2.2 Materials and Methods
2.2.3 Physico-chemical Parameter Analysis
Temperature of the water samples was measured on site using a portable mercury thermometer (Scientific, USA); turbidity was measured with a turbidity meter 21000P (HACH, USA); pH was determined using a Microprocessor pH meter 211 (HANNA, USA).
Chemical oxygen demand (COD) was measured using a Spectroquant Nova 60 (Merck, USA) according to the manufacturer’s instructions. A 3 ml sample was added to COD test cell (Merck), thoroughly mixed and heated for 2h in a TR420 spectroquant thermo-reactor and cooled to room temperature in the dark. The COD test cells were shaken and cooled further for another 10 minutes and read using the Spectroquant Nova 60 (Merck, USA).
Total dissolved solids (TDS) were measured using the CDC 401 probe and HQ40d multimeter (HACH Colorado, USA). Dissolved oxygen (DO) was determined using the LDC 101 probe with an HQ40d multimeter (HACH) for day 0 and day 5 after incubation at 20 ºC and the biological oxygen demand (BOD5) calculated thereafter using the two values using the following equation:
BOD5 (mg/L) = D1-D2 / P
Where, (D1= DO of diluted sample immediately after preparation, D2= DO of the sample after 5 days incubation at 20 ºC and P = volumetric fraction of the sample used).
2.2.4 Microbial Analysis
2.2.4.1 Enumeration and isolation of Yersinia species
Five hundred millilitres of each water sample was filtered through a 0.45 µm pore membrane (PALL Life Sciences, Mexico). Using sterile forceps, filters containing the residue from the filtrate were rolled such that sample residue was on the inside. Rolled filters residue were placed into test tubes containing 10 mL modified tryptic soy broth (mTSB) and incubated at 12 °C for 2-3 days. After 24 h of incubation, 10 μL of irgasan stock solution (4 mg/mL in
methanol) was added to each enrichment culture, to achieve a final concentration of 4 μg/mL (Bhaduri et al., 1997). To reduce the background flora, a 0.5 ml portion of the enrichment culture was transferred into 4.5 ml of 0.5% potassium hydroxide solution (KOH) and mixed gently for 20 s (Söderqvist et al., 2011). Thereafter, 1 ml of the treated samples was used for 10- fold serial dilutions in sterile distilled water and 100 μl of each dilution was then spread plated onto Yersinia selective agar (YSA) and plates were incubated at 28 °C for 16-24 h.
After incubation, the plates were observed for colonies displaying typical Yersinia spp.
morphology of deep red centre with a transparent margin, often referred to as having “bulls- eye” appearance. The colonies were enumerated and expressed in colony forming units per millilitre (cfu/ml).
2.2.4.2 Biochemical Identification and Molecular Confirmation of Yersinia spp. by PCR The presumptive colonies were further identified by the biochemical reactions that would assist in eliminating organisms that may grow and resemble Yersinia spp on the YSA agar.
The biochemical tests performed include urease test, citrate utilization, lactose fermentation and oxidase test. DNA extraction was done from the presumptive colonies tested positive from biochemical tests screening. The isolates were grown on tryptic soy agar (TSA) at 37 °C for 24 h. Following incubation, 5 single colonies were picked and transferred into 100 μL nuclease-free water in 1.5 ml Eppendorf tube and homogenized by vortexing. The tubes were then placed in a boiling water bath at 100 °C for 10 min, cooled down centrifuged at 12000 rpm for 3 min at 25 °C and immediately placed on ice. The supernatant was transferred into a new tube and used directly as DNA template in PCR assay (Sambrook and Russell, 2001) for Yersinia spp. identification. Each 25 µl reaction mixture contained 20 pmol of each primer (Table 2.1), 0.20 mM dNTPs, 4 mM MgCl2, 2.5 U of Taq DNA polymerase, 2.5 µl of 10X PCR buffer and 1 µl of the DNA template. Cycling conditions were initial denaturation (80
°C, 5 min), 30 cycles of amplification; 1 min of denaturation at 94 °C, 1 min of annealing at 63 °C and 2 min of extension at 72 °C. For all the reactions 5 µl of each PCR product was analyzed by electrophoresis on 1.5% (w/v) agarose gels. The products were visualized by UV transillumination (Syngene, UK) after staining in 1 mg/ml ethidium bromide for 15 min.
2.2.4.3 Molecular identification of Yersinia enterocolitica
DNA was extracted as described in section 2.2.4.2. To specifically amplify the Y.
enterocolitica 16S rRNA gene, a primer set by Neubauer et al. (2000) was used (Table 2.1).
Each 25 µl reaction contained the Y. enterocolitica 16S rRNA-specific primers at a concentration of 80 nM each, 200 µM dNTPs, 0.5 U of Taq polymerase, 2.5 µl 10x PCR buffer and 2 µl of DNA template. Cycling conditions were: denaturation step at 94 °C for 5 min, followed by 36 cycles consisting of heat denaturation at 94 °C for 45 s, annealing at 62
°C for 45 s, and extension at 72 °C for 45 s. A final extension was performed at 72 °C for 7 min. For all the reactions, 5 µl of each PCR product was analyzed by electrophoresis on 1.5%
(w/v) agarose gels. The products were visualized by UV transillumination (Syngene, UK) after staining in 1 mg/ml ethidium bromide for 15 min.
2.2.4.4 Multiplex PCR for identification of Y. pseudotuberculosis and Y. pestis
DNA was extracted as described in section 2.2.4.2. A multiplex PCR was performed for the confirmation of the Y. pseudotuberculosis and Y. pestis using primer sets shown in Table 2.1.
Each 25 µl contained 1 µl of genomic DNA, 1X PCR buffer, 0.2 mM dNTPs, 0.3 mM of each primer and 0.75 U Taq polymerase. The cycling conditions were 95 °C for 5 min, 40 three-step cycles, 94 °C for 20 s, 60 °C for 20 s, 72 °C for 15 s. For all the reactions, 5 µl of each PCR product was analyzed by electrophoresis on 1.5 % (w/v) agarose gels. The products
were visualized by UV transillumination (Syngene, UK) after staining in 1 mg/ml ethidium bromide for 15 min.
Table 2.1: Primers used in this study for PCR detection of genes specific to certain Yersinia species.
Target organism Primer Sequence (5´-3ˋ) Amplicon size (bp)
Reference
Yersinia spp. GCGGCAGCGGGAAGTAGTTTA 749 Kalheinz et al., (1998)
TACAGCGTGGACTACCAGGGT
Y. enterocolitica AATACCGCATAACGTCTTCG 330 Neubauer et al., (2000)
CTTCTTCTGCGAGTACGTC
Y. pseudotuberculosis GTCTGGGCTTTGCTGGTC 756 Steknova et al., (2008)
ACGTCGTCTGTCATGATTCG
Y. pestis GTCTGGGCTTTGCTGGTC 510 Steknova et al., (2008)
CTTGTTAGCGATAGTATCAGAGAAG
2.2.5 Statistical Analyses of data
Mean and standard deviation calculations were carried out using Microsoft excel office 2010.
The Pearson’s correlation of the microbial counts and the physicochemical parameter data was done using the SPSS 18.0 software for windows program (SPSS, Inc. USA) and correlations were considered statistically significant at P values < 0.05 and P values <0.01.