designed to extend basi shelf-life.
REFERENCES CITED
CAPOZZI V, LADERO V, BENEDUCE L, FERNANDEZ M, ALVAREZ MA, BENOIT B, LAURENT B, GRIECO F, SPANO G. 2011. Isolation and characterization of tyramine-producing Enterococcus faecium strains from red wine. Food Microbiol 28: 434–439.
CLARIDGE JE. 2004. Impact of 16S rRNA gene sequence analysis for identification of bacteria on clinical microbiology and infectious diseases. Clin Microbiol Rev 17: 840–862.
COLLINS MD, PHILLIPS BA, ZANONI P. 1989.
Deoxyribonucleic acid homology studies of Lactobacillus casei. Int J Syst Bacteriol 39: 105–108.
DALMACIO LMM, ANGELES AKJ, LARCIA LLH, BALOLONG MP, ESTACIO RC. 2011. Assessment of bacterial diversity in selected Philippine fermented food products through PCR-DGGE. Benef Microbes 2:
273–281.
DICKS LMT, ENDO A. 2008. Taxonomic status of lactic acid bacteria in wine and key characteristics to differentiate species. S Afr J Enol Vitic 30: 72–90.
DUNDAR H. 2016. Bacteriocinogenic potential of Enterococcus faecium isolated from wine. Probiotics Antimicrob Proteins 8: 150–160.
ELEGADO FB, COLEGIO SM, LIM VM, GERVASIO AT, PEREZ MT, BALOLONG MP, MENDOZA BC. 2016.
Ethnic fermented foods of the Philippines with reference to lactic acid bacteria and yeasts. In: Tamang JP, editor. Ethnic fermented foods and alcoholic beverages of Asia: India: Springer. p. 323-340.
ESCALANTE A, GILES-GÓMEZ M, HERNÁNDEZ G, CÓRDOVA-AGUILAR MS, LÓPEZ-MUNGUÍA A, GOSSET G, BOLÍVAR F. 2008. Analysis of bacterial community during the fermentation of pulque, a traditional Mexican alcoholic beverage, using a polyphasic approach. Int J Food Microbiol 124: 126–
134.
FUGELSANG KC, EDWARDS CG. 2007. Wine microbiology: Practical applications and procedures.
USA: Springer. https://doi.org/10.1007/978-0-387-33349 -6.
GUPTA A, SINGH VK, QAZI GN, KUMAR A. 2001.
Gluconobacter oxydans: Its biotechnological applications. J Mol Microbiol Biotech 3: 445–456.
JONES RM. 2017. The use of Lacto bacillus casei and Lactobacillus paracasei in clinical trials for the improvement of human health. The microbiota in gastrointestinal pathophysiology: Implications for human health, prebiotics, probiotics, and dysbiosis.
https://doi.org/10.1016/B978-0-12-804024-9.00009-4.
KERSTERS K, LISDIYANTI P, KOMAGATA K, SWINGS J. 2006. The family Acetobacteraceae: The genera Acetobacter, Acidomonas, Asaia, Gluconacetobacter, Gluconobacter and Kozakia. In: Dworkin M., Falkow S, Rosemberg E, Schleifer KH, Stackebrandt E, editors.
The prokaryotes. New York, New York: Springer. p.
163-200.
KIM EB, MARCO ML. 2014. Nonclinical and clinical Enterococcus faecium strains, but not Enterococcus faecalis strains, have distinct structural and functional genomic features. Appl Environ Microbiol 80 (1): 154–
165.
KUMAR S, STECHER G, TAMURA K. 2015. MEGA7:
Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol Biol Evol 33: 1870-1874.
LARCIA LL, ESTACIO RC, DALMACIO LM. 2011.
Bacterial diversity in Philippine fermented mustard (burong mustasa) as revealed by 16S rRNA gene analysis.
Benef Microbes 2: 263–271.
LONVAUD-FUNEL A. 1999. Lactic acid bacteria in the quality improvement and depreciation of wine. Anton van Lee 76: 317-331.
MAMLOUK D, GULLO M. 2013. Acetic acid bacteria:
Physiology and carbon sources oxidation. Indian J Microbiol 53(4): 377–384.
MANERO A, BLANCH AR. 1999. Identification of Enterococcus spp. with a biochemical key. Appl Environ.
Microbiol 65: 4425–4430.
MEROTH CB, WALTER J, HERTEL C, BRANDT MJ, HAMMES WP. 2003. Monitoring the bacterial population dynamics in sourdough fermentation processes by using PCR-denaturing gradient gel electrophoresis. Appl Environ Microbiol 69: 475–482.
MORANDI S, BRASCA M, ALFIERI P, LODI R, TAMBURINI A. 2005. Influence of pH and temperature on the growth of Enterococcus faecium and Enterococcus faecalis. Dairy Sci Technol 85: 181- 192.
MTSHALI PS, DIVOL B, VAN RENSBURG P, DU TOIT M. 2010. Genetic screening of wine-related enzymes in Lactobacillus species isolated from South African wines. J Appl Microbiol 108: 1389–1397.
MURA K, SHIRAMATSU H, TANIMURA W. 1996.
Inhibitory substance for the growth of lactic acid bacteria in samac (Macharanga grandifolia Linn.) fruit.
Nippon Shokuhin Kagaku Kogaku Kaishi 43(7): 866- 872.
POT B, LUDWIG W, KERSTERS K, SCHLEIFER KH.
1994. Taxonomy of lactic acid bacteria. In: De Vuyst L, Vandamme EJ, editors. Bacteriocins of Lactic Acid Bacteria. Boston, MA: Springer. https://
doi.org/10.1007/978-1-4615-2668-1_2
RASPOR P, GORANOVIČ D. 2008. Biotechnological applications of acetic acid bacteria. Crit Rev Biotechnol 28: 101–124.
RAY B. 2004. Fundamental food microbiology. 3rd ed.
New York, USA: CRC Press.
SANCHEZ PC. 1981. Studies on the traditional sugarcane wine (basi) production in the Philippines. Philipp J Crop Sci 6(3): 108-116.
SIEVERS M, SWINGS J. 2005. Family Aceto bacteraceae. In Bergey’s manual of systematic bacteriology. 2nd ed.
New York, USA: Springer p. 41-95.
TURNER J, HINGORANI MM, KELMAN Z, O’DONNELL M.1999. The internal workings of a DNA polymerase clamp-loading machine. EMBO J 18 (3): 771–783.
UNIVERSITY OF CALIFORNIA. n.d. Lactobacillus paracasei. Retrieved July 27, 2018 from http://
wineserver.ucdavis.edu/industry/enology/winemicro/
winebacteria/lactobacillus_paracasei.html
WILSON K. 2001. Preparation of genomic DNA from bacteria. Curr Protoc Mol Bio https://
currentprotocols.onlinelibrary.com/doi/
abs/10.1002/0471142727.mb0204s56.
