Simpulan
Keragaman komunitas aktinomiset pada sampel akar (20-23 pita) berdasarkan gen 16S rRNA lebih beragam dibandingkan dengan sampel tanah (12-18 pita). Keragaman komunitas aktinomiset memiliki kemiripan pada empat varietas tanaman padi. Tujuh belas sekuen DNA hasil analisis DGGE memiliki kemiripan sebesar 93%-100% dengan Kocuria, Actinoplanes, Actinokineospora,
Streptomyces, dan Geodermatophilus. Pita 1 dan 6 memiliki indikasi sebagai
novel species karena kedua sekuens DNA ini memiliki identitas maksimum <97% dengan K. rhizophila DC2201 (96%) dan G. terrae PB261 (93%). Streptomyces
merupakan genus aktinomiset yang ditemukan lebih bervariasi dibandingkan dengan genus lain, dengan dominansi S. alboniger dan S. acidiscabies pada hampir seluruh sampel.
Keragaman komunitas bakteri pemfiksasi nitrogen pada sampel tanah (12- 14 pita) berdasarkan gen nifH lebih bervariasi dibandingkan sampel akar tanaman padi (7-11 pita). Keragaman komunitas bakteri pemfiksasi nitrogen memiliki kemiripan pada empat varietas tanaman padi. Lima sekuens DNA yang dianalisis dengan program BLAST.N menunjukkan kekerabatan dengan uncultured bacterium clone J50, uncultured bacterium clone clod-38, dan uncultured bacterium clone BG2.37 dengan identitas maksimum sebesar 99%, 98%, dan 92%. Analisis dengan program BLAST.X menunjukkan bahwa lima sekuen DNA memiliki kekerabatan dengan dinitrogenase reduktase dari uncultured bacterium
(97%), nitrogenase iron protein dari uncultured bacterium (99%), dan nifH dari B. japonicum (85%).
Saran
Spesifik primer perlu didesain untuk mendeteksi gen nifH pada aktinomiset.
33
DAFTAR PUSTAKA
[AGRISNET]. 2014. Rice soil requirement. [Internet]. [diunduh 28 Mei 2014]. Tersedia pada: http://sikkimagrisnet.org/General/en/Rice_Soil_ Requirement.aspx
Amann RI, Ludwig W, Schleifer KH. 1995. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev. 59:143-169.
Antoun H, Beauchamp CJ, Goussard N, Chabot R, Lalande R. 1998. Potential of
Rhizobium and Bradyrhizobium species as plant growth promoting rhizobacteria on non-legumes: effect on radishes (Raphanus sativus L.).
Plant Soil. 204:57-67.
Babcock DA, Wawrik B, Paul JH, McGuinness L, Kerkhof LJ. 2007. Rapid screening of a large insert BAC library for specific 16S rRNA genes using TRFLP. Microbiol Methods. 71:156-161.
[BALITANAH] Balai Penelitian Tanah. 2014. Analisis Tanah Sawah, Kering dan Rawa.. Bogor (ID): Balai Penelitian Tanah.
Berdy J. 2005. Bioactive microbial metabolites: a personal view. J Antibiot. 58:1- 26.
Bibi F, Yasir M, Geun CS, Sang YL, Young RC. 2012. Diversity and characterization of endophytic bacteria associated with tidal flat plants and their antagonistic effects on oomycetous plant pathogens. Plant Pathol J.
28(1):20-31.
[BPS] Biro Pusat Statistik. 2012. Berita Resmi Statistik. No. 70/11/Th. XV, 1 November 2012.
Bruce KD, Hiorns WD, Hobman JL, Osborn AM, Strike P, Ritchie DA.1992. Amplification of DNA from native populations of soil bacteria by using the polymerase chain reaction. Appl Environ Microb. 58:3413-3416.
Chaiharn M, Chunhaleuchanon S, Lumyong S. 2009. Screening siderophore producing bacteria as potential control agent for fungal rice pathogens in Thailand. World J Microbiol Biotechnol. 25:1919-1928.
Chakravorty S, Helb D, Burday M, Connell N, Alland D. 2007. A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69(2):330-339.
Chen K, Pachter L. 2005. Bioinformatics for whole genome shotgun sequencing of microbial communities. PloS Comp Biol. 1:24.
Cheng Q. 2008. Perspectives in biological nitrogen fixation research. J Integr Plant Biol. 50 (7):784-796.
Chowdhury SP, Schmid M, Hartmann A, Tripathi AK. 2009. Diversity of 16S rRNA and nifH genes derived from rhizosphere soil and roots of an endemic drought tolerant grass Lasiurus sindicus. Eur J Soil Biol. 45:114- 122.
Cockrell J. 2004. Bacterial and fungal endophytes in rice. Bull Texas Rice 4:1-5.
Coelho MRR, Marriel IEE, Jenkins SN, Lanyon CV, Seldin L, O’Donnell AG.
2009. Molecular detection and quantification of nifH gene sequences in the rhizosphere of sorghum (Sorghum bicolor) shown with two levels of nitrogen fertilizer. Appl Soil Ecol. 42:48-53.
34
Coombs JT, Franco CMM. 2003. Isolation and identification of actinobacteria from surface sterilized wheat roots. J Appl Environ Microbiol. 69:5603- 5608.
Conti R, Cunha IGB, Siqueira VM, Motta CMS, Amorim ELC, Araujoc JM. 2012. Endophytic microorganisms from leaves of Spermacoce verticillata
(L.): diversity and antimicrobial activity. J Appl Pharmaceutical Sci. 2(12):17-22.
Correa MF, Quintana A,Duque C, Suarez C, Rodrigues MX, Barea JM. 2010. Evaluation of actinomycete strains for key traits related with plant growth promotion and mycorrhiza helping activities. Appl Soil Ecol. 45:209-217. Dasuki UA.1991. Sistematika Tumbuhan Tinggi. Bandung (ID): Institut Teknologi
Bandung.
Dimpkpa C, Svatos A, Merte D, Buchel G, Kothe E. 2008. Hydroxamate siderophores produced by Streptomyces acidiscabies E13 bind nickel and promote growth in cowpea (Vigna unguiculata L.) under nickel stress. Can J Microbiol. 54:163-172.
Duan YH, Zhang YL, Ye LY, Fan XR, Xu GH, Shen QR. 2007. Responses of rice cultivars with different nitrogen use efficiency to partial nitrate nutrition.
Ann Bot. 99:1153-1160.
Dung TV. 2010. Diversity of the actinomycetes community colonising rice straw residues in cultured soil undergoing various crop rotation systems in the Mekong Delta of Vietnam. IJERD. 1:104-112.
Edenborn SL, Sexstone AJ. 2007. DGGE fingerprinting of culturuble soil bacterial communities complements culture-independent analyses. Soil Biol Biochem. 39:1570-1579.
Fakruddin, Mazumdar RM, Chowdhury A, Hossain N, Mahajan S, Islam S. 2013. Pyrosequencing a next generation sequencing technology. World Appl Sci J. 24:1558-1571.
Fischer SG, Lerman LS. 1983. DNA fragments differing by single basepair substitutions are separated in denaturing gradient gels: correspondence with melting theory. Proc Natl Acad Sci USA. 80:1579-1583.
Felsenstein J. 1985. Confidence limits on phylogenies: an approach using the bootsrap. Evolution. 39:783-791.
Gaby JC, Buckley DH. 2014. A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen-fixing bacteria. Database. 2014: article ID bau001. doi:10.1093/database/bau001.
Gangwar M, Rani S, Sharma N. 2012. Investigating endophytic actinomycetes diversity from rice for plant growth promoting and antifungal activity. Int J Adv Life Sci (IJALS). 1:10-21.
George M, Anjumol A, George G, Hatha AAM. 2012. Distribution and bioactive potential of soil actinomycetes from different ecological habitat. Afr J Microbiol Res. 6:2265-2271.
Hall BG. 2011. Phylogenetic Trees Made Easy, A How to Manual. Ed ke-4. Sunderland (US): Sinauer Associates, Inc.
Hasegawa S, Meguro A, Shimizu M, Nishimura T, Kunoh H. 2006. Endophytic actinomycetes and their interaction with host plants. Actinomycetologica.
35 Hastuti RD, Lestari Y, Suwanto A, Saraswati R. 2012a. Endophytic Streptomyces
spp. as biocontrol agents of rice bacterial leaf blight pathogen (Xanthomonas oryzae pv. oryzae). HAYATI J Biosci. 19:155-192.
Hastuti RD, Yulin L, Rasti S, Antonius S, Chaerani. 2012b. Capability of
Streptomyces spp. in controlling bacterial leaf blight disease in rice plants.
Am J Agri Biol Sci. 7:217-223.
He JZ, Zhu YG, Zheng YM, Zhang LM, Shen JP. 2007. Methodology and application of soil metagenomics. Chinese Acad of Sci (Article in Chinese). 18:212-218.
Huse SM, Dethlefsen L, Huber JA, Welch DM, Relman DA, Sogin ML. 2008. Exploring microbial diversity and taxonomy using SSU rRNA hypervariable tag sequencing. PLoS Genet. 4(11):e1000255. doi:10.1371/journal.pgen.1000255
Hussain MB, Mehboob I, Zahir ZA, Naveed M, Asghar HN. 2009. Potential of
Rhizobium spp. for improving growth and yield of rice (Oryza sativa L.).
Soil Environ. 28:49-55.
Janso JE, Carter GT. 2010. Biosynthetic potential of phylogenetically unique endophytic actinomycetes from tropical plants. Appl Environ Microbiol. 76:4377-4386.
Jelita SP. 2012. Dinamika populasi dan karakter morfologi aktinomiset endofit asal 5 varietas tanaman padi [skripsi]. Bogor (ID): Institut Pertanian Bogor. Jin L, Lee HG, Kim HS, Ahn CY, Oh HM. 2013. Geodermatophilus soli sp. nov.
and Geodermatophilus terrae sp. nov., two actinobacterial isolated from grass soil. Int J Syst Evol Microbiol. 63:2625-2629.
Kaminski PA, Batut J, Boistard P. 1998. A survey of symbiotic nitrogen fixation by rhizobia. Di dalam: The Rhizobiaceae, molecular biology of model plant ascociated bacteria. Sapaink HP, Kondorosi A, Hooykaas PJJ, editor. Inggris (GB): Kluwer Academic.
Kataoka M, Ueda K, Kudo T, Seki T, Yoshida T. 1997. Application of the variable region in 16S rDNA to create an index for rapid species identification in the genus Streptomyces. FEMS Microbiol Lett. 151:249-55. Khamna S, Akira Y, John FP, Saisamorn L. 2010. Indole-3-acetic acid production
by Streptomyces sp. isolated from some Thai medicinal plant rhizosphere soils. EurAsia J BioSci. 4:23-32.
Konietzny U, Greiner R. 2002. Molecular and catalytic properties of phytate degrading enzymes (phytases). Int J Food Sci Technol. 37:791-812.
Learn-Han L, Yoke-Kqueen C, Shiran MS, Vui-Ling CMW, Nurul-Syakima AM, Son R, Andrade HM. 2012. Identification of actinomycete communities in Antarctic soil from Barrientos Island using PCR-denaturing gradient gel electrophoresis. Genet Mol Res. 11:277-291.
Lestari Y. 2006. Identification of indegenous Streptomyces spp. producing antibacterial compounds. J Mikrobiol Indones. 11:99-101.
Liu Z, Lozupone C, Hamady M, Bushman FD, Knight R. 2007. Short pyrosequencing reads suffice for accurate microbial community analysis.
Nucl Acids Res. 35: e120. doi:10.1093/nar/gkm541.
Madigan MT, Martinko JM, Stahl DA, Clark DP. 2012. Brock Biology of Microorganisms. Ed ke-13. San Francisco (CA): Pearson Education, Inc.
36
Marsh TL, Saxman P, Cole J, Tiedje J. 2000. Terminal restriction fragment length polymorphism analysis program, a web-based research tool for microbial community analysis. Appl Environ Microbiol. 66:3616-3620.
Martina K, Jan K, Tamas F, Ladislav C, Marek O, Genevieve LG, Yvan ML, Marketa SM. 2008. Development of a 16S rRNA gene based prototype microarray for the detection of selected actinomycetes genera. Anton Leeuw Int J G. 94:439-453.
Miyadoh S. 1997. Morphology and Phylogeny of Actinomycetes. Atlas of Actinomycetes. Japan: The Society for Actinomycetes.
Moat AG, Foster JW, Spector MP. 2002. Microbial Physiology. NewYork: Wiley- Liss, Inc.
Montero-Calasanz MDC, Goker M, Potter G, Rohde M, Sproer C, Schumann P, Gorbushina AA, Klenk HP. 2013. Geodermatophilus normandii sp. nov., isolated from Saharan desert sand. Int J Syst Evol Microbiol. 63:3437-3443. Munjiati. 2013. Keragaman komunitas bakteri pemfiksasi nitrogen pada tanah
sawah di Sukabumi [skripsi]. Bogor (ID): Institut Pertanian Bogor.
Muyzer G. 1998. Methods of microbial community analysis. Di dalam: Bell CR, Brylinsky M, Johnson-Green P, editor. Microbial Biosystems: New Frontiers, Proceedings of the 8th International Symposium on Microbial Ecology, Halifax, Canada. Canada: 1-10.
Muyzer G, Smalla K. 1998. Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie van Leeuwenhoek. 73:127-141.
Nimnoi P, Pongsilp N, Lumyong S. 2010. Genetic diversity and community of endophytic actinomycetes within the roots of Aquilaria crassna Pierre ex Lex assessed by actinomycetes-specific PCR and PCR-DGGE of rRNA gene. Biochem Syst Ecol. 38: 595-601.
Nubel U, Engelen B, Felske A, Snaidr J, Wieshuber A, Amann RI, Ludwig W, Backhaus H. 1996. Sequence heterogeneities of genes encoding 16S rRNAs in Paenibacillus polymyxa detected by temperature gradient gel electrophoresis. J Bacteriol. 178: 5636-5643.
Nurkanto A. 2007. Identifikasi aktinomiset tanah hutan pasca kebakaran Bukit Bangkirai Kalimantan Timur dan potensinya sebagai pendegradasi selulosa dan pelarut fosfat. Biodiversitas. 8:314-319.
Overeas L, Fomey L, Daae FL.1997. Distribution of bacterioplankton in meromictic lake saelevannet, as determined by denaturing gradient gel electrophoresis of PCR. Amplified gene fragments coding for 16S rRNA.
Appl Environ Microb. 63:3367-3373.
Pangastuti A. 2008. Analisis komunitas bakteri selama tahapan perkembangan larva udang putih (Litopenaeus vannamei) [disertasi]. Bogor (ID): Institut Pertanian Bogor.
Patrick DS, Handelsman J. 2005. Metagenomics for studying unculturable microorganism: cutting the Gordian knot. Genome Biol. 6:229.
Pereira SMC, Schloter-Hai B, Schloter M, Elsas JDV, Salles JF. 2013. Temporal dynamics of abundance and composition of nitrogen fixing communities across agricultural soils. PLoS ONE. 8 (9): e74500. doi:10.1371/journal.pone.0074500.
37 Perez PG, Ye J, Wang S, Wang X, Huang D. 2014. Analysis of the occurrence and activity of diazotrophic communitiesin organic and conventional horticultural soils. Appl Soil Ecol. 79:37-48.
Poly F, Monrozier LJ, Bally R. 2001. Improvement in the RFLP procedure for studying the diversity of nifH genes in communities of nitrogen fixers in soil. Res Microbiol. 152:95-103.
Prabavathy RV, Narayanasamy M, Murugesan K. 2006. Control of blast and sheath blight diseases of rice using antifungal metabolites produced by
Streptomyces sp. PM 5. Biol Control. 39:313-319.
Pratyasto AP. 2012. Kemampuan aktinomiset endofit sebagai penambat nitrogen dan perannya dalam meningkatkan pertumbuhan tanaman padi [tesis]. Bogor (ID): Institut Pertanian Bogor.
Priyadharsini P, Dhanasekaran D. 2014. Diversity of soil allelopathic actinobacteria in Tiruchirappalli district, Tamilnadu, India. J Saudi Soc Agric Sci. http://dx.doi.org/10.1016/j.jssas.2013.07.001.
Promnuan Y, Kudo T, Ohkuma M, Chantawannakul P. 2013. Streptomyces chiangmaiensis sp. nov. and Streptomyces lannensis sp. nov., isolated from the South-East Asian stingless bee (Tetragonilla collina). Int J Syst Evol Microbiol. 63:1896-1901.
Sambrook J, Russell. 2001. Molecular Cloning: A Laboratory Manual. Ed ke-3. New York (US): Cold Spring Harbor Laboratory Pr.
Sangmanee P, Bhromsiri A, Akarapisan A. 2009. The potential of endophytic actinomycetes (Streptomyces sp.) for the biocontrol of powdery mildew disease of sweet pea (Pisum sativum). As J Food Ag-Ind. S93-S98.
Santacruz HAM, Leon RH, Mosqueda MCO, Sepulveda IV, Santoyo G. 2010. Diversity of bacterial endophytes in roots of Mexican husk tomato plants (Physalis ixocarpa) and their detection in the rhizosphere. Genetics Mol Res. 9(4):2372-2380.
Sari WE, Solihin DD, Lestari Y. 2014. Identification of endophytic actinomycetes from Indonesian rice plant based on 16S rRNA and nifH genes analysis.
Adv Environ Biol. 8:2357-2365.
Sekiguchi Y. 2006. Yet-to-be cultural microorganism relevant to methane fermentation processes. Microbes Environ. 21:1-15.
Shanks OC, Domingo JWS, Lamendella R, Kelty CA, Graham JE. 2006. Competitive metagenomic DNA hybridization identifies host specific microbial genetic markers in cow fecal samples. Appl Environ Microbiol.
72:4054-4060.
Singh B., S.K. Gautam, V. Verma, M. Kumar, B. Singh. 2008. Metagenomics in animal gastrointestinal ecosystem: Potential biotechnological prospect.
Anaerobe. 14:138
Soe KM, Bhromsiri A, Karladee D. 2010. Effect of selected endophytic actinomycetes (Streptomyces sp.) and Bradyrhizobia from Myanmar on growth, nodulation, nitrogen fixation and yield of different soybean varieties. CMU J Nat Sci. 9:95-109.
Solomon T, Pant LM, Angaw T. 2012. Effects of inoculation by Bradyrhizobium japonicum strains on nodulation, nitrogen fixation, and yield of soybean (Glycine max L. Merill) varieties on Nitisols of Bako, Western Ethiopia.
38
Stackebrandt E, Goebel BM. 1994. Taxonomic note: A place for DNA-DNA reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology. Int J Syst Bacteriol. 44:846-849.
Stackebrandt E, Rainey FA, Ward-Rainey NL. 1997. Proposal for a new hierarchic classification system, Actinobacteria classis nov. Int J Sys Bacteriol. 47:479-491.
Stackebrandt E, Witt D, Kemmerling C, Kroppenstedt R, Liesack W. 1991. Designation of Streptomycete 16S and 23S rRNA-based target regions for oligonucleotide probes. Appl Environ Microbiol. 57:1468-1477.
Strobel G, Daisy B. 2003. Bioprospecting for microbial endophytes and their natural product. Microbial Mol Biol Rev. 67:491-502.
Sulaeman, Suprapto, Eviati. 2005. Petunjuk Teknis, Analisis Kimia Tanah, Tanaman, Air, dan Pupuk. Prasetyo BH, Santoso D, Widowati LR, editor. Bogor (ID): Balai Penelitian Tanah.
Suprihatno B, Daradjat AA,Satoto, Baehaki SE, Widiarta IN, Setyono A, Indrasari SE, Lesmana OS, Sembiring H. 2009. Deskripsi Varietas Padi. Subang (ID): Balai Besar Penelitian Tanaman Padi.
Sutiknowati LI. 2011. Microbia community during bioremidiation experimental on oil spill in coastal of Pari island. J Ilmu Teknol Kelautan Tropis. 3:91- 103.
Tamura K, Peterson D, Peterson N, Stetcher G, Nei M, Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likehood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol.
28:2731-2739.
Tan RX, Zou WX. 2001. Endophytes: a rich source of functional metabolites. Nat Prod Rep. 18:448-459.
Tian XL, Cao LX, Tan HM, Han WQ, Chen M, Liu YH, Zhou SN. 2007. Diversity of cultivated and uncultivated actinobacterial endophytes in the stems and roots of rice. Microbial Ecol. 53:700-707.
Tian XL, Cao LX, Tan HM, Zeng QG, Jia YY, Han WQ, Zhou SN. 2004. Study on the communities of endophytic fungi and endophytic actinomycetes from rice and their antipathogenic activities in vitro. World J Microbiol Biotechnol. 20:303-309.
Valdes M, Perez NO, de los Santos PE, Mellado JC, Cabriales JJP, Normand P, Hirsch M. 2005. Non-Frankia actinomycetes isolated from surface sterilized roots of Casuarina equisetifolia fix nitrogen. Appl Environ Microbiol. 71:460-466.
van Steenis CGGJ, S. Bloembergen, P.J. Eyma. 2008. Flora. Surjowinoto M, dkk. Penerjemah; Jakarta (ID): Pradnya Paramita. Terjemahan dari: Flora. Villegas M, Vasquez L, Valdes M. 1997. Growth and nitrogenase activity
conditions of a new diazotrophic group of filamentous bacteria isolated
from Casuarina root nodules. Rev Lat-Am Microbiol. 99:65-72.
Wartiainen I, Eriksson T, Zheng W, Rasmussen. 2008. Variation in the active diazotrophic community in rice paddy nifH DGGE analysis of rhizosphere and bulk soil. Appl Soil Ecol. 39(1):65-75.
White D. 2000. The Physiology and Biochemistry of Prokariotes. Ed ke-2. London (GB): Oxford University Press.
39 Xu J. 2006. Microbial ecology in the age of genomics and metagenomics:
concept, tools and recent advances. Mol Ecol. 15:1713-1731.
Yusepi TT. 2011. Kemampuan aktinomiset endofit dalam meningkatkan pertumbuhan tanaman padi (Oryza sativa L.) melalui aktivitas asam indol asetat [skripsi]. Bogor (ID): Institut Pertanian Bogor.
Zehr JP, McReynolds LA. 1989. Use of degenerate oligonucleotides for amplification of the nifH gene from the marine cyanobacterium
Trichodesmium thiebautii. Appl Environ Microbiol. 55:2522-2526.
Zhang W, Long X, Huo X, Chen Y, Lou K. 2013. 16S rRNA-based DGGE analysis of actinomycete communities in fields with continuous cotton cropping in Xinjiang, China. Microb Ecol. 66:385-393.
Zhao L, Ma T, Gao M, Gao P, Cao M, Zhu X, Li G. 2012. Characterization of microbial diversity and community in water flooding oil reservoirs in China. World J Microbiol Biotechnol. 28:3039-3052.
Zhu C, Xia S, Wang B, Qu D. 2011. Variation of Anaeromyxobacter community structure and abundance in paddy soil slurry over flooding time. Afr J Agric Res. 6: 6107-6118.
40
LAMPIRAN
Lampiran 1 Deskripsi dan gambar varietas tanaman padi 1. Deskripsi Varietas Padi Ciherang (Suprihatno et al. 2009)
Nomor seleksi : S3383-1D-PN-41-3-1
Asal persilangan : IR18349-53-1-3-1-3/3*IR19661-131-3-1-3//4*IR64
Golongan : Cere
Umur tanaman : 116-125 hari
Bentuk tanaman : Tegak
Tinggi tanaman : 107-115 cm
Anakan produktif : 14-17 batang
Warna kaki : Hijau
Warna batang : Hijau
Warna telinga daun : Tidak berwarna
Warna lidah daun : Tidak berwarna
Warna daun : Hijau
Muka daun : Kasar pada sebelah bawah
Posisi daun : Tegak
Daun bendera : Tegak
Bentuk gabah : Panjang ramping
Warna gabah : Kuning bersih
Kerontokan : Sedang
Kerebahan : Sedang
Tekstur nasi : Pulen
Kadar amilosa : 23%
Indeks Glikemik : 54
Bobot 1000 butir : 28 g
Rata-rata hasil : 6,0 t/ha
Potensi hasil : 8,5 t/ha
Ketahanan terhadap
Hama Penyakit : Tahan terhadap wereng coklat biotipe 2 dan agak
tahan biotipe 3
Tahan terhadap hawar daun bakteri strain III dan IV
Anjuran tanam : Baik ditanam di lahan sawah irigasi dataran rendah
sampai 500 m dpl.
Pemulia : Tarjat T, Z. A. Simanullang, E. Sumadi dan Aan A.
Daradjat
41 2. Tanaman Padi Varietas Ciherang
42
3. Deskripsi Varietas Padi IR64 (Suprihatno et al. 2009)
Nomor seleksi : IR18348-36-3-3
Asal persilangan : IR5657/IR2061
Golongan : Cere
Umur tanaman : 110 - 120 hari
Bentuk tanaman : Tegak
Tinggi tanaman : 115 – 126 cm
Anakan produktif : 20 - 35 batang
Warna kaki : Hijau
Warna batang : Hijau
Warna telinga daun : Tidak berwarna
Warna lidah daun : Tidak berwarna
Warna daun : Hijau
Muka daun : Kasar
Posisi daun : Tegak
Daun bendera : Tegak
Bentuk gabah : Ramping, panjang
Warna gabah : Kuning bersih
Kerontokan : Tahan
Kerebahan : Tahan
Tekstur nasi : Pulen
Kadar amilosa : 23%
Indeks Glikemik : 70
Bobot 1000 butir : 24,1 g
Rata-rata hasil : 5,0 t/ha
Potensi hasil : 6,0 t/ha
Ketahanan terhadap
Hama Penyakit : Tahan wereng coklat biotipe 1, 2 dan agak tahan
wereng coklat biotipe 3
Agak tahan hawar daun bakteri strain IV Tahan virus kerdil rumput
Anjuran tanam : Baik ditanam di lahan sawah irigasi dataran
rendah sampai sedang
Pemulia : Introduksi dari IRRI
43 4. Tanaman Padi Varietas IR 64
44
5. Deskripsi Varietas Padi Situ Patenggang (Suprihatno et al. 2009)
Nama seleksi : BP1153C-9-12
Asal persilangan : Kartuna / TB47H-MR-10
Golongan : Cere
Umur tanaman : 110 -120 hari
Bentuk tanaman : Tegak
Tinggi tanaman : 100 -110 cm
Anakan produktif : 10 - 11 batang
Warna kaki : Ungu tua
Warna batang : Hijau tua
Warna telinga daun : Kuning kotor
Warna lidah daun : Ungu
Warna daun : Hijau, tepi daun tua berkilau ungu
Muka daun : Bagian atas kasar, bawah permukaan halus
Posisi daun : Tegak
Daun bendera : Menyudut 35 – 50 derajat
Bentuk gabah : Agak gemuk
Warna gabah : Kuning kotor
Kerontokan : Sedang
Kerebahan : Tahan
Tekstur nasi : Sedang
Kadar amilosa : 24 %
Bobot 1000 butir : 27 g
Rata-rata hasil : 4, 6 t/ha
Potensi hasil : 6,0 t/ha
Ketahanan terhadap
Penyakit : Tahan blas
Sifat khusus : Aromatik, respon terhadap pemupukan, mampu
dikembangkan di sawah
Anjuran tanam : Lahan kering musim hujan, tumpangsari, lahan
tipe tanah Aluvial dan Podsolik ketinggian tidak lebih dari 300 m dpl
Pemulia : Ismail BP, Yamin S., Z.A. Simanullang, dan A.A.
Daradjat
Tim peneliti : Atito D, Husin Toha, Irsal L., dan Mukelar A.
Teknisi : U. Sujanang, Karmita, Meru, dan Sukarno
45 6. Tanaman Padi Varietas Situ Patenggang
46
7. Deskripsi Varietas Padi Inpara 2 (Suprihatno et al. 2009)
Nomor Seleksi : B10214F-TB-7-2-3
Asal : Pucuk/Cisanggarung/Sita
Golongan : Cere Indica
Umur tanaman : 128 hari
Bentuk tanaman : Tegak
Tinggi tanaman : 103 cm
Anakan produktif : 16 batang
Warna kaki : Hijau
Warna telinga daun : Tidak berwarna
Warna daun : Hijau
Permukaan daun : Kasar
Posisi daun : Tegak
Posisi daun bendera : Tegak
Warna batang : Hijau
Kerebahan : Sedang
Tipe malai : Kompak
Leher malai : Sedang
Kerontokan : Sedang
Bentuk gabah : Sedang
Warna gabah : Kuning
Rata-rata hasil di rawa lebak
: 5,49 t/ha
Rata-rata hasil di rawa Pasang surut
: 4,82 t/ha
Potensi hasil : 6,08 t/ha
Berat 1000 butir : 25, 66 g
Tekstur nasi : Pulen
Kadar amilosa : 22,05 %
Ketahanan terhadap Hama : Agak tahan Wereng Batang Coklat Biotipe 2
Ketahanan terhadap penyakit
: Tahan terhadap penyakit Hawar Daun dan Blas
Toleransi cekaman abiotik : Toleransi keracunan Fe dan Al.
Keterangan : Baik ditanam di daerah rawa lebak dan pasang
surut
Pemulia : Bambang Kustianto, Aris Hairmansis, Supartopo
dan Suwarno.
Peneliti : Erwina Lubis, Anggiani Nasution, Santoso, Heni
Safitri.
Teknisi : Basarudin N., M. Syarif, Panca Hadi Siwi, dan
Maulana. Pengusul
Alasan utama dilepas
: :
Balai Besar Penelitian Tanaman Padi, Sukamandi Hasil tinggi, toleran Fe dan sesuai untuk daerah yang menyukai nasi pulen
47 8. Tanaman Padi Varietas Inpara 2
48
Lampiran 2 Karakteristik fisik dan kimia tanah
No. Nama
Sampel
Tekstur (Pipet) (%) pH
Bahan Organik HCL 25%
Pasir Debu Liat C (%) N (%) C/N P2O5
(mg/100g) K2O (mg/100g) 1 Tanah Sawah 16 41 43 5,4 2,03 0,21 10 4,7 29 2 Tanah Kering 22 32 46 5,6 11,82 0,44 27 92 80 3 Tanah Rawa 21 61 18 5,2 4,83 0,35 14 7,6 47 No. Nama Sampel
Nilai Tukar Kation KCI 1N
Ca Mg K Na Jumlah KTK KB + (%) Al 3+ (cmolc/Kg) H+ (cmolc/Kg) 1 Tanah Sawah 10,05 2,86 0,49 0,45 13,85 14,62 95 0,92 0,26 2 Tanah Kering 37,70 3,63 0,98 0,12 42,43 37,27 >10 0 0,00 0,02 3 Tanah Rawa 24,74 3,78 0,43 0,45 29,40 36,51 81 0,43 0,22 Sumber: (BALITANAH 2014)
49 Lampiran 3 Runutan basa 17 pita DGGE berdasarkan gen 16S rRNA
#Pita 1 TACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGCGGA AGCCTGATGCAGCGACGCCGCGTTGAGGGGATGACGGCCTTCGGGGTT GTAAACCTCTTTCAGCAGGGGACGAAGCGCGAGTGACGGTACGTGCA GAAGAAGCGCCGGCTAACTACGTGCCAGCAGCCGCGGT #Pita 2 TTTACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAA AGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTA AACCTCTTTCAGCAGGGACGAAGCGCAAGTGACGGTACCTGCAGAAG AAGCACCGGCTAACTACGTGCCAGCAGCCGCGGTAATAA #Pita 3 TTACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAA AGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTA AACCTCTTTCAGCAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAG AAGCGCCGGCTAACTACGTGCCAGCAGCCGCGGTAATA #Pita 4 ACNGGGAGGCAGCCAGTGGGGAATATTGCACAATGGGCGCAAGCCTG ATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTC TTTCAGCAGGGAAGAAGGCGAAAAGTGACCGGTACCTGCAGAAGAAG CGCCGGCTAACTACGTGCCAGCAGCCGCGGTAATAA #Pita 5 TTACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGGA AGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTA AACCTCTTTCAGCAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAG AAGCGCCGGCTAACTACGTGCCAGCAGCCGCGGAAATA #Pita 6 TCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGGAAGCC TGACGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGGTTGTAAA CCTCTTTCAGCAGGGAAGAAGGCGACAAGTGACCGGTACCTGCAGAA GAAGCCCCGCACCCACTACGTGGGCCAGCAGCCGCGAGTAA
50 #Pita 7 TTTACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGGA AGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTA AACCTCTTTCAGTAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAG AAGCGCCGGCTAACTACGTGCCAGCAGCCGCGGTAATA #Pita 8 TTACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAA AGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTA AACCTCTTTCAGCAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAG AAGCCCTGGCTAACTACGTGCCAGCAGCCGCGGTAATAA #Pita 9 TTTACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGGA AGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTA AACCTCTTTCAGTAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAG AAGCGCCGGCTAACTACGTGCCAGCAGCCGCGGTAATA #Pita 10 TTACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGGA AGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTA AACCTCTTTCAGCTAAGGGAAGAAGCGAAAGTGACGGTACCTGCAGA AGAAGCGCCGGCTAACTACGTGCCAGCAGCCGCGGTAATAAA #Pita 11 TACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGGAA GCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAA ACCTCTTTCAGCAGGGAAGAAGCGAAAGTGACGGTACTTGCAGAAGA AGCGCCGGCTAACTACGTGCCAGCAGCCGCGGTAATAA #Pita 12 TACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGGAA GCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAA ACCTCTTTCAGCAGGGAAGAAGCGCAAGTGACGGTACCTGCAGAAGA AGCGCCGGCTAACTACGTGCCAGCAGCCGCGGTAAAAAA #Pita 13 TACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGGCGGA AGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTA AACCTCTTTCAGTAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAG AAGCGCCGGCTAACTACGTGCCAGCAGCCGCGGTAAT
51 #Pita 14 TACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGGAA GCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAA ACCCTCTTTCAGTAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAG AAGCGCCGGCTAACTACGTGCCAGCAGCCGCGGTAATA #Pita 15 TACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGGAA GCCTGATGCAGCGACGCCGCGTTGAGGGGATGACGGCCTTCGGGGTTG TAAACCTCTTTCAGCAGGGACGAAGCGAAAGTGACGGTACCTGCAGA AGAAGCGCCGGCTAACTACGTGCCAGCAGCCGCGGTAA