JOURNAL OF MIUTftftV PHflRMnCO-MCDICINC 7-2013
EFFECTS OF UMBILICAL CORD EXCTRACTS ON PROLIFERATION AND GENE EXPRESSION OF
CULTURED HUMAN SKIN FIBROBLAST
Pham Van Phuc*; Dang Thi Tung Loan*; Phan Kim Ngoc*
Dinh Thanh Uyen**; Le Van Dong***
SUMMARY
Wrinkles are consequences of skin aging. This pnDcess is characterized with collagen breakdown and shortage In skin structure. This study tested the effects of newborn umbilical cord extracts on the proliferation and synthesis of collagen type 1, fibronectin and metalioproteinase 1 (MMP-1) of human skin fibroblast. 25 formulas made of 4 types of extracts included: extracellular extract of coni tissue;
intracellular extract of cord cells; mixtures of these two extracts; intracellular extract of umbilical cord stem cells, were supplemented to culture media of human fibroblast. Cell proliferation was evaluated by MTT assay; gene expression was analyzed by Real-time RT-PCR technique. The results showed that supplementation of 7.5% of formula 3-5 containing a combination of both extra- and intra-cellular extracts of umbilical cord led to the highest cell proliferation and also stimulated the expression of collagen type 1 while inhibited the expression of MMP-1 on fibroblast These data suggested that umbilical cord extract would be a potential source of material for wrinkle reduction skin care product.
' Key words: Skin aging; Wrinkle; Stem cell; Umbilical cord extract.
I N T R O D U C T I O N
Aging is the issue that is getting more and more attentions because of its social impacts. Skin aging is known to be caused mainly by exposure to light since then it Is being referred as photo-aging, in which sunlight UV is main cause. U V ray activates signal transductions via protein kinases in cells located through dermis leading to the over expression of genes related to proteolysis of proteins in extracellular matrix such as metalioproteinase ( M M P ) 1 (collagenase), MMP-3 (stramelysis 1), and MMP-9 (gelatinase) [ 2 , 5 ] . MMP-1 cuts collagen type I, 111 of skin tertiary structures t h e n collagen continue to be digested by M M P - 3 and MMP-9 [10].
Hence, once being induced by UV, MMP will break d o w n collagen causing skin structure damage. If lack of factor to fix these damages,
collagen damage caused by MMP will accumulate time to time and contribute to the human skin aging. Apart from collagen lysis, U V light also inhibits the synthesis of collagen type I and III [3]. Collagen breakout and less collagen synthesis are two directions leading to severe loses of collagen component In skin, causing changes in extracellular matrix, ultimately create wrinkles at the collagen lysis places. It is the main and most important of skin aging. Since then, skin anti-aging treatment needs to control t l i e collagen lysis process, or inhibit the production of MMP In general and MMP-1 In particular and also stimulate the synthesis of new collagen.
Stem cell extract and stem cell secreted factors and other factors that act on skin cells are considered to be able to do so that lead to skin anti-aging.
* Hochiminh City National University
" Mekostem Stem Cell Bank
"** Vietnam Military Medical University
Address correspondence to Le Van Dong: Vietnam Military Medical University E.mail: levandong^rahoo.com
39
JOURNAL OF WILITARV PHRRWRCO-MgPICINC 7-2013 Stem cells from various sources have demonstrated that they secrete numerous cytokines such as vascular endothelial growth factor (VEGF), transforming growth factor (TGF) and some proteins such as collagen, fibronectin, elastin etc. [9]. These proteins are mainly responsible for skin plasticity. Newborn umbilical cord is known to contain various types of stem cells, stem cell derived factors and essential factors for stem cells packed in different parts of the cord such as Wharton's jelly, blood vessel and cord lining membrane. Since then, this research aimed: To test the effect of different extracellular and intracellular extracts of umbilical cord tissue and cells on the proliferation of human fibroblast and the synthesis of skin essential proteins such as collagen type I, fibronectin and MMP-1.
MATERIAL AND METHODS 1. Isolation and culture of human skin fibroblast.
Human skin fibroblasts of adult donors were isolated and cultured followed the standard procedures that was optimized previously in our lab as selection tissue culture protocols with DMEM/F12 media supplemented with 10% FBS at 37°C, 5%
CO2. The culture medium was replaced every four days. Subculture was done once the cell reached 70 - 80% confluence. After three subculture cyrcles, fibroblast was harvested and characterized by morphology evaluation and the expression of CD90 analyzed by flowcytometry by which more than 90% of cell population are positive with CD90. This cell population was then used for the whole experiments.
2. Umbilical cord stem cell sorting.
Umbilical cord tissues were process mechanically to cell suspension. Stem cells
were sorted by fluorescence activated cell sorting (FACS) method on FACSJazz system (BD Bioscience, USA). Each stem cell type was sorted as it stained with antibody to a specific marker: CD90 for mesenchymal stem ceil; GD117 for epittieiial stem cell;
GD113 for vascular endothelial stem cell.
3. Preparation of cord cell and tissue extracts.
* Umbilical cord collection and storage:
130 newborn umbilical cords samples that voluntarily donated by biological mothers were collected for research purpose. Mothers and the cords were selected following a strictly screening tests followed NetCord standards and had negative results to all HIV, HBV, HGV, CMV as described in our previous paper [1]. After collection in hospitals and transferred to the lab, eacli cord was taken a portion with the length ranging from 18 to 22 cm. The cords were then stored at -80°G till further usage.
* Preparation of extracellular extract:
Frozen cords were defrosted in the 37°C water bath then washed with physiological saline; sliced, add buffer (saline supplemented with protease inhibitor, Sigma-Aldrich, USA) to protect protein from hydrolysis during the preparation process. The mixture was milled thoroughly, then centrifuged at 3,000 rpm for 20 minutes at 4°C. The supernatant (namely as cord tissue extract or extracellular extract) was then serially diluted to different concentrations and kept at -80°C till the next usage.
* Preparation of cellular extract:
The pellet obtained ft-om above was quickly frozen with liquid nitrogen and defrosted with warm buffer (saline supplemented wltti protease inhibitor) then centrifuged at 3,000 rpm for 20 minutes at 4°C. The supernatant obtained after this step (nameiy as cord cellular extract or intracellular exti-act) was then serially diluted to different concentrations
JOURNAL OF MILITARY PHRRMACO-MCDICINC 7-2013 and kept at -80°C till the next usage. The
cord tissue extract and cord cellular extract were mixed together in difl'erent ratio to fonri various formulas for lijrther activity testing.
* Preparation of stem cell extract:
Stem cell cellular extract was also prepare as described above.
' Cord extracts combinations:
5 main preparations were formulated: cord tissue extract, total cord cellular extract, cord stem cell extract, mixture of cord tissue and cord cellular extracts, control (physiological saline). Each preparation was diluted into five different concentrations and form 25 testing formulas coded as followed' Gord tissue extract: solution 1-1; 1-2; 1-3; 1-4; 1- 5; Gord cellular extract: solution 2-1; 2-2; 2- 3; 2-4; 2-5; Mixture of cord tissue and cord cellular extracts: solution 3-1; 3-2; 3-3; 3-4;
3-5; Cord stem cell extract: solution 4-1; 4- 2; 4-3; 4 ^ ; 4-5; Gontrol: solution 5-1; 5-2; 5- 3; 5-4; 5-5.
4. Cell proliferation assessment by MTT assay.
The c^i proliferation was evaluated following the instmction of manufacturer (Gell proliferating
kit GeneWortd, Hochiminh Gity, Vietnam) as followed: Take the 96 well cell culture plates out of the incubator and move to the clean cell culture area, add sterile MTT equal to 10% of final volume, put the 96 well cell culture plates back into tiie incubator for another 3 - 4 hours; after the incubation, take the plates out of the incubator and dissolved the MTT formazan crystals by adding equal volume of solvent. The absorbent was measured within 1 hour after adding the solvent with a spectrometer (Multimode Reader DTX880, Beckman- Coulter, USA) 570 nm (measure wavelength) and 690 nm (referent wavelength).
5. Realtime RT-PCR analysis.
Total RNA was extracted as described in our previous study [7]. Genetic markers were analyzed are collagen type I, fibronectin and MMP-1. Tlie Real-time RT-PGR analysis was perform on Eppendorf gradient S thermal Gycler system (Eppendorf-AG, Hamburg, Germany) with the primers are listed in table 1.
Table 1: Details of primers used in this research.
GENES Collagen type 1
Fibronectin
Matrixmetalloproteinase (MMP)-1
ACCESSION NO NM 000088.3
NM 212482.1
YP 003494989 1
PRIMER (5'-3') F CGGAGGAAACTTTGCTCCCC R: CCCTTAGCACCAGTGTCTCC F: TGAAGAGGGGCACATGCTGA R: GTGGGAGTTGGGCTGACTCG FlAAAATCCTGTCOAGCCCATCQ R:TTCTGTCCCTGAACAGCCCAGT
REF.
m
6. Data analysis.
All tests were repeated three times. Value p s 0.05 is considered as statistical significant. Data was analyzed by Statgraphics scftware 7.0 (Statgraphics Graphics System, Warrenton, VA).
41
JOURNAL Of millTBRV PHHRBMCO-MtDICIWt 7-2013 RESULTS AND DISCUSSION
1. Effects of different extraction formulas on the proliferation of fibroblast
In this research, we had prepared 25 fomnulas for screening with fibroblast by supplement 10% of each formula to the cell culture media. MTT assay was utilized to evaluate the cell prolNefation after 0, 2, 4, 6, 8 and 10 days and data are shown in figure 1.
1'^-
11 12 14 15
22 13 24 25
l i .
rmAd^d
Figure 1: Proliferation rates of fibroblasts cultured in media supplemented with 25 different formulas after 0,2, 4, 6, 8 and 10
days (from left to right).
The increase of activity and proliferation of fibroblast help skin to keep its normal structure. Decrease in fibroblast proliferation and production of essential proteins of skin structure, especially collagen, is one of the
causes leading to skin structure loses and wrinkle fomiation. Skin fibroblast proliferating stimulation is one important characteristics on skin rejuvenating and anti-wrinkle product Data from figure 1 show that, generally In all formulas, fibroblast proliferates when they are being cultured. Among them, fonnula 3-5 shows strongest proliferation activity. At day 0, 2, 4 and 6, the amount of cells proliferated equally to other formulas;
however, at day 8 and 10, the proliferation increased significantty in comparison to other formulas. This data indicate that, among 25 formulas tested, fomiula 3-5 contain essential elements necessary for fibroblast growth. In fact, fonnula 3-5 contain both extracellular and cellular extracts of umbilical cord tissues;
among them proteins such as collagen, hyaluronic acid, stem cell derived growth factors etc. that stimulate fibroblast to growth better. The fact that formula 3-5 give the best effect also reflecting that fibroblast proliferation requires balanced proteins from both extracellular and cellular origins. In the other word, total extract from whole umbilical cord tissue give good effects on fibroblast Others extracts - either from extracellular origin (solution 1-) or intracellular origin (solution 2-) did not show clear stimulation effects during the culturing period tested.
Proteins from extracellular and intracellular' origins seem to work compiementarily to each others.
2. Effects of concentrations of formula 3-5 on fibroblast proliferation.
As the contents and preparation of formula 3-5 is rather expensive if adding too much to the final skin care product, we decided not to supplement more than 10% volume of the final product. As such, in this study, we test the effects of supplementing formula 3-5 at concentration of 2.5%, 5%, 7.5% and 10%
JOURNRL OF MlUrnnV PHflRMnCO-MCDICINC 7-2013 volume of culture media. Data presented in
figure 2 shows the different supplement concentrations giving different effects on fibroblast proliferation. In general, very little difference seen between 7,5% and 10%, but significantiy differences was seen between 10% aid other concentrations. Since then we selected supplementation of 7.5% of fonnula 3-5 for the next experiments.
Figure 2: Fibroblast proliferation after supplemented with 3-5 formula at different
ratios after 0, 2,4, 6, 8 and 12 days.
3. Effects on the expression of genes reiated to formation of wrinlde.
Another important effect of anti-wrinkle product is stimulating fibroblast to produce factors necessary for skin restructuring and inhibit the production of products leading to break down of extracellular matrix. Consequently, in order to produce a anti-wrinkle product, formula 3-5 supplementation at 7.5% was selected for testing the effect on expression of genes related to skin restnjcture, especially wrinkle treatment. In this study, we assessed the expression of 3 genes namely collagen I, fibronectin and MMP-1. The RT-PGRs were compared between control (without formula 3-5) and test group supplemented with formula 3-5 at 7.5% and presented in figure 3. The results show that different expressions of the three tested genes were seen among tested and control subjects. In the tested group, stronger expression of collagen I was seen jn comparison to control group; however, this is not significant
difference. The expression of fibronectin is almost no change while the expression of MMP-1 strongly decreased (p > 0.5) in the tested group in comparison to control group.
IIJI
Figure 3: Ghanges in expression of some genes related to wrinkles in fibroblasts before and after treatment with formula
3-5 in vitro.
One of the reasons leading to formation of wrinkle is the activity of MMPs (matrix metalioproteinase). MMP hydrolyses structural proteins in skin such as collagen, laminin, fibronectin and elastin. In order to keep skin stnjcture balance, MMP-1 activity is regulated by proteins and MMP inhibitors called TIMP (tissue inhibitor of metalioproteinase). As skin aged, the imbalance between MMP-1 and TIMP make skin lose its stmcture and formation of wrinkle [4, 8]. Gaining back the regulation of MMP-1 activity or inhibit the expression of this gene is a key point in anti-wrinkle treatment. The above presented results show that the expression of MMP-1 strongly decreased as supplemented 7.5% of formula 3-5 to the fibroblast culture medium indicating that formula 3-5 inhibits MMP-1 expression. Since tiien, fonnula 3-5 is potentially be an anti wrinkle treatment in vivo.
CONCLUSION
This in vitro research demonstrates that the umbilical cord extracts have some effects on human fibroblast. Especially, formula 3-5 which is mixture of cord tissue and cellular 43
JOURNflL OF WILirnRV PHflRlWHCO-M€PICIN€ 7-2013
extracts, shown strongest stimulation effect at 7.5%. At this concentration, fibroblast not only strongly proliferated but also decreased the expression of gene related to wrinkle fomiation such as MMP-1 and increased the expression of collagen I. T h e s e data show that umbilical cord extracts can be used for development of anti wrinkle skin care product.
Acknowledgment
This research w a s partially financially supported by research project "Development and evaluation the effects of beauty pn^duct from umbilical cord stem cell" Gode: 188- 2010 sponsored by Department of Science and Technology of Hochiminh City.
R E F E R E N C E S
1 Pham Thuy Trinh. L§ VSn 06ng vd CS.
Nghign CLFU phSn ISp te bao goc trung m6 tCr mSng dSy r6n tre so sinh. Tap ch( ThSng tin Y difac. S6 Chuy§n 6k Miin dich hpc. 2010, tr.1-6.
2. Angel P, Szabowski A, Schorpp-Kistner M , Function and regulation of AP-1 subunits in skin physiology and pathology Oncogene. 2001, 20, pp.2413-2423-
3. Fisher GJ Datta S, Wang ZQ et ai c-Jun-dependent inhibition of cutaneous procollagen transcription following ultraviolet
in-adiation is reversed by all-frans retinoic add. J Clin Invest. 2000,10, pp.6663-6670.
4. Hornebeck W. Down-regulation of tissue inhibitor of matrix metalloprotease-1 (TIMP-1) in aged human skin contributes to matrix degradation and impaired cell growUi and survival. Pathol Biol (Paris). 2003, 51 (10), pp.569-573.
5. Kann M, Liu Z-G, Zandi E. AP-1 function and regulation. Curr Opin Cell Bio! 1997, pp 9240-9246.
6. Kim WS, Park BS, Sung JH, Yang JM.
Park SB, Kwak SJ. Park JS. Wound healing effect of adipose-derived stem cells: a critical role of secretory fectors on human dermal fibrotrfasts, J Dermatol Sci. 2007, 48 (1), pp.15-24.
7. Phuc P.V, Nhung T.H, Loan D.T, Chung D.C, Ngoc P.K. Differentiating of banked human umbilical cord blood-derived mesenchymal stem cells Into Insulin-secreting ceils. In Vitro Cell Dev Biol Anim. 2011, 47 (1), pp.54-63.
S. Ritti6 L, Fisher GJ. UV-light-induced signal cascades and skin aging. Aging Res Rev. 2002, 1 (4), pp.705-720,
9. Song SY, Jung JE. Jeon YR, Tark KC, Lew DH. Determination of adipose-derived stem cell application on photo-aged fibroblasts, based on paracrine function. Cytotherapy. 2011,13 (3), pp.378-784.
10. Stemlicht MD, Werb Z. How matrix metalioproteinases regulate cell behavior. Annu Rev Cell Dev Biol. 2001, pp. 17463-17516.
