Induction of oocyte development in previtellogenic eel, Anguilla australis

(1)

Contents lists available atScienceDirect

General and Comparative Endocrinology

journal homepage:www.elsevier.com/locate/ygcen

Induction of oocyte development in previtellogenic eel, Anguilla australis

Anh Tuan Nguyen

^a,b,⁎

, Jolyn H.Z. Chia

^a

, Yukinori Kazeto

^c

, Matthew J. Wylie

^a,1

, P. Mark Lokman

^a

aDepartment of Zoology, University of Otago, 340 Great King Street, PO Box 56, Dunedin 9054, New Zealand

bUniversity of Agriculture and Forestry, Hue University, 6 Le Loi Street, Hue, Viet Nam

cKamiura Laboratory, National Research Institute of Aquaculture, Fisheries Research and Education Agency, 422-1 Nakatsuhamaura, Oita 879-2602, Japan

A R T I C L E I N F O

Keywords:

Eel

Anguilla australis rec-Fsh hCG

11-Ketotestosterone

A B S T R A C T

The role of gonadotropins during early ovarian development infish remains little understood. Concentrations of gonadotropins were therefore experimentally elevatedin vivoby administration of recombinant follicle-stimulating hormone (rec-Fsh) or human chorionic gonadotropin (hCG) and the effects on ovarian morphology, sex steroid levels and mRNA levels of genes expressed in pituitary and ovary examined. Hormones were injected thrice at weekly intervals in different doses (20, 100 or 500 µg/kg BW for rec-Fsh and 20, 100 or 500 IU/kg BW for hCG). All treatments, especially at the highest doses of either rec-Fsh or hCG, induced ovarian development, reflected in increased oocyte size and lipid uptake. Both gonadotropins up-regulated follicle-stimulating hormone receptor (fshr) mRNA levels and plasma levels of estradiol-17β(E2). Exogenous gonadotropins largely decreased the expression of follicle-stimulating hormoneβ-subunit (fshb) and had little effect on those of luteinizing hormoneβ-subunit (lhb) in the pituitary. It is proposed that the effects of hCG on ovarian development in previtellogenic eels could be indirect as a significant increase in plasma levels of 11-ketotestosterone (11-KT) was found in eels treated with hCG. Using rec-Fsh and hCG has potential for inducing puberty in eels in captivity, and indeed, in teleostfish at large.

1. Introduction

Puberty in teleostfish is known as a developmental period during which an immature individual obtains the capacity to reproduce for the first time (Okuzawa, 2002). Among the many factors involved in regulating puberty in female teleosts, gonadotropins (Fsh: follicle-stimulating hormone and Lh: luteinizing hormone) secreted from the pituitary are considered key (Levavi-Sivan et al., 2010). Briefly, Fsh promotes estradiol-17β(E2) biosynthesis in ovarian follicular cells. In turn, E2 regulates ovarian development by inducing the synthesis of vitellogenin (Vtg: the precursor of egg yolk protein) in the liver and releasing it into the bloodstream during the major oocyte growth period (Nagahama et al., 1995). Meanwhile, Lh regulates final oocyte maturation by stimulating the production of maturation–inducing hormone (Nagahama and Yamashita, 2008).

Although gonadotropins have been associated with regulating vi- tellogenesis and ﬁnal oocyte maturation/ovulation, evidence is accu- mulating that gonadotropins may also be involved in advancing previtellogenic oocyte growth. Much of this evidence is based on associations, rather than being causal in nature. Studies on salmonids deduced roles for Fsh during previtellogenesis based on correlations

between oocyte cytology and the expression of Fsh in the pituitary and its presence in plasma, rather than through the direct administration of Fshin vitroandin vivo. For example, it was suggested that Fsh may be involved in the regulation of oocyte development in coho salmon (Oncorhynchus kisutch) during the cortical alveolus stage because the appearance of cortical alveoli in the oocyte was associated with increases in plasma and pituitary Fsh levels (Campbell et al., 2006). Given a general increase in levels of pituitary and plasma Fsh, and of ovarian follicle-stimulating hormone receptor (fshr) mRNA levels as lipid droplets accumulated in oocytes, Fsh signaling was assumed to be important for the transition of oocytes into the lipid droplet stage (Campbell et al., 2006). A study byLuckenbach et al. (2008)on O.

kisutchshowed that Fsh in the pituitary and plasma, andfshrmRNA levels in the ovary signiﬁcantly increased alongside increasing expression of genes related to cortical alveoli production and lipid uptake during the transition from the perinucleolus stage to the mid-cortical alveolus stage. However, the degree to which these genes are regulated by Fsh is still unknown. More recently,in vitroculture of previtellogenic ovarian tissues ofO. kisutchwith salmon Fsh indicated a strong inﬂu- ence of Fsh on steroidogenesis, causing a dramatic increase in testosterone (T) and E2 production and changes in mRNA levels of

https://doi.org/10.1016/j.ygcen.2020.113404

Received 11 August 2019; Received in revised form 23 December 2019; Accepted 22 January 2020

⁎Corresponding author at: Faculty of Fisheries, University of Agriculture and Forestry, Hue University, 6 Le Loi street, Hue, Viet Nam.

E-mail address:anhtuan2312@gmail.com(A. Tuan Nguyen).

1Present address: The New Zealand Institute for Plant and Food Research, Seafood Production Unit, 293-297 Port Nelson, Nelson 7010, New Zealand.

Available online 27 January 2020

T

(2)

steroidogenesis–related proteins during the previtellogenic stage (Luckenbach et al., 2011). Similarly, an increase in E2 secretion was observed when immature ovarian fragments from yellowtail kingfish (Seriola lalandi) were incubated with homologous recombinant Fsh (Sanchis-Benlloch et al., 2017). In addition, immature female yellowtail kingfish injected with rec-Fsh for 10 weeks showed a significant increase in plasma E2 levels and development of oocytes (Sanchis- Benlloch et al., 2017). These projects represent two of a very limited number of studies using rec-Fsh to investigate its effects on the development of previtellogenic oocytes in teleostfish.

In eels, there similarly is evidence suggesting that gonadotropins and their receptors may contribute to regulating previtellogenic oocyte growth. For example, follicle-stimulating hormoneβ-subunit (fshb) and luteinizing hormone β-subunit (lhb) transcripts were detected in the pituitaries from previtellogenic female Japanese eels,Anguilla japonica (Han et al., 2003; Jeng et al., 2007). In addition, the ovarianfshrmRNA level was roughly 40 times higher than that oflhrat this stage and it is thought to play an important role in the mediation of gonadotropin action in previtellogenic eel (c.f.,Jeng et al., 2007).

There is also support for a functional role for gonadotropins in previtellogenic growth of shortﬁnned eels (A. australis). Thus, ovarian tissues in the early oil droplet stage treated with recombinant Fsh (rec- Fsh) in vitroshowed a signiﬁcant increase in the expression of steroidogenic acute regulatory protein (star) (Reid et al., 2013). Further- more, European eels (A. anguilla) chronically treated with carp pituitary extract (rich in Lh-like gonadotropin) displayed an increase in, amongst others, follicle size, in the amount of lipid in the oocyte cytoplasm and in the thickness of the follicular envelope (Lopez and Fontaine, 1990).

Similarly, a progressive increase in gonadosomatic index (GSI) was observed in cultivated yellow Japanese eel injected weekly with salmon pituitary extract for 9 weeks (Jeng et al., 2002).

However, it seems impossible to accurately evaluate the role of gonadotropins and their receptors during the previtellogenic stage by administration of pituitary extracts as these products contain other hormones. Indeed, the application of recombinant gonadotropins (rec- GtHs) in aquaculture is becoming more relevant due to their advantage over hormones extracted from the pituitary. For instance, rec-GtHs can be continually produced without dependence onﬁsh. Importantly, the use of rec-GtHs avoids cross-contamination with other related glyco- proteins, such as thyroid-stimulating hormone (Levavi-Sivan et al., 2010).

The objective of this study was to investigate the effects of Fsh (recombinant Japanese eel Fsh) and an Lh analog (human chorionic gonadotropin, hCG) on ovarian development and steroid synthesis during the previtellogenic stage of New Zealand shortfinned eels. HCG was selectedi)because of its broad application to manipulation of reproduction in many fish species (Zohar and Mylonas, 2001), and ii) because it exclusively activates eel Lhr, but not Fshr (Aizen et al., 2012, Minegishi et al., 2012; Kazeto et al., 2012).

To evaluate the eﬀects of these treatments, the mRNA levels offshb andlhbin the pituitary and those of their receptors (fshrandlhr) in the ovary were measured. Additionally, the mRNA level of genes coding for steroidogenic enzymes (cytochrome p450 aromatase (cyp19); cytochrome p450 11-βhydroxylase (cyp11b)), and for proteins associated with lipid uptake (lipoprotein lipase (lpl); low density lipoprotein (ldlr);

vitellogenin receptor (vtgr), apolipoprotein E (apoe)) in the ovary were measured (c.f.,Damsteegt et al., 2015).

2. Materials and methods

2.1. Animals

Female yellow shortﬁnned eels (body weight (BW) = 758 ± 5.1 g) were captured from Lake Ellesmere (South Island, New Zealand) in April 2016 using fyke nets andﬁsh were transported to the laboratory at the Department of Zoology, University of Otago. Upon arrival, eels

were immediately transferred to a 1 m³recirculating tank containing 1/

3 seawater to limit the likelihood of infection by pathogens. They were held in this tank for one week under simulated-ambient autumn pho- toperiod and temperature (16–18 °C) for the purpose of acclimation.

Food was not provided to the eels due to the notorious diﬃculty of conditioning them to eat dry food. Animal handling and manipulation were approved and conducted in accordance with the guidelines of the University of Otago Animal Ethics Committee.

2.2. Hormone preparation for injection

HCG was purchased from the University of Otago Animal Welfare Office (Chorulon® Intervet), while rec-Fsh was produced by HEK293 cells as described (Kazeto et al., 2019; Suzuki et al., 2019). Both hCG and rec-Fsh were dissolved and diluted in phosphate-buffered saline (PBS) and the aliquots stored at−70 °C until required. The biological activities of rec-Fsh were confirmed in previous studies on silver Ja- panese eels (Kazeto et al., 2014). It is noted that theβ-subunit of Fsh is near-identical (98.4%) between Japanese eel (127 amino acids; Ac- cession No. Q9YGK3) and shortfinned eel (partial sequence of 121 amino acids; Accession No. AEC03631). Therefore, the rec-FSH derived from Japanese eel is likely to be a highly specific mediator of Fsh action in shortfins.

2.3. Experimental design

After one week of acclimation, 42 eels were randomly selected and distributed between seven experimental tanks (six eels/ 200 L) under the same conditions as the stock tank. They were kept in these tanks for three days before the experiment commenced. On thefirst day of experimentation, six eels from the stock tank were randomly selected for terminal sampling after euthanasia (0.3 g/L benzocaine) to serve as initial controls. The experimentalfish received weekly intraperitoneal (IP) injections of either PBS (control group) or hormones (rec-Fsh or hCG) at different concentrations. Recombinant-Fsh was injected intra- peritoneally at 20, 100 or 500μg/kg BW, while hCG was used at 20, 100 or 500 IU/kg BW. Eels were anesthetized with Aqui-S (15 mg/L of water) prior to receiving injections. Two days after the third (final) weekly injection,fish were euthanized (0.30% benzocaine) for tissue collection.

2.4. Sampling protocol

Total length and weight of theﬁsh were measured before removing the tail for blood collection into 15 ml tubes containing 50 μl of 200 mg/ml ethylenediaminetetracetic acid. Blood was centrifuged at 4 °C and 1000gfor 10 min and plasma aspirated and stored at−70 °C until assay for sex steroid levels (see Radioimmunoassay Section).

Ovarian and pituitary tissues were collected immediately after decap- itation; portions of the right ovary and whole pituitaries were rapidly frozen on dry ice and stored at−70 °C until RNA extraction and subsequent molecular analyses (see RNA extraction Section). A few small ovarian tissue fragments wereﬁxed in 10% neutral-buﬀered formalin for histological procedures. The left ovary was weighed to calculate the gonadosomatic index (GSI: weight of left ovary × 2/ BW).

2.5. Histology and image analysis

Allﬁxed tissues were processed for embedding in Technovit 7100 (Heraeus Kulzer GmbH and Co., Hanau, Germany) following the manufacturer’s instructions. Embedded samples were sectioned on a Reichert Jung microtome at 2μm and stained in 1.3% methylene blue and 0.2% azure II prior to being counterstained in 2% basic fuchsin.

Images were captured by a compound microscope (Olympus BX51) equipped with an Olympus SC100 camera. Images were then analyzed through specialized computer software (CellSens Standard, Inc). In

(3)

order to elucidate the eﬀects of each treatment on oocyte growth, the surface areas of oocytes were measured according to Lokman et al.

(2007). Brieﬂy, a scale length of 100μm was selected to calibrate slides.

All intact oocytes in an image wereﬁrst counted. Of these, only the 20%

largest oocytes were used for data collection to exclude those oocytes that may have been sectioned oﬀ-centre. Oocyte diameter was calcu- lated by taking the square root of oocyte surface area and multiplying this value by 4/π.

2.6. Radioimmunoassay

The concentrations of 11-KT and E2 in plasma samples were measured by radioimmunoassay exactly as described previously (Lokman et al., 1998). Recoveries averaged 85% and 68% for 11-KT and E2, whereas minimum detectable concentrations of 11-KT and E2 amounted to 0.29 ng/ml and 0.03 ng/ml, respectively. Serial dilutions of eel plasma were run for validation and found to yield parallel dis- placement to the 11-KT and E2 standard curve. All duplicate samples were analyzed in a single run.

2.7. RNA extraction, DNase treatment and cDNA synthesis

RNA extraction, DNase treatment and cDNA synthesis were conducted as described byNguyen et al. (2019). Brieﬂy, RNA from frozen tissues was extracted using TRIzol®Reagent (Invitrogen) following the manufacturer’s protocol. To minimize potential genomic DNA contamination, the isolated RNA (5 µg) was treated with TURBO^TMDNase (Applied Biosystems, Invitrogen) according to the manufacturer’s protocol. Subsequently, cDNA was synthesized from 1 µg of DNase-treated RNA using the High-Capacity cDNA Reverse Transcription Kit, using random hexamer primers as outlined in the kit manual (Applied Bio- systems, Invitrogen). The reverse-transcription reactions were carried out using an Eppendorf EpGradient S PCR machine.

2.8. Real-time quantitative PCR (qPCR) 2.8.1. Primers for qPCR

Primers forfshb,lhb,fshr,lhr,cyp19,cyp11b,lpl,ldlr,apoe,vtgr,actb, l36 and eef1used for qPCR analysis were designed and validated from previous studies, as shown inTable 1. These primers were re-validated prior to each qPCR assay in the present study.

2.8.2. qPCR assays

All qPCR assays were performed using a QuantStudio 5 real-time thermal cycler using SYBR® Premix Ex Taq ™II (Takara Bio, Kyoto, Japan) reaction as described byNguyen et al. (2019). Due to the lack of space tofit all samples on a single plate, initial controls were run on replicate plates as quality control in order to evaluate inter-assay variation (Table 2). Standards for each gene were made from serial dilutions of qPCR product, amplification efficiencies ranging from 95.2% to 101.8% for the different target genes (Table 2).

2.8.3. qPCR data normalization

In this study, the geometric average of three candidate reference genes (l36, actb and eef1) was evaluated in order to normalize the transcript abundance of target genes in both ovary and pituitary tissues.

Although the geometric means did not diﬀer signiﬁcantly between treatment groups, it was generally inconsistent between treatments:

thus, in eels that received 100 µg/kg rec-Fsh, a tendency for a lower ovarian geometric mean was observed compared to that in other groups (Suppl. Fig. 1B). A similar trend was observed for the pituitary geometric mean in eels that received 20 IU/kg or 500 IU/kg hCG (Suppl.

Fig. 1A). Treatments with inconsistent geometric means lead to the under- or overestimation of relative target gene expression. Therefore, total RNA was used as a normalizer instead and data normalized over total RNA presented in the Result section.

Statistical outcomes for both normalization methods (standardized over total RNA and normalized over geometric mean) are only men- tioned if these measures diﬀer between both methods. In instances when the trends between treatment groups for gene expression data standardized over total RNA and those normalized over that of the geometric mean were the same, no speciﬁc mention is made (c.f.Suppl.

Figs. 2–5).

2.8.4. Statistics

Normality and equal variances of data were tested using Shapiro– Wilk and Bartlett’s tests, respectively; where needed, data were log- transformed to obtain homogeneity of variance. An independent sam- plest-test was used to compare data between the initial group and the control group. The data from the rec-Fsh treated groups and the hCG- treated groups were analyzed separately using one-way ANOVA fol- lowed by Tukey’s post-hoc test. The initial and experimental control groups were used for both Fsh and hCG statistics, as direct comparisons between eﬀects of rec-Fsh and those of hCG were deemed in- appropriate. All analyses were done using SPSS 17.0 and all numerical data are presented as means ± SE using GraphPad Prism version 6.00 for Windows (GraphPad Software, California, USA).

In order to achieve accurate quantiﬁcation of the isolated total RNA, the RiboGreen® RNA Quantiﬁcation Kit (Invitrogen) was used for measuring the concentration of DNase-treated RNA of each sample according to the manufacturer’s instruction.

3. Results

3.1. Fish health

Except for a single eel in the hCG (100 IU/kg) group that died after 1 h of the second injection,ﬁsh tolerated the manipulations well and remained in good condition (behavior, external condition) throughout the experimental period.

3.2. Gonadosomatic index and oocyte diameter

After three weeks of experimentation, hormone-treated fish displayed an increase in GSI in comparison with the control group (Fig. 1A). However, there was only a significant dose effect within the rec-Fsh treatment groups (F3,22= 6.389, p < 0.05). Notably, the GSI of eels treated with 500μg/kg of rec-Fsh was almost twice that of the other groups. There was no significant difference in the GSI between the initial control and experimental control groups.

The effects of gonadotropins on oocyte diameter are described in Fig. 1B. In the hCG treatment group, there was no significant difference between treatments although there was a clear increasing trend in oocyte diameter, from 89.7 ± 6.2 to 106.3 ± 8.5 μm, as hCG concentrations increased. In the rec-Fsh treatment group, however, the oocyte size of eels that were injected with 500 µg/kg rec-Fsh (105.9 ± 5.2 µm) was significantly greater (ANOVA F3,22= 3.541, p < 0.05) than that of the experimental control group (82.0 ± 5.6 µm).

3.3. Histology

Histologically, most of the oocytes from eels in the experimental control and initial control groups remained at the perinucleolar stage.

Only a few oocytes had oil droplets in the ooplasm (Fig. 2A and B).

Treatments with either rec-Fsh or hCG induced oocyte development to the oil droplet stage. This was apparent especially in oocytes fromfish injected with 500 IU/kg of hCG (Fig. 2C) or 500 µg/kg of rec-Fsh (Fig. 2D). Additionally, the nucleus of these oocytes appeared to be larger (not quantified) in comparison with that of the experimental control and initial controlfish.

(4)

3.4. Radioimmunoassay

Both rec-Fsh and hCG treatment resulted in a signiﬁcant increase in plasma E2 levels compared to experimental control conditions (F3,23= 13.396, p < 0.0001; F3,22= 8.731, p < 0.05, respectively) (Fig. 3A). Plasma E2 levels of experimental control eels averaged 0.07 ng/ml while plasma E2 levels of eels treated with the highest doses of rec-Fsh or hCG were approximately 0.7 ng/ml. However, there was no clear dose response in E2 levels for either rec-Fsh or hCG treatment

regime. It is to be noted that E2 levels were signiﬁcantly lower in the experimental control than in initial controlﬁsh (t = 3.202, df = 10, p < 0.05).

Onlyfish in the hCG treatment regime displayed a significant difference in plasma 11-KT concentrations between doses (F3,22= 9.130, p < 0.05) (Fig. 3B). The 11-KT levels (5.01 ng/ml) offish treated with hCG at the highest concentration (500 IU/kg) were significantly higher than those of the experimental controlfish (2.73 ng/ml). A dose response was apparent in response to hCG treatment, administration of 20 IU/kg yielding a significantly lower 11-KT level than other doses of hCG (p < 0.05).

3.5. Target gene transcript abundance in the pituitary 3.5.1. Fshb and lhb mRNA levels

Both rec-Fsh and hCG treatments brought about a dramatic reduc- tion infshbmRNA levels (Fig. 4A), but differences were only significant in the hCG treatment regime (F3,22= 3.314, p < 0.05); Tukey’s post- hoc tests failed to identify any differences infshbmRNA levels between hCG doses, nor were differences infshbtranscript abundance between the experimental control and initial control groups. Treatment with rec- Fsh or hCG did not have any significant effects onlhbmRNA levels, nor were any trends identifiable (Fig. 4B).

3.6. Target gene transcript abundance in the ovary 3.6.1. Fshr and lhr mRNA levels

FshrmRNA levels increased significantly in the ovary of rec-Fsh or hCG-treatedfish (Fig. 5A). In the rec-Fsh treatment regime, all doses caused significantly higherfshrmRNA levels than those observed in experimental control fish (F3,23 = 8.653, p < 0.05). In the hCG treatment regime, statistical differences were also found between doses in a dose-dependent manner (F3,22= 6.343, p < 0.05). There was no significant difference infshrmRNA levels between initial control and experimental control groups. In contrast tofshrmRNA levels, treatment with either rec-Fsh or hCG did not result in any effects on ovarianlhr Table 1

QPCR primers, their annealing temperatures and amplicon size (bp) for each qPCR product. Abbreviations: follicle-stimulating hormoneβ-subunit (fshb), luteinizing hormoneβ-subunit (lhb), follicle-stimulating hormone receptor (fshr), luteinizing hormone receptor (lhr), cytochrome p450 aromatase (cyp19), cytochrome p450 11β-hydroxylase (cyp11b), lipoprotein lipase (lpl), low density lipoprotein receptor (ldlr), vitellogenin receptor (vtgr), apolipoprotein E (apoe),β-actin (actb), 60S ribosomal protein (l36) and elongation factor-1α(eef1). Lengths of the amplicons are in base pairs (bp), and annealing temperatures (Ta) in degrees Celsius (°C).

Gene qPCR primers (5′–3′) TaTa (°C) Amplicon size (bp) Reference

fshb FW: CCGTGGAGAATGAAGAATGC

RV: TGGTTTCAGGGAGCTCTTGT

64 °C 104 Setiawan et al. (2012)

lhb FW: TCACCAAGGACCCAAGCTAC

RV: CCATGGTGCACAGGTTACAG

fshr FW: CCTGGTCGAGATAACAATCACC

RV: CCTGAAGGTCAAACAGAAAGTCC

63 °C 173 Zadmajid et al. (2015)

lhr FW: GTACAGCGCTACGCATTCAAC

RV: CGTAGAAGACACATCGAGCAGAC

62 °C 132 Ozaki et al. (unpublished data)

cyp19 FW: AAAAAGCCCGCACCTACTTT

RV: AGGTTGAGGATGTCCACCTG

cyp11b FW: ATCACTGTCCAGCGATACC

RV: CGCGTCGGCTTAAATATCTC

lpl FW: AGCTTCACCTTCTGGGATACAG

RV: TCCTGTTGATCTTGTGGTTTGT

57 °C 81 Divers et al. (2010)

ldlr FW: CTGTGCCCTAGCGAGAGTGT

RV: GTTGGTAGCGCAGTCTTTGAG

57 °C 106 Damsteegt et al. (2015)

vtgr FW: CAGTCTTTGAGGATCGAGTGTTC

RV: ACCAGTTTGTCCCTGACAGC

apoe FW: GCAGAGAGATGGACACCCTGAT

RV: CGTTGACGTACTGGGTGGAG

actb FW: AATCCTGCGGTATCCATGAG

RV: GCCAGGGATGTGATCTCTTT

62 °C 154 Setiawan & Lokman (2010)

l36 FW: CCTGACCAAGCAGACCAAGT

RV: TCTCTTTGCACGGATGTGAG

62 °C 160 Setiawan & Lokman (2010)

eef1 FW: CCCCTGCAGGATGTCTACAA

RV: AGGGACTCATGGTGCATTTC106

64 °C 152 Setiawan and Lokman (2010)

Table 2

The efficiency of amplification of the standard curves (%) used in qPCR analysis and the inter-assay variation shown as the coefficient of variation (%) for each target gene qPCR assay (n = 3 plates per assay). Abbreviations: follicle-stimulating hormoneβ-subunit (fshb), luteinizing hormoneβ-subunit (lhb), follicle-stimulating hormone receptor (fshr), luteinizing hormone receptor (lhr), cytochrome P450 aromatase (cyp19), cytochrome P450 11β-hydroxylase (cyp11b), lipoprotein lipase (lpl), low density lipoprotein receptor (ldlr), vitellogenin receptor (vtgr), apolipoprotein E (apoe), 60S ribosomal protein (l36), beta-actin (actb) and elongation factor-1α(eef1).

Gene Tissue Eﬃciency % Coeﬃcient of variation (%)

fshb pituitary 98.2 to 101.8 10.7

lhb pituitary 97.4 to 98.8 12.3

fshr ovary 97.6 to 98.9 7.8

lhr ovary 96.9 to 98.2 9.4

cyp19 ovary 98.2 to 100.4 11.6

cyp11b ovary 99.8 to 100.2 13.7

lpl ovary 99.4 to 101.7 6.2

ldlr ovary 95.6 to 99.4 8.3

vtgr ovary 99 to 100 7.2

apoe ovary 95.6 to 95.7 10.3

l36 ovary 97.1 to 97.8 5.8

pituitary 99.2 to 99.3 7.6

actb ovary 99.4 to 99.7 9.2

eef1 ovary 98.6 to 99.1 6.7

(5)

mRNA levels (Fig. 5B).

3.6.2. Cyp19 and cyp11b mRNA

Fish injected with rec-Fsh displayed significant differences incyp19 transcript abundance between doses (F3,23 = 5.334, p < 0.05) (Fig. 6A), which were particularly evident amongfish treated with the highest doses (100 and 500μg/kg). In contrast, hCG treatment did not yield any significant differences incyp19mRNA levels, nor was there any statistical difference in cyp19 mRNA levels between the experimental control and initial groups. Thecyp19mRNA levels normalized over geometric means displayed a similar trend and statistical outcome to those normalized over total RNA, except for significantly higher cyp19mRNA levels infish treated with 100 µg rec-Fsh/kg in comparison with thefish in the experimental control and those in the rec-Fsh (20 µg/kg) treated group (Supplementary Fig. 4A).

Treatment with rec-Fsh or hCG did not result in any significant differences incyp11bmRNA levels. Similarly, there were no significant differences between the experimental control and initial controlfish (Fig. 6B). Again, the use of total RNA for normalizingcyp11bmRNA

yielded a similar trend and statistical outcome when compared to the use of the geometric mean, except for signiﬁcantly highercyp11bmRNA levels inﬁsh in the rec-Fsh (100 µg/kg) group in comparison with experimental controls (Supplementary Fig. 4B).

3.6.3. Lpl, ldlr, apoe and vtgr mRNA levels

There was a significant difference between the concentrations of rec-Fsh on thelplmRNA levels (F3,23= 6.109, p < 0.05). Fish injected with 100 and 500 µg/kg of rec-Fsh had 20- and 40-fold higher levels of lpl mRNA compared to the control, respectively. Meanwhile, hCG treatments also resulted in a significant increase in relativelplmRNA levels at all doses (F3,22= 8.762, p < 0.05). Neither rec-Fsh nor hCG treatment significantly affected theldlr,vtgr,apoemRNA levels mRNA levels (Fig. 7B, C and D). Similarly, the differences in the abundance of ldlrtranscripts between the initial control and the experimental control groups were not statistically significant. Except for rec-Fsh (100 µg/kg) showing a significantly higher ldlr mRNA level than control (Supplementary Fig. 5B), the trend and statistical differences between data normalized over geometric means and data normalized over total RNA were identical.

4. Discussion

The idea that gonadotropins may be involved in regulating previtellogenic oocyte growth in teleost ﬁsh seems to be gaining mo- mentum (c.f., Campbell et al., 2006; Luckenbach et al., 2011;

Luckenbach et al., 2013). Here, we contribute to this sentiment, de- monstrating clearin vivoeﬀects of gonadotropins on ovarian development of previtellogenic shortﬁnned eels through weekly administration of rec-Fsh and hCG.

After three injections with gonadotropins, the eels showed an increase in both GSI and oocyte size, although the significant effects were only found in the rec-Fsh treatment. This coincided with a more advanced oocyte developmental stage, especially in eels that were treated with the highest dose (500 µg/kg) of rec-Fsh. This result is consistent with findings from previous studies on yellow European eels and farmed yellow Japanese eels, although the subjects used for those studies were in more advanced stages of oogenesis at the onset of experimentation. For example, in European yellow eels that had under- gone long-term treatment with carp pituitary extract, a significant increase in GSI (from 0.38 ± 0.03 to 0.70 ± 0.05) and mean follicle Fig. 1.Mean ( ± SE) GSI (A) and oocyte diameter (B) of femaleA. australisafter

three weeks of rec-Fsh (µg/kg) or hCG (IU/kg) injections. Different letters above bars denote significant differences between category means of each hormone treatment group. Abbreviation: control (CNT). For all other abbreviations see text.

Fig. 2.Effects of rec-Fsh and hCG on ovarian development in previtellogenic eels (A. australis)in vivo. Either hCG or rec-Fsh was administered weekly into eels for 3 weeks. Photomicrographs show ovarian tissue sections from initial controlfish (A), experimental controlfish (B),fish treated with 500 IU/kg hCG (C), 500 µg/kg rec-Fsh (D). Important morphological features are labeled N:

nucleus; OD: oil droplet. Scale bar = 50μm.

(6)

size (from 61 ± 5 to 96 ± 3.2 µm) was observed (Lopez and Fontaine, 1990). Similarly, the GSI of cultivated 3-year-old yellow Japanese eels significantly increased from around 1.5 to approximately 7 after treatment with SPE for 9 weeks (Jeng et al., 2002). In contrast to these studies, inefficacy of SPE administration was reported in wild Japanese yellow eels which exhibited undeveloped gonads (GSI: 0.3–0.9) and eventually died during SPE injections (Okamura et al., 2008). The in- consistency in the results between the present study and previous studies may reflect differences in eel species, physiological stage of eels, treatment duration and method of application, especially with regard to differences in the dose and the quality of the hormone (heterologous vs homologous protein; extracted protein vs. recombinant protein; Fsh- poor vs Fsh-rich) used.

It is noted that the present study is thefirst study using rec-Fsh for administration to previtellogenic eels, and indeed, one of only a very few in teleost at large. The successful induction of ovarian development by rec-Fsh in this study indicates that Fsh has a clear effect on previtellogenic ovaries and this effect may well mimic that in eels under natural conditions. The result of our study reinforces evidence from studies on salmonids (c.f., Swanson, 1991; Campbell et al., 2006;

Luckenbach et al., 2011) and yellowtail kingﬁsh (c.f.,Sanchis-Benlloch et al., 2017). Fsh is generally thought to play the major role in follicular

growth and development in salmonids because high levels of Fsh are associated with early stages of oocyte development (Swanson, 1991;

Campbell et al., 2006). Moreover,in vitroincubation of coho salmon ovaries with highly purified coho salmon Fsh indicated that Fsh is involved in cell survival, growth and differentiation in the ovary through its effects on the expression of anti-apoptotic and growth factor genes in the ovary (Luckenbach et al., 2011).

The result of this study suggests that Fshr is involved in the regulation of oocyte development in the previtellogenic stage. Evidently, a signiﬁcant up-regulation of ovarianfshrmRNA levels was detected in eels that were injected with rec-Fsh and those injected with the highest doses of hCG. In addition, histological analysis showed that the ovaries of these eels had advanced development (larger oocytes and more oil in the cytoplasm) compared to the controls. This assumption is supported by observations on other eel species and wild femaleA. australis; for instance, in immature Japanese eels, there was a greater abundance of fshrtranscripts compared to those oflhrin the ovary (Jeng et al., 2007).

Similarly, work on channel catﬁsh (Ictalurus puntatus) and zebraﬁsh (Danio rerio) showed that a rise in ovarianfshrgene expression occurs Fig. 3.Mean ( ± SE) E2 levels (A) and 11-KT levels (B) of femaleA. australis

after three weeks of rec-Fsh (µg/kg) or hCG (IU/kg) injections. Different letters above bars represent significant differences between category means in each hormone treatment group. Abbreviation: control (CNT). For all other abbreviations see text.

Fig. 4.Mean ( ± SE) relativefshbmRNA (A) andlhbmRNA (B) levels in the pituitaries of femaleA. australisafter three weeks of rec-Fsh (µg/kg) or hCG (IU/kg) injections. Abbreviation: control group (CNT). For all other abbreviations see text. A signiﬁcant diﬀerence infshbmRNA level between hCG treatments is denoted by *.

(7)

prior to vitellogenin uptake, coinciding with the appearance of cortical alveoli (Kumar et al.,2001; Kwok et al., 2005). Importantly, Fsh was detected in the pituitaries of previtellogenic shortﬁnned eels, both at the mRNA and protein levels (Nguyen et al., 2019). Therefore, we contend that Fsh signaling is essential for oocyte development during the previtellogenic stage in shortﬁnned eel.

In eels, hCG was determined to exclusively bind to Lhr (Aizen et al., 2012, Kazeto et al., 2012, Minegishi et al., 2012), and Fsh to Fshr (Aizen et al., 2012). We observed a significant effect from the high dose of hCG (100 IU/kg and 500 IU/kg) on the abundance offshrtranscripts in the ovary, which is possibly mediated indirectly, for example, via sex steroid hormones. Indeed, 11-KT and E2 levels were remarkably ele- vated in eels injected with hCG, but not rec-Fsh (increase in E2 levels only). According toJeng et al. (2007), E2 treatment failed to induce an increase in transcript levels offshrin the ovary of Japanese eels, but treatment of previtellogenic shortfinned eels with 11-KT resulted in a dramatic increase in mRNA levels of ovarian fshr (Setiawan et al., 2012).

Messenger RNA levels ofcyp19(encoding aromatase, involved in E2 production) and ofcyp11b(encoding 11β-hydroxylase, involved in 11- KT production) correlated with E2 and 11-KT levels in eels treated with

rec-Fsh. Cyp19 mRNA levels significantly increased along with the elevation of E2 levels, while there was no significant change in either levels ofcyp11bmRNA or plasma 11-KT. The failure to elevate plasma 11KT levels was somewhat unexpected – the steroidogenesis-stimulating activity of Fsh was previously demonstrated and was reflected in, for example, increased mRNA levels of steroidogenic acute regulatory protein in shortfinned eel (Reid et al., 2013). It is possible that the molar concentration of rec-Fsh that was used in this study was lower than that of hCG, thus preventing a substrate (testosterone) build-up and subsequent conversion towards 11-KT in ovaries of rec-Fsh-treated eels. Alternatively, Fsh may have induced the expression of other steroidogenic enzymes, thus directing steroid substrates towards products other than 11-KT.

The stimulation ofcyp19mRNA levels by Fsh has been reported in many vertebrates, such as rats (Fitzpatrick and Richards, 1991), hu- mans (Steinkampf et al., 1987), ruminants (Manuel Silva and Price, Fig. 5.Mean ( ± SE) relativefshrmRNA (A) andlhrmRNA (B) levels in the

ovaries of femaleA. australisafter three weeks of rec-Fsh (µg/kg) or hCG (IU/

kg) injections. Different letters above bars denote significant differences between category means in each hormone treatment regime. Abbreviation and symbols: control (CNT);●: outlier. For all other abbreviations see text.

Fig. 6.Mean ( ± SE) relativecyp19mRNA (A) andcyp11bmRNA (B) levels in the ovaries of femaleA. australisafter three weeks of rec-Fsh (µg/kg) or hCG (IU/kg) injection. Different letters above bars denote significant differences between category means in each hormone treatment group. Abbreviation:

control (CNT). For all other abbreviations see text.

(8)

2000) and brown trout (Salmo trutta) (Montserrat et al., 2004). For eels, rec-Fsh was found to stimulate E2 secretion in the ovary of Japanese eels (Kamei et al., 2006). Furthermore, expression of cyp19 was indicated to be the most influential factor on E2 production in the eel ovary (Ijiri et al., 2003). Taken together, we suggest that rec-Fsh, but not hCG (see below), controls the plasma E2 level by regulating the expression of thecyp19gene. This speculation is reinforced byfindings in the Japanese eel where Fsh and hCG were suggested to have differential effects on steroidogenic activities and these differences may be due to their different affinities for gonadotropin receptors (Kamei et al., 2006).

Unlike the scenario for rec-Fsh, hCG treatment did not affect mRNA levels ofcyp11bandcyp19in spite of the significant increases in E2 and 11-KT. Noteworthy, 11β-hydroxyandrostenedione, a precursor of 11- KT, was not detected when ovarian follicles of Japanese eels in pre- and early vitellogenic stages were incubated with radiolabeled androstenedione (Kazeto et al., 2011). There is a possibility that 11-KT can be produced by extra-gonadal organs. Indeed, head kidney and forebrain were identified as organs that have the ability to produce 11-KT from androstenedione (Kazeto et al., 2012), which might explain the mismatch between 11-KT levels and the transcript abundance ofcyp11bin eels treated with hCG in this study. A mismatch between E2 levels and ovariancyp19 expression was also evident, and has been reported in previous studies on New Zealand shortfinned eels (Setiawan et al., 2012) and Japanese eels (Ijiri et al., 2003; Sudo et al., 2011). The

increases in E2 levels without accompanying changes in ovariancyp19 mRNA levels in the hCG treatment group could be explained by the high potency of hCG to produce testosterone for aromatization, as reported byKamei et al. (2006)in the ovary of Japanese eels. Therefore, slight diﬀerences in aromatase activity alongside increased substrate production could lead to the observed increase of E2 levels.

The accumulation of lipid droplets in the oocyte is key for egg quality in marinefish (Rainuzzo et al., 1997). Lipid can be deposited in oocytes through receptor-mediated endocytosis or extracellular hydro- lysis of triacylglycerides by Lpl and/or involvement of fatty acid transport proteins (Damsteegt et al., 2015). In the present study, both rec-Fsh and hCG treatment significantly up-regulatedlplexpression but not that ofldlr. A strong correlation between ovarian lipid content and both Lpl activity andlpl mRNA levels was reported in New Zealand shortfinned eel before (Divers et al., 2010). In particular, a remarkable increase inlplmRNA levels was observed when eels were implanted with 11-KT slow-release pellets. The histological data of the present study showed more oil droplets in the oocytes of eels treated with gonadotropic hormones than in the controls, probably reflecting the associated elevation of 11-KT levels in plasma of hCG-injectedfish. The significant increase of ovarianlplmRNA levels in eels treated with rec- Fsh cannot be explained in this light, however, as plasma levels of 11- KT did not change. E2, a potential alternative, is an unlikely mediator of rec-Fsh-induced lipid uptake as it did not previously show any effects on lipid accumulation in previtellogenic oocytes of Japanese eelsin vitro Fig. 7.Mean ( ± SE) relativelplmRNA (A),ldlrmRNA (B),vtgrmRNA (C) andapoemRNA (D) levels in the ovaries of femaleA. australisafter three weeks of rec-Fsh (µg/kg) or hCG (IU/kg) injections. Different letters above bars denote significant differences between category means in each hormone treatment group.

Abbreviation: control (CNT). For all other abbreviations see text.

(9)

(Endo et al., 2011). Regulation oflpl expression by Fsh nonetheless remains possible since Fsh-driven transitioning into the lipid droplet stage in salmon may require steroid biosynthesis (Campbell et al., 2006). Thus, it is possible that rec-Fsh exerted direct stimulatory eﬀects on lplexpression and downstream lipid uptake. Alternatively, as dis- cussed above, steroid products other than 11-KT may have been gen- erated in response to Fsh-mediated increases in steroidogenesis. These products conceivably include androgens capable of activating the androgen receptor to up-regulate lpl gene expression. A third possible explanation is that 11-KT levels increased only locally (not systemi- cally), allowing for paracrine eﬀects of 11-KT at the level of the ovarian follicle. Further research, including in vitro studies, are needed to evaluate these possible mechanisms.

In conclusion, the present study unequivocally demonstrates that rec-Fsh and hCG can stimulate oocyte growth and development in previtellogenic eels. Treatment with rec-Fsh and hCG increased oocyte size, sex steroid hormone levels and the expression of key reproduction- related genes in the ovary of the eels. Activation of the Fsh receptor, rather than the Lh receptor, appears to be principally important for advancing oogenesis in previtellogenic eels. This study sets the scene for a paradigm shift around gonadotropin biology during early oogenesis in eels.

Funding

The leading author of this study was supported by a New Zealand ASEAN scholarship. Contributions to research expenses were made by a Research Enhancement Grant (2016 PBRF support to PML).

Declaration of Competing Interest

The authors declare that they have no known competingﬁnancial interests or personal relationships that could have appeared to inﬂu- ence the work reported in this paper.

Acknowledgements

We acknowledge the help from Ken Miller with preparation of the illustrations and we are grateful for editorial comments on earlier drafts of the manuscript by Dr. Erin Damsteegt.

Appendix A. Supplementary data

Supplementary data to this article can be found online athttps://

doi.org/10.1016/j.ygcen.2020.113404.

References

Aizen, J., Kowalsman, N., Kobayashi, M., Hollander, L., Sohn, Y.C., Yoshizaki, G., Niv, M.Y., Levavi-Sivan, B., 2012. Experimental and computational study of inter-and intra-species speciﬁcity of gonadotropins for various gonadotropin receptors. Mol.

Cell. Endocrinol. 364, 89–100.

Campbell, B., Dickey, J., Beckman, B., Young, G., Pierce, A., Fukada, H., Swanson, P., 2006. Previtellogenic oocyte growth in salmon: relationships among body growth, plasma insulin-like growth factor-1, estradiol-17beta, follicle-stimulating hormone and expression of ovarian genes for insulin-like growth factors, steroidogenic-acute regulatory protein and receptors for gonadotropins, growth hormone, and somato- lactin. Biol. Reprod. 75, 34–44.

Damsteegt, E.L., Falahatimarvast, A., McCormick, S.P., Lokman, P.M., 2015.

Triacylglyceride physiology in the short-ﬁnned eel,Anguilla australis- changes throughout early oogenesis. Am. J. Physiol. Regul. Integr. Comp. Physiol. 308, R935–R944.

Divers, S.L., McQuillan, H.J., Matsubara, H., Todo, T., Lokman, P.M., 2010. Eﬀects of reproductive stage and 11-ketotestosterone on LPL mRNA levels in the ovary of the shortﬁnned eel. J. Lipid. Res. 51, 3250–3258.

Endo, T., Todo, T., Lokman, P.M., Kudo, H., Ijiri, S., Adachi, S., Yamauchi, K., 2011.

Androgens and very low density lipoprotein are essential for the growth of previtellogenic oocytes from Japanese eel,Anguilla japonica,in vitro. Biol. Reprod. 84, 816–825.

Fitzpatrick, S.L., Richards, J.S., 1991. Regulation of cytochrome P450 aromatase messenger ribonucleic acid and activity by steroids and gonadotropins in rat granulosa

cells. Endocrinology 129, 1452–1462.

Han, Y.S., Liao, I.C., Huang, Y.S., Tzeng, W.N., Yu, J.Y.L., 2003. Proﬁles of PGH-α, GTH I- β, and GTH II-βmRNA transcript levels at diﬀerent ovarian stages in the wild female Japanese eelAnguilla japonica. Gen. Comp. Endocrinol. 133, 8–16.

Ijiri, S., Kazeto, Y., Lokman, P.M., Adachi, S., Yamauchi, K., 2003. Characterization of a cDNA encoding P-450 aromatase (CYP19) from Japanese eel ovary and its expression in ovarian follicles during induced ovarian development. Gen. Comp. Endocrinol.

130, 193–203.

Jeng, S.R., Chen, G.R., Lai, J.Y., Huang, Y.S., Dufour, S., Chang, C.F., 2002. Regulation of pituitary gonadotropin II and growth hormone content by sex steroids and pituitary extract in the aquacultured Japanese eel,Anguilla japonica. Aquaculture 209, 319–332.

Jeng, S.R., Yueh, W.S., Chen, G.R., Lee, Y.H., Dufour, S., Chang, C.F., 2007. Diﬀerential expression and regulation of gonadotropins and their receptors in the Japanese eel, Anguilla japonica. Gen. Comp. Endocrinol. 154, 161–173.

Kamei, H., Kaneko, T., Aida, K., 2006. Steroidogenic activities of follicle-stimulating hormone in the ovary of Japanese eel,Anguilla japonica. Gen. Comp. Endocrinol. 146, 83–90.

Kazeto, Y., Ito, R., Ozaki, Y., Suzuki, H., Tanaka, T., Imaizumi, H., Gen, K., 2014. Mass production of Japanese eel recombinant follicle-stimulating hormone and luteinizing hormone by a stable expression system: they fully induced ovarian development at diﬀerential mode. In: Proceeding of the 10th International Symposium on Reproductive Physiology of Fish, Olhao, Portugal, pp. 67.

Kazeto, Y., Kohara, M., Tosaka, R., Gen, K., Yokoyama, M., Miura, C., Miura, T., Adachi, S., Yamauchi, K., 2012. Molecular characterization and gene expression of Japanese eel (Anguilla japonica) gonadotropin receptors. Zool. Sci.29, 204–211.

Kazeto, Y., Tanaka, T., Suzuki, H., Ozaki, Y., Fukada, H., Gen, K., 2019. Development and validation of enzyme-linked immunosorbent assays speciﬁc for follicle-stimulating hormone and luteinizing hormone in Japanese eel. Fisheries Sci. 85, 829–837.

Kazeto, Y., Tosaka, R., Matsubara, H., Ijiri, S., Adachi, S., 2011. Ovarian steroidogenesis and the role of sex steroid hormones on ovarian growth and maturation of the Japanese eel. J. Steroid Biochem. Mol. Biol. 127, 149–154.

Kumar, R.S., Ijiri, S., Trant, J.M., 2001. Molecular biology of the channel catﬁsh gonadotropin receptors: 2. Complementary DNA cloning, functional expression, and sea- sonal gene expression of the follicle-stimulating hormone receptor. Biol. Reprod. 65, 710–717.

Kwok, H.F., So, W.K., Wang, Y., Ge, W., 2005. Zebraﬁsh gonadotropins and their receptors: I. Cloning and characterization of zebraﬁsh follicle-stimulating hormone and luteinizing hormone receptors - evidence for their distinct functions in follicle development. Biol. Reprod. 72, 1370–1381.

Levavi-Sivan, B., Bogerd, J., Mañanós, E., Gómez, A., Lareyre, J.J., 2010. Perspectives on ﬁsh gonadotropins and their receptors. Gen. Comp. Endocrinol. 165, 412–437.

Lokman, P.M., George, K.A., Divers, S.L., Algie, M., Young, G., 2007. 11-Ketotestosterone and IGF-I increase the size of previtellogenic oocytes from shortﬁnned eel,Anguilla australis, in vitro. Reproduction 133, 955–967.

Lokman, P.M., Vermeulen, G.J., Lambert, J.G., Young, G., 1998. Gonad histology and plasma steroid proﬁles in wild New Zealand freshwater eels (Anguilla dieﬀenbachii andA. australis) before and at the onset of the natural spawning migration. I.

Females. Fish. Physiol. Biochem. 19, 325–338.

Lopez, E., Fontaine, Y., 1990. Hormonal stimulation,in vivo, of the ovary of European eel in the yellow stage. Reprod. Nutr. Dev. 30, 577–582.

Luckenbach, J.A., Dickey, J.T., Swanson, P., 2011. Follicle-stimulating hormone regulation of ovarian transcripts for steroidogenesis-related proteins and cell survival, growth and diﬀerentiation factors in vitro during early secondary oocyte growth in coho salmon. Gen. Comp. Endocrinol. 171, 52–63.

Luckenbach, J.A., Iliev, D.B., Goetz, F.W., Swanson, P., 2008. Identiﬁcation of diﬀeren- tially expressed ovarian genes during primary and early secondary oocyte growth in coho salmon,Oncorhynchus kisutch. Reprod. Biol. Endocrin. 6, 1477–7827.

Luckenbach, J.A., Yamamoto, Y., Guzmán, J.M., Swanson, P., 2013. Identiﬁcation of ovarian genes regulated by follicle-stimulating hormone (Fsh) in vitro during early secondary oocyte growth in coho salmon. Mol. Cell Endocrinol. 366, 38–52.

Manuel Silva, J., Price, C.A., 2000. Eﬀect of follicle-stimulating hormone on steroid secretion and messenger ribonucleic acids encoding cytochromes P450 aromatase and cholesterol side-chain cleavage in bovine granulosa cells in vitro. Biol. Reprod. 62, 186–191.

Minegishi, Y., Dirks, R., de Wijze, D., Brittijn, S., Burgerhout, E., Spaink, H., van den Thillart, G., 2012. Quantitative bioassays for measuring biologically functional gonadotropins based on eel gonadotropic receptors. Gen. Comp. Endocrinol. 178, 145–152.

Montserrat, N., González, A., Méndez, E., Piferrer, F., Planas, J.V., 2004. Eﬀects of follicle stimulating hormone on estradiol-17βproduction and P-450 aromatase (CYP19) activity and mRNA expression in brown trout vitellogenic ovarian folliclesin vitro.

Gen. Comp. Endocrinol. 137, 123–131.

Nagahama, Y., Yamashita, M., 2008. Regulation of oocyte maturation inﬁsh. Dev.

Growth Diﬀer. 50, S195–S219.

Nagahama, Y., Yoshikuni, M., Yamashita, M., Tokumoto, T., Katsu, Y., 1995. Regulation of oocyte growth and maturation inﬁsh. Curr. Top. Dev. Biol. 30, 103–146.

Nguyen, A.T., Chia, J.H.Z., Kazeto, Y., Lokman, P.M., 2019. Expression of gonadotropin subunit and gonadotropin receptor genes in wild female New Zealand shortﬁnned eel (Anguilla australis) during yellow and silver stages. Gen. Comp. Endocrinol. 272, 83–92.

Okamura, A., Yamada, Y., Horie, N., Utoh, T., Mikawa, N., Tanaka, S., Tsukamoto, K., 2008. Eﬀects of silvering state on induced maturation and spawning in wild female Japanese eelAnguilla japonica. Fisheries Sci. 74, 642–648.

Okuzawa, K., 2002. Puberty in teleosts. Fish. Physiol Biochem. 26, 31–41.

Rainuzzo, J.R., Reitan, K.I., Olsen, Y., 1997. The signiﬁcance of lipids at early stages of

(10)

marineﬁsh: a review. Aquaculture 155, 03–115.

Reid, P.M., Divers, S.L., Zadmajid, V., Alqaisi, K.M., Lokman, P.M., 2013. Steroidogenic acute regulatory protein transcript abundance in the eel,Anguilla australis:changes during the induced reproductive cycle and eﬀects of follicle-stimulating hormone during previtellogenesis. J. Steroid Biochem. Mol. Biol. 138, 464–470.

Sanchis-Benlloch, P.J., Nocillado, J., Ladisa, C., Aizen, J., Miller, A., Shpilman, M., Levavi-Sivan, B., Ventura, T., Elizur, A., 2017. In-vitro and in-vivo biological activity of recombinant yellowtail kingﬁsh (Seriola lalandi) follicle stimulating hormone. Gen.

Comp. Endocrinol. 241, 41–49.

Setiawan, A.N., Lokman, P.M., 2010. The use of reference gene selection programs to study the silvering transformation in a freshwater eelAnguilla australis: a cautionary tale. BMC Mol. Biol. 11, 1471–2199.

Setiawan, A.N., Ozaki, Y., Shoae, A., Kazeto, Y., Lokman, P.M., 2012. Androgen-speciﬁc regulation of FSH signalling in the previtellogenic ovary and pituitary of the New Zealand shortﬁnned eel,Anguilla australis. Gen. Comp. Endocrinol. 176, 132–143.

Steinkampf, M.P., Mendelson, C.R., Simpson, E.R., 1987. Regulation by follicle-stimulating hormone of the synthesis of aromatase cytochrome P-450 in human granulosa

cells. Mol. Endocrinol. 1, 465–471.

Sudo, R., Suetake, H., Suzuki, Y., Utoh, T., Tanaka, S., Aoyama, J., Tsukamoto, K., 2011.

Dynamics of reproductive hormones during downstream migration in females of the Japanese eel,Anguilla japonica. Zool. Sci. 28, 180–188.

Suzuki, H., Kazeto, Y., Gen, K., Ozaki, Y., 2019. Functional analysis of recombinant single- chain Japanese eel Fsh and Lh produced in FreeStyle 293-F cell lines: Binding spe- cificities to their receptors and differential efficacy on testicular steroidogenesis. Gen.

Comp. Endocrinol. 285, 113241.

Swanson, P., 1991. Salmon gonadotropins: reconciling old and new ideas. In: Scott, A.P., Sumpter, J.P., Kime, D.E., Rolf, M.S. (Eds.), Proc 4th Intl Symp Reprod Physiol Fish.

Univ East Anglia Printing Unit, Norwich, UK pp. 2–72-7.

Zadmajid, V., Falahatimarvast, A., Damsteegt, E.L., Setiawan, A.N., Ozaki, Y., Shoae, A., Lokman, P.M., 2015. Eﬀects of 11-ketotestosterone and temperature on inhibin subunit mRNA levels in the ovary of the shortﬁnned eel,Anguilla australis. Comp.

Biochem. Physiol. B. 187, 14–21.

Zohar, Y., Mylonas, C.C., 2001. Endocrine manipulations of spawning in culturedﬁsh:

from hormones to genes. Aquaculture 197, 99–136.