• Tidak ada hasil yang ditemukan

Phylogeography of tropical eel (Anguilla spp) in Indonesia Waters

N/A
N/A
Protected

Academic year: 2017

Membagikan "Phylogeography of tropical eel (Anguilla spp) in Indonesia Waters"

Copied!
104
0
0

Teks penuh

(1)

PHYLOGEOGRAPHY OF TROPICAL EELS

(

Anguilla spp

) IN INDONESIAN WATERS

MELTA RINI FAHMI

GRADUATE SCHOOL

BOGOR AGRICULTURAL UNIVERSITY

BOGOR

(2)

STATEMENT OF DISSERTATION

AND INFORMATION SOURCE

Hereby I express that the dissertation entitled: “

Phylogeography of

Tropical Eel (

Anguilla spp

) in Indonesian Water

” is the original result of

my research and has never been submitted to obtain a Doctorate in similar

mayor at other universities. All of data and information that I had provided

in this dissertation are based on evidence and available references.

Bogor, March 2013

(3)

SUMMARY

MELTA RINI FAHMI. Phylogeography of Tropical Eel (Anguilla spp) in Indonesia Waters. Supervised by DEDY DURYADI SOLOHIN, PATRCIK BERREBI, KADARWAN SOEWARDI and LAURENT POUYAUD

The freshwater eels (Anguilla spp: Anguillidae) are popular as a commercial important food, because of good nutritional value. These fish are also a well known for their unique catadromous life histories. These species breed far from offshore after migrate thousands kilometers from their growth habitats in freshwater and estuarine to their spawning area in oceanic waters. Most of the investigations concerning eels are concentrated on temperate species, in the north hemisphere mainly because of the economic importance of these species. Nowadays, the population of temperate eel, dramatically decrease is caused by habitat damage, illegal fishing and climatic changes in the ocean. As a consequence, tropical eels become important eel nowadays in the market, as well as the research on tropical eels become a new challenge. One of primary problems in tropical eels is that they have overlapping range of most morphological character, so species identification on this genus are no more sufficient. Then molecular approaches have been proposed for eel identification.

This study has four main objectives: (1) to establish quick methods of identification of tropical eels; (2) to understand exact distribution and dispersal of tropical eel in Indonesia water; (3) to reveal the phylogenetic relationship among population in Indonesia and (4) to uncover population genetic structure of Anguilla bicolor between two Ocean. All of information obtained in this study revealed the conservation management of tropical eel in Indonesia water.

The semi-multiplex method was proposed in this study has demonstrated the efficiency for in identifying seven species and sub-species of tropical eels with only one step PCR. By using this method, one could reduce the number of necessary sequences while the results are very sure for each species determination (we easily identified 1112 specimens). All of species were obtained in this study showed overlapping morphology and distribution. Especially for small specimens (mainly glass eels), the molecular method appears as indispensable. This method has proven to be most simple, quicker, lower cost (no acrilamide migration), specific/sensitive, and highly reliable way.

The geographic distribution of tropical eels of the genus Anguilla in Indonesian waters was establish by identified genetically of all sample that obtain during this study. The genetically identification applied the semi-multiplex PCR method that recently developed in this study. We recognized four species and subspecies with wide distribution: A. b. bicolor, A. b. pacifica, A. marmorata and A. interioris, two species with limited distribution, close to endemism: A. celebesensis and A. borneensis and one subspecies A. nebulosa nebulosa that is only spread in river flowing into Indian Ocean.

(4)

The economic important shortfinned eel, Anguilla bicolor, has a relatively wide geographic distribution compared to the 19 species and subspecies of genus Anguilla, it is distributed longitudinally from the eastern coasts of Africa through the seas around Indonesia to New Guinea in Pacific Ocean. The genotypes of seven microsatellite DNA were analysed for 180 specimens collected from 10 representative location where two subspecies have been found. Analysis with seven microsetallite loci showed Expected (He) and observed (Ho) heterozigosities of each locus range from 0,594 to 0,921 and from 0,250 to 1,000 respectively. All off locus showed high polymorphic. Based on FST value and

clustering test, there is no structure and fragmentation of A. bicolor in Indonesia water.

A critical first step in species conservation is to gain a clear understanding of its taxonomy. Considering Indonesian waters that are inhabited by several sympatric species of tropical eels, almost all morphological character in this genus are overlapping. So a rapid and efficient identification technique is needed. Semi multiplex PCR that has been developed in the present study has successfully distinguished seven species that inhabit the waters of Indonesia through one-step PCR. After established the identification species subspecies methods then we constructed distribution and dispersal pattern, phylogenetic relationship among species that inhabit Indonesian water and population genetic structure of species that have widespread distribution. All of information obtained in this study was needed for conservation management of anguillid in Indonesian water.

Key words: Tropical eel, Anguilla spp, semi-multiplex PCR, Indonesia water and

(5)

Copyright©2013 by Bogor Agricultural University Copyright are protected by law,

1. It is prohibited to cite all or part of this thesis/ dissertation without referring to and mentioning the source.

a. Citation only permitted for sake of education, research, scientific problem.

b. Citation doesn’t inflict the name and honor of Bogor Agricultural University.

(6)
(7)

Dissertation’s title : Phylogeogphy of Tropical Eels (Anguilla spp) In

Indonesian Waters

Name : Melta Rini Fahmi

Student ID : G 362080061

Departement : Biology

Aproved by the Supervisor Commite

Dr. Dedy Duryadi Solihin Head

Prof. Dr. Patrick Berrebi Prof. Dr.Kadarwan Soewardi, M.Sc

Member Member

Dr.Laurent Pouyoud M.Sc Member

Acknowledged by:

Head of Biology Programme of Dean of Graduate School Graduate School Bogor Agricultural University

(8)

TABLE OF CONTENTS

Page

TABLE OF CONTENTS ... i

LIST OF TABLES ... iii

LIST OF FIGURES ... iv

LIST OF APPENDIX ... v

I. GENERAL INTRODUCTION Background ... 1

Questions to Solve ... 7

Framework ... 7

II. A NOVEL SEMI-MULTIPLEX PCR ASSAY FOR IDENTIFICATION OF TROPICAL EEL GENUS Anguilla IN INDONESIAN WATER Abstract ... 10

Introduction ... 10

Material and Methods ... 12

Result ... 16

Discussion ... 18

III. DISTRIBUTION OF TROPICAL EEL GENUS Anguilla IN INDONESIAN WATER BASED ON SEMI-MULTIPLEX PCR Abstract ... 20

Introduction ... 20

Material and Methods ... 23

Result ... 25

Discussion ... 28

IV. A NEW MOLECULAR PHYLOGENY AND GENETIC DIVERSITY OF FRESHWATER EEL GENUS Anguilla IN INDONESIAN WATER BASED ON MITOCHONDRIAL GENES Abstract ... 35

Introduction ... 35

Material and Methods ... 38

Result ... 41

Discussion ... 52

V. POPULATION GENETIC STRUCTURE OF TROPICAL EEL Anguilla bicolor IN INDONESIAN WATER Abstract ... 55

Introduction ... 55

Material and Methods ... 58

(9)

Result ... 62

Discussion ... 65

VI. GENERAL DISCUSSION ... 67

REFERENCES ... 71

APPENDIX ... 76

(10)

LIST OF TABLES

Page

1. Position of nine species-specific primers for semi-multiplex PCR on

cytochrome b and 16s rRNA genes respectively. Two positions for

forward primers (FCYT-EEL and F16S-EEL) and seven positions for

reverse primers ... 15

2. Species-specific primer sequences for semi- multiplex PCR, and PCR product lengths expected for the seven Anguilla species and subspecies ... 16

3. Identification eel by morphology (only 796 eels were classified into the four groupa) and semi-multiplex-PCR (1112 eels were identified among 1115 eels) ... 18

4. List of sampling locations of tropical eels in Indonesia ... 25

5. List specimens, sampling location and date in this study ... 39

6. Matrix nucleotide substitution based on HKY+G+I methods ... 42

7. Genetic diversity and neutral test of species/sub species of tropical eel genus Anguilla from Indonesia waters ... 43

8. Nucleotide diagnostic of each species and clade on the species ... 47

9. Matrix genetic distance between all of species-subspecies on genus Anguilla. Grey highlights one is species-subspecies during this study ... 48

10. Genetic distance within species and sub species ... 48

11. Intraspecific genetic differentiation measured within A. bicolor species ... 51

12. Mutation on nucleotide sequence (above) and amino acid (below) between A. b. bicolor and A. b. pacifica ... 51

13. Intraspecific genetic differentiation measured within A. marmorata species ... 52

14. List of specimen used for microsatellite analyses in the present study .... 59

15. List locus that using during this study ... 61

16. Genetic variability of population parameters at 7 microsatellite loci on tropical eel in Indonesia water ... 63

17. Genetic divergence (Fst) (above) and genetic distance (below) among population during present study ... 64

(11)

LIST OF FIGURES

Page

18. World production of eels (FAO, 2009) ... 3

19. Research framework ... 9

20. Measurement morphology character of specimen ... 15

21. Identification species and subspecies of Anguilla by semi-multiplex PCR

samples ... 18

22. Map of the stations around Indonesia Sea where samples have been

collected for this study ... 25

23. Distribution of the seven species and subspecies of freshwater eels

which were found around Indonesia during this study ... 28

24. The sampling location of genus Anguilla in the origin region Indonesia

water ... 41

25. Neighbor Joining (NJ) phylogentic tree based on 1042 bp of

mitochondrial DNA cyt b gene fragmen under Kimura 2-parameter model,

with Serrivomer sector, Synaphobranchus kaupi and Conger myriaster as

outgroup (up to 75%) ... 46

26. Neighbor Joining (NJ) phylogentic tree based on 1042 bp of

mitochondrial DNA cyt b gene fragmen under Kimura 2-parameter model,

with Synaphobranchus kaupi as outgroup (up to 75%) ... 47

27. Neighbor Joining (NJ) phylogentic tree of all sequence in this study

based on 1042 bp of mitochondrial DNA cyt b gene fragmen under

Kimura 2-parameter model (up 75%) ... 51

28. Dendogram of genetic distance of Indonesian tropical eel based on cyt b

sequence ... 56

(12)

v   

LIST OF APPENDIX

Page

1. Sampling Location during this Study ... 76

2. Number haplotype for the cytochrome b gene among all specimen on

present study ... 77

3. Sequencing Alignment for Cytochrome b gene among all haplotype of

Anopicall eel Anguilla spp ... 79

4. Frequency allele for each locus, each localities for all specimen ... 83

(13)

LIST OF TABLES

Page

1. Position of nine species-specific primers for semi-multiplex PCR on

cytochrome b and 16s rRNA genes respectively. Two positions for

forward primers (FCYT-EEL and F16S-EEL) and seven positions fo

reverse primers ...

2. Species-specific primer sequences for semi- multiplex PCR, and PCR r

... 15

... 16

into the

18

.... 25

. 39

... 61

64 product lengths expected for the seven Anguilla species and

subspecies ...

3. Identification eel by morphology (only 796 eels were classified

four groupa) and semi-multiplex-PCR (1112 eels were identified among

1115 eels) ...

4. List of sampling locations of tropical eels in Indonesia ...

5. List specimens, sampling location and date in this study ...

6. Matrix nucleotide substitution based on HKY+G+I methods ... 42

7. Genetic diversity and neutral test of species/sub species of tropical eel

genus Anguilla from Indonesia waters ... 43

8. Nucleotide diagnostic of each species and clade on the species ... 47

9. Matrix genetic distance between all of species-subspecies on genus

Anguilla. Grey highlights one is species-subspecies during this study ... 48

10. Genetic distance within species and sub species ... 48

11. Intraspecific genetic differentiation measured within A. bicolor species ... 51

12. Mutation on nucleotide sequence (above) and amino acid (below)

between A. b. bicolor and A. b. pacifica ... 51

13. Intraspecific genetic differentiation measured within A. marmorata

species ... 52

14. List of specimen used for microsatellite analyses in the present study .... 59

15. List locus that using during this study ...

16. Genetic variability of population parameters at 7 microsatellite loci on

tropical eel in Indonesia water ... 63

17. Genetic divergence (Fst) (above) and genetic distance (below) among

population during present study ...

(14)

LIST OF FIGURES

Page

1. World production of eels (FAO, 2009) ... 3

2. Research framework ... 9

3. Measurement morphology character of specimen ... 15

4. Identification species and subspecies of Anguilla by semi-multiplex PCR

25

1

del,

... 51

t b samples ... 18

5. Map of the stations around Indonesia Sea where samples have been

collected for this study ...

6. Distribution of the seven species and subspecies of freshwater eels

which were found around Indonesia during this study ... 28

7. The sampling location of genus Anguilla in the origin region Indonesia

water ... 4

8. Neighbor Joining (NJ) phylogentic tree based on 1042 bp of

mitochondrial DNA cyt b gene fragmen under Kimura 2-parameter model,

with Serrivomer sector, Synaphobranchus kaupi and Conger myriaster as

outgroup (up to 75%) ... 46

9. Neighbor Joining (NJ) phylogentic tree based on 1042 bp of

mitochondrial DNA cyt b gene fragmen under Kimura 2-parameter mo

with Synaphobranchus kaupi as outgroup (up to 75%) ... 47

10. Neighbor Joining (NJ) phylogentic tree of all sequence in this study

based on 1042 bp of mitochondrial DNA cyt b gene fragmen under

Kimura 2-parameter model (up 75%) ...

11. Dendogram of genetic distance of Indonesian tropical eel based on cy

sequence ... 56

(15)

I. GENERAL INTRODUCTION

Background

The freshwater eels (Anguilla spp: Anguillidae) are a well known for their

catadromous life histories. They migrate between freshwater and marine

environment. These species are breeding far offshore after a migration of

thousands kilometers from their growth habitats in freshwater and estuarine to

their spawning area in oceanic waters (Ege 1939; Tesch 1977). Most of the

temperate species spawn within a narrow tropical area. Furthermore, the eels

larvae, known as leptocephali, passively swim to their growth habitat along

subtropical currents (Tesch 1977; Tsukamoto 1992).

The anguillid leptocephalus is one of the most distinctive larvae of

Anguilliform fishes and has an olive leaf-like shape, with a depth of about one

fifth of total length (TL), no melanophores, transparent body, relatively few

myomeres and high water content contribute to the buoyancy, which would be

advantageous for passive transport by ocean current (Tesch 1977; Mochioka

2003). Lepthocephalus will be metamorphose, their morphological and

physiological change before into glass eel, which occurs before entering

freshwater. Eel larvae undergo marked changes the somatic structure from the

leaf-like shape of the lepthocephali to the adult-like shape of the glass eel. Glass

eel is a developmental stage from the end of metamorphosis to the beginning of

pigmentation, following this stage the young eels are called “elver” (Tesch 1977;

Mochioka 2003). The next development stage is the yellow eel or sexually

immature adult stage. Those inhabit in estuarine until freshwater environment,

which tend to live longer and attain much larger sizes (Tesch 1977). Further

freshwater eels will continue to the sexually mature stage are called silver eel. In

this stage, they begin downstream migration from the growth habitat, freshwater

to the open oceanic, after transformation from yellow-phase to silver-phase eels.

The silver eel spent their entire growth phase in the marine environment and

apparently they never entered freshwater (Tesch 1977; Aoyama et al. 2003a).

Ege (1939) divided the Anguilla species into four groups, based upon

color, body proportions, dentition, and meristic characters: First group, variegated

species with broad undivided maxillary and mandibular bands of teeth;

A. celebesensis Kaup 1856; A. interioris Whitley 1938; and A. megastoma Kaup

(16)

1856; second group, variegated species with a toothless longitudinal groove in

the maxillary and mandibular bands of teeth; A. nebulosa (A. n. labiata Peters

1852; A. n. nebulosa McClelland 1844); A. marmorata Quoy and Gaimard 1824;

A. reinhardti Steindachner 1867; and A. ancestralis Ege 1939; third group,

species without variegated markings and with a long dorsal fin; A. anguilla

Linnaeus 1758; A. rostrata Lesueur 1817; A. mossambica Peters 1852;

A. borneensis Popta 1924; A. japonica Temminck and Schlegel 1846; and

A. dieffenbachii Gray 1842; and fourth group, species without variegated

markings and with a short dorsal fin; A. bicolor (A. b. bicolor McClelland 1844;

A. b. pacifica Schmidt 1928); A. australis (A. a. australis Richardson 1841;

A. a. schmidti Phillips 1925); and A. obscura Gunther 1871. Castle and

Williamson (1974) postulated that A. ancestralis is an invalid species, based on

similarities with juvenile A. celebesensis. Currently, after scientist discovered a

new species A. luzonensis in Philippines water at 2009, accepted number of

species in the genus Anguilla is 16 species (Watanabe et al. 2009).

At the population level, most of the freshwater eel showed randomly

mating panmictic structure on the whole species or sub-species distribution

(Avice et al. 1986). Panmixia is realized on the unique species or subspecies

spawning area where all individuals are potential partners. There are no mating

restrictions, neither genetics or behavioral and all recombination is possible

(Avise et al. 1986).

Apart from their unique life history, eels are also popular as a commercial

important food, because of good nutritional value, with protein and fat content of

65% and 28% respectively (Hainsbroek 2007). Among the many popular eel

dishes consumed around the world, kabayaki (marinated grilled eel) is a national

dish in Japan, while smoked eel is favored in Europe and North America, and eel

larvae are eaten as appetizers in Spain (Ringuet 2002).

The international market for cultured eels exceeds 200,000 ton in year

2000. Based on FISHSTAT (FAO 2009) data, total production of eels rose from

17,750 ton in 1950 year to 284,274 ton in 2007 year. In Japan, the Japanese eel

(Anguilla japonica) has long been esteemed as an important food fish, as much

as 130,000 tons of eels are consumed per year followed by China, Korea,

America and some European countries, like Denmark, France, Italy, Belgium and

Germany. However most of this production is based on catching wild of adults

and rearing of wild-caught juvenile “glass eels”. The catching activity of glass eel

(17)

since the mid-1990s has been increased rapidly (Figure 1). The impact of

exploitation of glass eel populations is unknown, although the yield of yellow and

silver eel has declined. Ecologists consider that the decline of eel production is

caused by habitat damage, illegal eel fisheries, climatic changes in the ocean,

and parasites (especially Anguillicola crassus in European eel). According to

Ringuet (2001), the overall production of A. anguilla and A. japonica has

declined, landings of European eels, Japanese eels and American eels dropped

to 43.5%, 64% and 8.3%, respectively, over a period of 17 years (1984 to 2000).

As a consequence, tropical eels became most important nowadays in the market,

as well as the research on tropical eel which becomes a new challenge.

Figure 1 World production of eels (FAO 2009), graphic adapted from FAO 2009

On the other hand, the knowledge on tropical eel species occupying

southern or tropical zones is still limited. Two thirds of the recognized 18 Anguilla

species and subspecies are found in the tropical Pacific, while only 6 in

temperate regions of both the Pacific and Atlantic Oceans and seven occupy the

western Pacific around Indonesia (Ege 1939; Castle & Williamson 1974; Arai et

al. 1999). The main differences between tropical and temperate eels are the

length of larval phase, the distribution, the spawning season and the population

structure. The temperate eel generally have a longer and farther migration

distances (Cheng and Tzeng 1996; Arai et al. 1999, 2001). The larvae of

temperate eel enter estuaries is in spring, while that of tropical eels are found in

estuaries throughout the year with different abundance (Arai et al. 1999).

(18)

Most studies of population genetic structure of eels have focused just on

temperate species in the northern hemisphere and few have examined tropical

species. Some studies on population genetic structure of tropical eel have been

conducted such as; A. marmorata by Ishikawa et al. (2004), Tseng (2012) and

Minegishi et al. (2008); A. bicolor by Minegishi et al. (2012) and A. reinhardtii by

Shen and Tzeng (2007, 2012).

To uncover the existence of tropical eel, several studies have been

conducted through the collaboration between the Japanese institution Ocean

Research Institute and research institutes of Indonesia (LIPI) to investigate the

distribution of tropical eels , using the research vessels KM Baruna Jaya VII and

RV Haruko Maru in the period 1998-2003. Both research vessels collected

lepothocephali around the Indonesian sea: A. borneensis caught in the Celebes

Sea, A. b. bicolor caught in the Mentawai Islands and A. celebesensis in the

Tomini bay (Arai et al. 1999; Wouthuyzen et al. 2009; Aoyama et al. 2007;

Setiawan et al. 2001; Miller 2003).

Beside looking for the spawning areas of these eels, this expedition

confirmed also some observations quite interesting for taxonomy. According to

Watanabe et al. (2004a), the tropical eels show geographic distribution and

morphological characters heavily overlapping. The comprehensive identification

of eels proposed by Ege (1939), divided genus Anguilla into 15 species, three of

which were subdivided into two subspecies by using morphological character.

But when the geographic distribution of each species is plotted on a map, several

species have overlapping geographic range. They have also overlapping range

of morphological character. While Ege's taxonomy has long been accepted since

its publication (because most of the first freshwater eel studied came from

temperate region and are not geographically overlapping), some doubts were

expressed (Watanabe et al. 2004a).

That means the identification of eels depends on the location of collection.

Watanabe et al. (2004a) deduced that if only morphological characters were used

for identification, the freshwater eels could be classified into only four groups.

This can be also a problem for the freshwater eels that have been transported

around the world in recent years for aquaculture.

Since morphological studies are no more sufficient for freshwater eels

species identification, the molecular genetics approaches become a new

challenge to develop technically and theoretically nowadays. Molecular genetics

(19)

have been used to evaluate certain taxa, for identification, evolution purposes

and phylogenies reconstructions (Freeland 2005). The application of molecular

genetics to confirm identification of freshwater eel have been conducted in

several research (Aoyama et al. 1999, 2001; Watanabe et al. 2004b, 2008;

Sezaki et al. 2005; Itoi et al. 2005; Gagnaire et al. 2007 and Trautner et al. 2006),

most of them apply RFLP, RAPD and Real Time-PCR methods with 16S rRNA

and Cyt b gene as marker.

Multiplex PCR is a variant of PCR permitting simultaneous amplification of

several targets in one reaction by using more than one pair of primers. For taxa

identification purpose, the multiplex PCR produce amplicons on varying sizes that

are specific to different DNA sequences (Rompler 2006). Multiplex PCR assay

that using several species-specific primers enable to identify several species in a

simple, quick, low cost, sensitive, and highly reliable method (Catanese et al.

2010)

The molecular genetics techniques also have been used for new

hypotheses of phylogeny and evolution of the genus Anguilla (Tagliavini et al.

1996; Aoyama and Tsukamoto 1997; Lin et al. 2001; Bastrop et al. 2000;

Aoyama et al. 2001; Inoue et al. 2001 and Minegishi et al. 2005). Molecular

phylogenetic studies upon all species of genus Anguilla have been conducted by

Lin et al. (2001) who examined mitochondrial 12SrRNA and cytochrome bgenes,

and Aoyama et al. (2001) examined 16SrRNA and cytochrome b genes. Both

studies presented almost the same topology defining species groups and their

geographic distribution. However these contributions diverged on the position of

basal species. Aoyama et al. (2001) concluded that A.borneensis was most likely

the basal species of the genus while Lin et al. (2001) suggested that the ancestor

species are A. marmorata and A.nebulosa.In recent year, Minegishi et al (2005)

produced a new phylogenetic analysis based on the complete mitochondrial DNA

(mtDNA) sequence of all species of genus Anguilla. This phylogenetic analysis

showed a better statistical support that mean more sure analysis than previous

studied. Minegishi et al. (2005) suggest A. mossambica to be most basal species

using Baysian analysis, but based on MP (maximum parsimony) analysis,

similarly with Aoyama et al. (2001), Minegishi et al. (2005) A. borneensis appears

as basal species. Moreover, because the tropical and Indo-Pacific zones have a

highest species diversity, these authors said that the Indonesia waters are the

origin of the eels” and “Indonesia is homeland of eels”.

(20)

A. bicolor and A. marmorata are tropical eels that have been widely

analyzed due to their exceptional large distribution (nearly 20,000 km east-west

in Indopacific oceans). This wide distribution is mostly in sympatry from the

eastern coasts of Africa through the seas around Indonesia to New Guinea in the

Pacific Ocean. They are strongly suspected to have several spawning areas.

According to Minegishi et al. (2008), A. marmorata is not taxonomically divided

into subspecies because of its morphological stability, but molecular studies have

demonstrated its structure into four differentiated populations: North Pacific,

South Pacific, Indian Ocean, and Mariana (Minegishi et al. 2008; Gagnaire et al.

2009). The shortfined eel, A. bicolor, of high abundance, is considered to be

structured into two subspecies A. b. bicolor in Indian Ocean especially at the west

of Indonesia and A. b. pacifica in Pacific Ocean (Ege 1939; Minegishi et al.

2012). However, the population structure and evolutionary history of A. bicolor

needs to be investigated in detail especially in Indonesia. These fish have high

economic value, and are believed to be the best candidate eels to replace

Japanese eel (A. japonica) and European eel (A. anguilla) which have been

decline for food, including fish farm growth.

Indonesia is an archipelagic country that has a long coastline of 91,000

km and 71,480 islands. The western part of Indonesia is connected with Indian

Ocean and the eastern was one with the Pacific Ocean, making Indonesia an

important biogeographic crossroad. Until now, there are seven recognized

species that occupy Indonesia waters: A. bicolor (two subspecies: A. b. bicolor

and A. b. pacifica), A. marmorata, A. celebesensis, A. borneensis, A. interioris, A.

obscura and A. nebulosa (subspecies: A. n. nebulosa) (Ege 1939; Castle &

Williamson 1974; Tsukamoto & Aoyama 1998 and Sugeha et al. 2008). But

information about distribution, evolution, phylogenetic relationship and structure

population still are limited and without details.

Questions to solve

This study was intended to solve some questions:

a. The distribution of seven eel species living in Indonesia is not really known.

This project aimed first at establishing quick methods of identification of

tropical eels. This is partly due to the difficulty to determine the species just

using morphological character. From here we begin to get a clear description

of the distribution of the species that live in Indonesian water. while it is quite

(21)

b. The genetic relationships among Anguillide in Indonesian water can be used

generate a new phylogenetic tree which can help to understand the evolution

of this genus in tropical areas especially in Indonesian water.

c. Indonesia is an important biogeographic crossroad, at the contact between

Indian and Pacific ichthyofaunas. Concerning the two widespread eel

species (A. marmorata and A. bicolor), Indonesia harbors a part of the Indian

and a part of the Pacific populations or subspecies, but nearly nothing is

known on the exact distribution of each lineage in Indonesian rivers.

Biogeography of both species and populations genetics of A. bicolor will be

used to understand the population structure and to know the gene flow

pattern among Anguillidae populations in the Indonesian waters.

Framework

The decreasing of temperate eel populations in the subtropical zone have

encouraged biologists to help conservation and aquaculture of this group. As a

result, research on tropical eel are become a new challenge especially in

Indonesian waters. Many scientists consider Indonesia as ”homeland and origin

of eels”, however, knowledge about distribution and biological traits of eel in

Indonesian waters is still limited. Understanding biological aspects and population

is an important point in the development of sustainable aquaculture.

In sustainable aquaculture, phylogeography and genetic population studies

are two first crucial steps to manage the fisheries resources. Such studies

should provide valuable information about their status, population fragmentation

and dispersal pattern. To analyze phylogeography of eels, we should begin by

their distribution map and phylogenetic relationships. Therefore samples

collection and identification become an important point. Recently many biologists

agree that identification of eels is more appropriate using molecular biology

approach. Semi-multiplex PCR is one method that provides genetic information to

identification of target species, by using the species-specific primers.

Semi-multiplex PCR assays can identify several species in a simple, quick, low cost,

sensitive and highly reliable way on one step PCR. Phylogenetic relationships

can be analyzed based on the information resulting from mtDNA sequencing.

The PCR and DNA sequencing constitute easy and fast methods, furthermore,

(22)

computer software provide convenient analytical methods to infer phylogenetic

relationships and evolution and some statistical calculation.

The analysis of polymorphic microsatellites will provide inter and intra

populations information structure. This population analysis should be conducted

on widespread species.

As a summary, the outputs of this research are (i) a quick identification

method of ells species living in Indonesian waters; (ii) distribution of eels species,

furthermore (iii) the information on systematics, phylogenetics and populations

genetics structure, which will provide data for conservation and aquaculture

strategy. The framework of this study is summarized in the Fig. 2.

Phylogeography tropical eels genus Anguilla in Indonesian waters

Distribution and species composition of Anguilla spp in Indonesian water

Phylogenetic tree tropical eel in Indonesian waters

Population genetic structure of tropical eel: Anguilla bicolor in Indonesian waters

CYT b and 16SrRNA genes to construct phylogenetic

relationships among populations and species Morphometric and

Semi-Multiplex PCR for identification

Polymorphic microsatellites to determine the population genetic structure of

A. bicolor

Quick identification methods, dispersal and distribution, systematic and phylogenetic and population genetic structure of tropical eels in

Indonesian water

Population connectivity and conservation-aquaculture strategy of tropical eel in

Indonesian waters

Figure 2. Research framework

(23)

II. A Novel Semi-Multiplex PCR Assay for Identification of

Tropical Eel Genus

Anguilla

in Indonesian Water

Abstract

A

o

ne step semi-multiplex PCR is proposed for distinguishing seven species and

subspecies of tropical eels including Anguilla bicolor bicolor, A. bicolor pacifica, A.

marmorata, A. interioris, A. celebesensis, A. borneensis, and A. nebulosa nebulosa in

Indonesian waters. Seven pairs of species-specific primers, including two forward and

seven reverse primer sequences, were designed after the alignment of complete

mitochondrial cytochrome b (1140 bp) and 16S rRNA (1120 bp) genes. All

species-specific primer pairs are included in one PCR, but only one pair of them can amplify a

specific fragment from the template DNA that is analyzed. The semi-multiplex PCR

amplified a fragment of 230 bp for A. b. bicolor, 372 bp for A. n. nebulosa, 450 bp for A.

borneensis, 620 bp for A. marmorata, 670 bp for A. b. pacifica, 720 bp for A.

celebesensis, and 795 bp for A. interioris, which are then separated by DNA agarose gel

electrophoresis.

KEY WORDS: semi-multiplex PCR, Anguilla, tropical eels, molecular identification, species-subspecies specific primer

Introduction

Order Anguilliformes contains 400 genera and 800 species, most of them

lives in the oceans and only genus Anguilla migrates to the freshwater for growth

Nelson (2006). Genus Anguilla is composed of freshwater eel having a

catadromous life history characterized by spawning in ocean waters and by a

migration of the larvae back to the parents growing habitats in freshwater or

estuarine areas. The three temperate species spawn in remote tropical waters

after a long adult migration. Their larvae, called leptocephali are passively

returning to their growth habitat with the influence of subtropical currents, and

perform long migration distance (Tesch 1977; Tsukamoto 1992). Oppositely, the

tropical eels have shorter migration distance for both adults and leptocephali than

those of the temperate species (Arai et al. 1999; Wouthuyzen et al. 2009 and

Aoyama 2009)

A first comprehensive identification of the genus Anguilla was proposed by

Kaup (1856), who recognized 45 species. In 1870, Gunther reduced this number

to 23 species. Lastly, a revision of the genus was done by Ege (1939) who

(24)

divided the genus Anguilla into 16 species, three of which were subdivided into

two subspecies. Based on morphological characters, the systematic organization

of Ege (1939) have long been widely accepted by many biologists. However,

Watanabe et al. (2004a) recently found that the morphological character

described by Ege (1939) were not sufficient to classify all species of this genus

without including the information on the geographic distribution of the specimens,

which he used as a taxonomic character. Watanabe et al. (2004a) considered

that the Ege’s (1939) key for species identification is partly invalid because many

morphological characters used are overlapping in most species. Species

recognition becomes especially important for tropical eels because nowadays

they are commercially transported around the world for food (frozen) and

aquaculture (a live) purposes. Ege's (1939) key is considered as insufficient

especially in tropical areas, where geographic and morphological characters of

eels are heavily overlapping and where scientific data are still scarce.

Indonesia is a wide equatorial characterized by archipelagos composed of

around 71,480 islands and coastline of around 91,000. Biogeographically,

Indonesia is at the crossroad of the Indian and Pacific Oceans, the western part

of Indonesia is connected with Indian Ocean and the eastern is connected with

the Pacific Ocean. Two thirds of the recognized 18 Anguilla species and

subspecies are found in the tropical Pacific and seven species and subspecies of

tropical eels range around Indonesia (Ege 1939; Castle & Williamson 1974, Arai

et al. 1999). Those are A. bicolor (two subspecies: A. b. bicolor and A. b.

pacifica), A. marmorata, A. celebesensis, A. borneensis, A. interioris, A. obscura

and A. nebulosa (subspecies: A. n. nebulosa). As a result, the position of

Indonesia appears to be center of origin the diversity of eel and is strategic in the

knowledge of their evolution.

Several methods for species identification have been used on fish like

conventional morphology and electrophoresis, immunoassay, liquid

chromatography or molecular genetics assay (O’Reilly and Wright, 1995).

Concerning eels, after demonstration that morphological characters were not

sufficient to classify all species, molecular genetics have been recommended

(Watanabe et al. 2004a). Most of the genetic approaches to species identification

are based on the amplification of a partial sequence of mitochondria (mtDNA).

The mtDNA, of maternal inheritance, shows no recombination, so that its

sequences are more conservative. The gene 16S rRNA, relatively well

(25)

conserved, is considered as a good marker for genera and species identification

(Aoyama et al. 2000, 2001; Watanabe et al. 2004b, 2005; Gagnaire et al. 2007).

However, it is not polymorphic enough between subspecies (Watanabe 2003).

Moreover, it is important to develop the markers that could distinguish

subspecies. One of the other genes used is cytochrome b (Cytb). This functional

gene is positioned between tRNAGlu and tRNAThr genes. Many investigations on

Cytb focus on inheritance and evolution (Freenlad 2005). Several studies have

used Cytb as a marker for identification of subspecies (Jain et al. 2008; Hyde et

al. 2005).

Recently, several simple PCR techniques have been used to distinguish A.

japonica and A. anguilla (Sezaki et al. 2005), A. interioris and A. celebesensis

(Aoyama et al. 2000) and to distinguish A. anguilla and A. rostrata (Trautner

2006). Application of Real-Time PCR technique allowed identification of A.

japonica leptocephali (Watanabe et al. 2004b), using single nucleotide

polymorphism (SNP) (Itoi et al. 2005), Random Amplified Polymorphic DNA

(RAPD) (Kim et al. 2009; Lehmann 2000), Restriction Fragment Length

Polymorphism (RFLP) (Lin et al. 2001), most of these researches dealing with

temperate area.

Rapid molecular identification of tropical eel began with Gagnaire et al.

(2007), who developed semi-multiplex PCR and RFLP to identify four eel species

in Indian Ocean. Multiplex PCR is a variant of PCR enabling simultaneous

amplification of several targets in one reaction by using more than one pair of

primers. The multiplex PCR produces amplicons on varying sizes that are

specific to different DNA sequences (Rompler 2006). By using the

species-specific primers in multiplex-PCR assays, the identification of several species in a

simple, quick, low cost, sensitive, and highly reliable amplification is possible

(Catanese et al. 2010).

In the present study we developed a method derived from multiplex PCR

assay. In this method, the PCR is based on two “universal” forward Anguilla

primers (and so, called semi-multiplex) and seven specific reverse primers, one

for each eel species or subspecies know from Indonesian waters. The method is

based on the complete sequence of cytochrome b and 16S rRNA extracted from

the specimens that was collected around Indonesia waters.

(26)

Material and Methods

Specimens

The 1115 specimens examined in this study were collected around the

Indonesian waters, covering all the geographic distribution of Anguilla species

that were expected to occur in the country (see Appendix 1). Around 800

specimens are silver eels while the others are glass eels. Samples collection

was conducted in rivers estuaries along the coasts of Indian Ocean, Pacific

Ocean and around Arafura and Celebes Seas. The specimens were collected

from 2008 to 2012. Species assignation was preliminary performed by using

available morphological keys (Watanabe et al. 2004a and Reveilac et al. 2007).

The first morphological characters, which are measurements in this study, a

quantitative one as follows: the total length (LT), the dorsal fin length (LD), the

anal fin length (LA). These measurements were used to calculate the distance

between the origin of the dorsal and anal fins (DA) using the formulation

DA=100(LD – LA)LT-1 (Reveillac et al. 2007) (Fig.3). This character determined

whether an individual was short-fin (FS) or long fin (FL). The accuracy of the

measurement is 0.01 mm by using the digital caliper. The second measurement

of morphological character was qualitative parameters that are presence or

absence of marbling and breadth of maxillary bands. According to Watanabe et

al. (2004a) genus Anguilla can be divided into four groups based on three

characters: presence or absence of marbling, wide and narrow maxillary band of

teeth and origin of the dorsal fin; group 1, groups long dorsal fin with marbling

skin and broad maxillary bands of teeth; group 2, groups long dorsal fin with

marbling skin and narrow maxillary bands of teeth; group 3, groups long dorsal fin

and no marbling and group 4, groups short dorsal fin without marbling skin.

Tissues from anal fin, which were immediately stored in 95% ethanol, were used

for genetic analysis.

Design of PCR primer

Nine semi-multiplex PCR primers were designed from sequence

alignment performed on the cytochrome b (cyt b) and the 16S rRNA genes. The

Cyt b and 16S rRNA sequence dataset include sequence from GenBank (ref.

AP007236, AP007237, AP007238, AP007239, AP007241, AP007242,

AP007246) and 100 sequences obtained during the present study. Nine position

of original sets for semi-multiplex PCR primers are shown in Table 1. Each

(27)

species-sp

of cyt b fr

show in Ta

pecific prim

ragments a

able 2.

mer pairs wa

nd one of t

as designed

two differen

d to amplify

nt lengths o

one of five

of 16S rRN

different le A fragment ngths ts, as Figu mar narr LT=

of m

PCR amp

The fi

suitable a

PCR in a

the primer

volume of

(25mM), 1

primer (co

(5u/µl),

(b)

(a)

ure 3 M

bling, (b) w row maxillar

total length maxillary ban

plification a

irst step of

annealing te

Mastercycle

rs were mix

f 10 µl cont

1.25 µl dN

ommon pri

0.2 µl d

L

T

(c)

easuremen without ma ry bands of h. Eels draw

nds created

and sequen

semi-multip

emperature

er gradient

xed in one P

taining 2 µl

TP (2mM),

mer) is 1

ddH2O an

nt morpho arbling, (c)

f teeth, LD

wing are ad d by myself.

ncing

plex PCR a

for all spe

(Eppendorf

PCR solutio

5x Green

0.5 µl eac

µl (10mM)

nd 1 µl

logy charac broad max

D= dorsal fin

dapted from

mplification

ecies-specif

f, Le Pecq,

on. The PC

GoTaq@ re

ch primer

), 0.05 µl

template

(d)

L

D

cter of spe xillary band n length LA

m Silfvergrip

n was to est

fic primers

France). In

R was carr

eaction buff

(10mM) ex

GoTaq@ D

DNA (

L

L

A

ecimen, (a) ds of teeth

=anal fin le (2009) and

) with h, (d) ength,

d that

tablish the s

by using s

second ste

ried out in a

fer, 0.5 µl M

xcept FCYT

DNA polyme

(28)

Table 1 Position of nine species-specific primers for semi-multiplex PCR on cytochrome b and 16s rRNA genes respectively. Two positions for forward primers (FCYT-EEL and F16S-EEL) and seven positions for reverse primers. See Table 2 for nucleotide sequence of primers.

(29)

Semi-multiplex-PCR was carried out in a Thermal Cycler from Bio-Rad,

programmed to perform a denaturation step at 95oC for 5 min, followed by 35

cycles consisting of 45s at 95oC, 45s at 50oC (see Results) and 1 min at 72oC.

The final extension step (at 72oC) was 10 min. Five microliters of each PCR

product were loaded on a 1,5% agarose electrophoresis gel, stained with Cyber

Safe before electrophoresis at 100 volt for 90 min. The DNA band were observed

under Blue Light and photographed by Canon camera digital

Five individuals of each banding pattern were sequenced on cytochrome b

gene with the primer pair F-EEL-Cytb: 5’ CCA CCG TTG TAA TTC AAC 3’ and

R-EEL-Cytb: 5’ AAG CTA CTA GGC TTA TC 3’. To ensure the identification of

species, alignment was done by using Mega 5.0 (Kumar et al. 2008) and

compared with published sequences.

Table 2 Species-specific primer sequences for semi- multiplex PCR, and PCR product lengths expected for the seven Anguilla species and subspecies

Gene Primers Sequence (5'----3') Lengths of PCR

amplification (bp) Specific species

Cytochrome b FCYT-EEL TAGTGGATCTACCAACCC (Forward)

R-BICO AGACAAATGAAGAAGAATGA 230 A. bicolor bicolor

R-BPAC ATGTTAGGGCAGTTAGC 670 A. bicolor pacifica

R-MAR GTGGAATGGAATTTTGTC 620 A. marmorata

R-CEL ATCTGGATCTCCAAGAAGA 720 A. celebensis

R-INT CGTAGGCGAATAGAAAG 795 A. interioris

16S rRNA F16S-EEL AGGAGAAGAAGGAACTCG (Forward)

R-NNEB TTGGATCATATTTAACGTTT 372 A. nebulosa nebulosa

R-BORN AAGTTTAGGGGTATTCCC 450 A. borneensis

Result

Nine species-specific primers have been designed after the alignment of

complete cytochrome b and 16S rRNA genes, including two forward primers

(FEEL-CYT and FEEL-16S) and seven reverse primers (BIC0, BPAC,

R-MAR, R-CEL, R-INT, R-NNEB and R-BORN) (see Table 2). The seven

species-specific fragments were successfully amplified at 50oC annealing temperature.

Five species and subspecies of tropical eel were distinguished by cytochrome b

gene with one forward and five species-specific reverse primers are A. b. bicolor,

A. b. pacifica, A. marmorata, A. celebesensis and A. interioris. Two species were

distinguished by 16S rRNA gene with one forward and two species-specific

reverse primers are A. n. nebulosa and A. borneensis. For the series analyses,

the whole 9 primers were added in the mix amplifiying their corresponding DNA

(30)

fragm

semi

beca

ampl

ments in on

i-multiplex

ause of the

lification fra

e step PCR

PCR assay

eir bad qua

agments.

R. A total of

y. Only 3 o

ality DNA.

f 1115 sam

out of 1115

Figure 4 s

ples have b

5 sample co

shows sev

been amplif

ould not be

ven differen

fied by this

e amplified

nt sizes of

M  1   2    3    4    5     MM   6   7    8   9  10    11  12  133  14   15  16  177   M  18  19  200 21  22  M  23  24  25  26  27  M 

395   F T b m u T Unsp deter minu F in or also three indiv were unsp

but o

silve beca (Moc spec ident Morp pairs

Figure 4. Iden The orde of th b. pacifica, 11 marmorata, 23 unexpected ba

The sizes o

pecific ban

rmination.

utes migratio

Five individ

rder to conf

done for in

e specimen

vidual in line

e confirmed

pecific band

The quan

only 769 sp

r eel stage

ause the m

chioka 200

cimens is sh

tification of

phological a

s of taxa: A 5 bp

230 bp

ntification spec he sample is a

-12 are A. bor 3-25 and 27 a and.

of these se

nds are a

The differe

on of the PC

duals of eac

firm the exp

dividuals sh

ns showed

e 27 to Fig

d as A. int

s of 230 an

titative mea

pecimens po

e. The qua

orphologica

03). The fo

hown in Tab

all specim

analyses fa

A. celebese 230 bp

670

cies and subs as follow : 1-2 rneensis, 13-1 are A. interioris

even specie also produ ent fragme CR product ch banding pected iden howing une d unexpec

gure 4). One

terioris. A

nd 620 bp.

asurement

ossible to m

alitative me

al character

our morph

ble 3. The

ens (excep

iled to iden

ensis versu 0 bp

450 bp

pecies of Ang are A. n. nebu 17 are A.celeb s, M=100 bp l

es-specific f

uced, whic

nts sizes c

on a 1,5 %

pattern typ

ntification. S

expected ba

cted band

e of showe

As a result,

of DA was

measureme

asurements

rs in this s

ological gr

right side o

pt 3), based

tify glass e

us A. interi 720bp b

guilla by semi-ulosa, 3-7 are besensis, 18-2 adder, u

fragments a

ch does n

can be eas

% agarose e

pes were se

Sequencing

anding patte

among 1

ed DNA dam

, A. interio

applied on

ent by a qua

s are inapp

tage are no

rouping dis

of Table 3 i

d on semi-m

eels and can

rioris, A. n. 620bp b

multiplex PCR A. b. bicolor, 22 and 26 are nspecific band

are given i

not impede

ily observe

lectrophore

equenced a

g and alignm

ern. In this s

115 exam

mage and t

oris can pro

n all 1115 s

alitative one

plicable on

ot clearly e

stinguishing s species-s multiplex P nnot disting nebulosa bp 795 b R samples. 8-10 are A. A.

ds, =

n Table 2.

e species

ed after 90

esis gel. nd aligned ment were study, only ined (see two others oduce two specimens,

e that only

glass eel

established

g the 769

subspecies

CR assay.

guish three

(31)

marmorata and A. b. bicolor versus A. b. pacifica. Only A. borneensis is

identifiable by morphological character only, as a “long fin” without marbling eel.

These results are in agreement with Watanabe (2003).

Table 3. Identification eel by morphology (only 796 eels were classified into the

four group) and semi-multiplex-PCR (1112 eels were identified among 1115 eels)

Group by morphology (n) Species (n) by multiplex PCR

− Long dorsal fin with marbling skin and broad maxillary bands of teeth (15)

: A. celebenesis (47), A. interioris (16)

− Long dorsal fin with marbling skin and narrow maxillary bands of teeth (428)

: A. marmorata (487), A. n. nebulosa (15)

− Long dorsal fin, without marbling skin (3) : A. borneensis (3)

− Short dorsal fin, without marbling skin (323) : A. b. bicolor (510), A. b. pacifica (34)

Discussion

Since morphological identification was not sufficient to determine Anguilla

species and subspecies, several molecular approaches have been proposed on

previous study. Most of the identification methods used simple PCR followed by

sequencing (Sezaki et al. 2005; Trautner 2006). However, sequencing is not

convenient for large samples because of its cost in time and money. Some of the

studies have used multiple loci such as RFLP-PCR (Aoyama et al. 2001, 2000;

Lin et al. 2001) and RAPD-PCR (Kim et al. 2009) with non species-specific

primers, which mean that many loci are needed for identification. Besides, the

number of species determined with each above-mentioned method is limited,

such as two species (Aoyama et al. 1999; Sezaki et al. 2005) or four species

(Kim et al. 2009).

The semi-multiplex method proposed here has demonstrated to be efficient

for identifying seven species and sub-species of tropical eel with only one step

PCR. By using this method, one could reduce the number of necessary

sequences while the results are very sure for each species determination (we

easily identified 1112 specimens). All of species were obtained in this study have

show overlapping morphology and distribution. Moreover for small specimens

(mainly glass eels), the molecular method appears as indispensable.

Shen et al. (2010) suggested several additional criteria which must be

taken into account when considering multiplex PCR assay 1) minimize primer

dimer association between all of the primers; 2) similarity of the annealing

temperature of each primer; 3) primer specificity; and 4) constraint the migration

of the amplicons in order to separate the DNA fragments in agarose gel

(32)

18

electrophoresis. In the present survey each primer is species or

subspecies-specific and the limited cases of unexpected (non-subspecies-specific) amplification never

reduced the liability of species determination. Banding pattern of A. b. pacifica

shows a weak specific fragment of 670 and a bigger un specific band of 230, but

this fragment pattern being stabile for all our A. b. pacifica specimens, there is no

difficulty to determine this species.

The length of amplified fragments was clearly distinguishable after

electrophoresis migration (no overlapping fragment). The primer structure was

checked in order to avoid inter-molecules interaction, which is an important

precaution with 9 primers simultaneously mixed in one step PCR. Optimization of

the semi-multiplex PCR mix consisted in designing an annealing temperature and

quantity of primer permitting was similar to amplification efficiency to pairs of

primers.

Semi-multiplex PCR methods has been introduced recently on eels by

Gagnaire et al. (2007) in order to rapidly determinate tree species of Anguilla: A.

marmorata, A. megastoma and A bicolor bicolor from West Indian Ocean.

Genetic distances between each species pairs in genus Anguilla are almost 0,02

until 0.05 based on 16S rRNA (Watanabe 2003). This study has established a

rapid method to distinguish even two subspecies A. b. bicolor and A. b. pacifica,

although these two subspecies have low genetic distance which is 0.0068 based

on the 16S rRNA

This method has proven to be the most simple, quicker, lower cost (no

acrilamide migration), specific/sensitive, and highly reliable way than the other

ones used before. This rapid method provides a useful tool for aquaculture,

global marketing, and academic-scientific research.

(33)

III. Distribution of Tropical Eel Genus

Anguilla

in

Indonesian Waters Based on Semi-multiplex PCR

Abstract

Tropical eels living in Indonesian waters are known to be composed of

several species, but their real listing together with their distribution ranges need

to be established. The main difficulties are the very high number of islands with

perennial rivers where these species are living during the growth phase of their

life cycle. It is difficult, sometimes impossible, to determine the species using

morphological characters, moreover on glass eels. In order to establish the

geographic distribution of tropical eels of the genus Anguilla in Indonesian

waters, a total 1115 specimens were collected between 2008 and 2012. Sample

collection was done in the growth habitats that are rivers and estuaries by

commercial nets of different categories according to the fish size. All samples

were identified genetically using the recently developed semi-multiplex PCR

method. Four species and subspecies was recognized with wide distribution:

Anguilla bicolor bicolor, A. b. pacifica, A. marmorata and A. interioris; two species

with limited distribution, close to endemism: A. celebesensis and A. borneensis

and one subspecies A. nebulosa nebulosa that is only spread in river flowing into

Indian Ocean.

Key words:Anguillaspp, semi-multiplex PCR, tropical eel, distribution range,

Indonesian waters

 

Introduction

The catadromous freshwater eels genus Anguilla is distributed nearly

world-wide except the South Atlantic and the Eastern Pacific oceans (Ege 1939).

Freshwater eels spawn in the offshore ocean. After hatching, their larvae migrate

to coastal areas as pelagic, floating and transparent (Mochioka 2003). Eel larvae,

called leptocephali, are transported passively by warm currents flowing at low

latitudes. When they approach the continental shelf, leptocephali metamorphose

into glass eels before settling in the continental waters (rivers and lakes) to grow

for years until changing into yellow eels or “elver” and then silver eels. The

dispersal of leptocephali not only drives the distribution of freshwater eel species

(34)

on continental areas, but also the phylogeography of the genus and its evolution

(Aoyama and Tsukamoto 1997).

After Johannes Schmidt succeeded collecting anguillid leptocephali in the

Sargasso Sea in 1922 (Schmidt 1922), he and his colleagues, through Carlsberg

Foundation’s Oceanographic Expedition, continued their efforts by searching for

the spawning areas of freshwater eels in the Indo-Pacific region where most of

the species of this genus are found. They successfully collected leptocephali in

the Indo-Pacific region during their expedition from 1928 to 1930 (Jespersen

1942). However, most of these leptocephali have overlapping morphological

characters, hampering exact identifications. Since then, the spawning areas of

the Indo-Pacific anguillid species have remained a mystery. As a result, the

studies of Indo-Pacific eels are still poorly understood as well as the exact

locations of the spawning areas, and their larval migrations and the recruitment

mechanisms.

To solve the problems in identifying anguillid leptocephali, genetic

approaches, mtDNA sequences or RFLP, has been successfully used (Aoyama

et al. 1999, 2001a, 2001b; Aoyama 2003; Watanabe et al. 2005). Since species

identification of anguillid leptocephali has been developed, projects aimed at

learning more about the spawning areas, larvae distribution and larval ecology of

anguillid in the Indo-Pacific region have been organized. The long scientific cruise

of the Baruna Jaya, in central Indonesia sea, around Sulawesi Island, from

2001-2002, successfully collected leptocephali of A. marmorata, A. bicolor pacifica and

A. interioris. This survey also collected leptocephali of A. celebesensis and A. borneensis allowing to deduce the spawning areas of these species (Aoyama et al. 2003, Wouthuyzen et al. 2009). In 2003 this cruise also collected young

leptocephali A. bicolor bicolor in west Sumatera, positioning a spawning area of

A. b. bicolor in this zone (Aoyama et al. 2007).

The three Indonesian endemic species spawning areas are also to be

discovered: leptocephali of A. interioris have been caught in western Sumatera

waters (Aoyama et al. 2007) and Sulawesi waters (Aoyama et al. 2003,

Wouthuyzen et al. 2009); leptocephali of A. celebesensis were recognized in

Tomini Bay Sulawesi Island and that of A. borneensis were found in Makasar

strait (Aoyama et al. 2003; Wouthuyzen et al. 2009).

According to the geographic range of each species, Aoyama et al. (2001)

and Lin et al. (2001) who studied genus Anguilla molecular phylogenetics based

(35)

on partial mtDNA, showed four major subgroups in the world, that are Oceanic,

Atlantic, Tropical-Pacific and Indo-Pacific lineages. However, the complete

mtDNA sequence of all species of genus Anguilla was determined recently by

Minegishi et al. (2005) which suggested the geographic structure of eel as follow:

two Atlantic species (A. rostrata and A. anguilla), two Oceanic species (A.

differenbachii and A. australis), and nine Indo-Pacific species (A. japonica, A.

reinhardtii, A. marmorata, A. nebulosa, A. bicolor, A. interioris, A. celebesensis,

A. megastoma and A. obscura). Seven species/subspecies of the Indo-Pacific

Anguilla occur in the western Pacific and eastern Indian Ocean around

Indonesian waters (Ege 1939; Castle & Williamson 1974). Because of this high

diversity, several scientists considered that “Indonesia is homeland of anguilid”.

Besides, Indonesia is also known as "the origin of anguillid" because

phylogenetic analyses indicated that the endemic tropical species A. borneensis

from eastern Borneo (Kalimantan) is one of the most basal species of the genus

(Aoyama et al. 2001; Minegishi et al. 2005).

Among the 19 existing eel species and sucspecies, 7 occupy the

Indonesian rivers. Half of them are endemic, limited to Indonesia (A. borneensis,

A. cebesensis, A. interioris), the others show larger range distribution (A.

obscura, A. nebulosa), sometimes established at the Indo-Pacific level (A. bicolor

and A. marmorata). However, the species range distribution of the 7 Indonesian

species is only an extrapolation of very limited records.

The widespread species A. bicolor and A. marmorata are of interest

because their distribution and abundance place them in central economic

position, and because their exceptional geographic distribution (over 18,000 km

east-west) and structure made them an important model for eel biology

understanding, encompassing probably several spawning areas. Short fin eels A.

bicolor are considered to be structured into two subspecies A. b. bicolor in Indian

Ocean, especially at the west of Indonesia and A. b. pacifica in Pacific Ocean, at

the east of Indonesia (Minegishi et al. 2012).The giant mottled eel A. marmorata

is not taxonomically divided into subspecies because of its morphological

stability, however molecular studies have demonstrated its structure into four

differentiated populations: North Pacific, South Pacific, Indian Ocean, and

Mariana (Minegishi et al. 2008; Gagnaire et al. 2009, 2011).

One of the most exigent parts of this study is sampling strategy. Indonesia

is an archipelago country with counts 17000 islands, among them several

(36)

thousand islands possibly hosting eels so a complete sampling is impossible. The

selection of representative sampling location is necessary.

Indonesian sea have a complex topography and connectivity between the

Pacific and Indian Oceans, so surface heat fluxes, thermo cline and variability in

thermocline waters and patterns of Indonesia current was influenced by Pacific

and Indian Ocean fluctuations. The eastern part of Indonesia waters influenced

by the Indonesian throughflow (ITF) current. ITF are water mass flow passing

through Indonesian waters from Pacific to Indian Ocean. This water mass flow

occurs as a result of the pressure difference between the two oceans. The water

mass drives upper thermocline water from the North Pacific through the western

route of the Makassar Strait directly exit through the Lombok Strait or flow

eastward into the Banda Sea and further joined with the south equatorial current

(SEC) (Wirtky 1973; Gardon 2005). The western Indonesian waters affected by

South Equatorial Counter Current (SECC), and this current going down the

Sumatran coast entry to southern coast of Java by South Java Current (SJC).

A new molecular identification method has been developed recently to

distinguish seven tropical eel inhabiting Indonesian waters, called semi-multiplex

PCR assay. By using multiple species-specific primers in one PCR reaction, the

identification of all Indonesian species is now simple, quick, low cost, sensitive,

and highly reliable (Fahmi et al. 2012).

In this study the semi-multiplex PCR methodology was used in order to

establish a first map distribution of species and subspecies of tropical eel

(Anguilla spp) that inhabit in Indonesian water.

Material and Methods

The 1115 specimens were collected in 28 locations around the

Indonesian waters, covering the whole geographic distribution of genus Anguilla

as known or expected in Indonesian waters (Appendix 1, Table 4). Specimens

collection was conducted in river estuaries along the coast of Indian Ocean,

Pacific Ocean and around Arafuru and Celebes Seas. The specimens were

collected from 2008 to 2011 by using traps, nets and fishing. Oceanographic

data of Indonesian seas (Gardon 2005) used for looking the movement of water

and the possible spread of eels.

All of specimens were identified using semi-multiplex PCR protocol

according to Fahmi et al (2012 (in press)). Nine species-specific primers were

(37)

added in one PCR reaction. The PCR was carried out in a total volume of 10 µl

containing 2 µl 5x Green GoTaq@ reaction buffer, 0.5 µl MgCl2 (25 mM), 1.25 µl

dNTP (2 mM), 0.5 µl each primer (10 mM) with 1 µl (10 mM), 0.05 µl GoTaq@

DNA polymerase (5 u/µl), 0.2 µl ddH2O and 1 µl template DNA (around 20 ng).

Semi-multiplex-PCR was carried out in a Bio-Rad Thermal Cycler, programmed

to perform a denaturation step at 95oC for 5 min, followed by 35 cycles with 45 s

at 95oC, 45 s at 50oC and 1 min at 72oC. The final extension step (at 72oC) lasted

10 min. Five microliters of each PCR product were loaded on a 1,5% agarose

electrophoresis gel, stained with Cyber Safe before electrophoresis and migrated

at 100 volts for 90 min. The DNA bands were observed under Blue Light and

photographed by a Canon camera digital.

Gambar

Figure 1 World production of eels (FAO 2009), graphic adapted from FAO 2009
Figure 2.  Research framework
Figuure 3
Table 1    Position of nine species-specific primers for semi-multiplex PCR on cytochrome b and 16s rRNA genes respectively
+7

Referensi

Dokumen terkait

Relationship between (A) Total Length and Eye Index, and (B) Total Length and Gonado Somatic Index of the Anguilla bicolor bicolor from the Waters of Segara Anakan (West

Besides, it is also important to explore the potency of marine yeast powder to use in fodder formulation and its influence in the growth of eel fish stadia elver by

Monthly catch statistics of anguillid eels with transaction at each stage in Sukabumi Regency, Indonesia in 2014 Local government of Sukabumi Regency, 2015 Therefore, we set four

Borneo Journal of Resource Science and Technology 2016 62: 1-10 Distributions of Dissolved Manganese in the Surface Waters of the Tropical North-Eastern Atlantic Ocean FARAH AKMAL

We discuss the ecological significance of seed respiration in three groups of tropical species which differ in seed moisture content, mass, viability, and post-dispersal moisture

Correlation between gonadal development stage and gonadal somatic index of striped eel catfish in the Kolono Bay, South Konawe District, Southeast Sulawesi, Indonesia Table 2... Length

Highlights 1 - The fat content of eels was variable and directly related to weight 2 - C14:0, C18:1n-9 and C20:4n-6 were higher and DHA and EPA were lower in the 3 larger eels 4

Potential area of habitat for eel larvae in wet months During dry months, suitable areas for eel larvae can be found in the coastal waters of Ciletuh Bay and the Ciletuh and