• Tidak ada hasil yang ditemukan

Directory UMM :Data Elmu:jurnal:P:PlantScience:PlantScience_Elsevier:Vol154.Issue1.2000:

N/A
N/A
Protected

Academic year: 2017

Membagikan "Directory UMM :Data Elmu:jurnal:P:PlantScience:PlantScience_Elsevier:Vol154.Issue1.2000:"

Copied!
9
0
0

Teks penuh

(1)

Molecular cloning of a novel water channel from rice: its products

expression in

Xenopus

oocytes and involvement in chilling

tolerance

Le-gong Li

1

, Shi-fang Li

2

, Yan Tao, Yoshichika Kitagawa *

Laboratory of Plant Genetic Engineering,Biotechnology Institute,Akita Prefectural Uni6ersity,Ogata,Akita010-0444,Japan

Received 15 March 1999; received in revised form 28 October 1999; accepted 1 December 1999

Abstract

Water channel proteins, aquaporins, play a fundamental role in transmembrane water movements in plants. We isolated rice cDNA,rwc1, by screening a rice (Oryza sati6acv. Josaeng Tongil) cDNA library using a conserved motif of aquaporins. Like

other aquaporin genes,rwc1 encodes a 290-residue protein with six putative transmembrane domains. The derived amino acid sequence of RWC1 shows high homology with PIP1 (plasma membrane intrinsic protein 1) subfamily members, which suggest it is localized in the plasma membrane. Injection of its cRNA intoXenopusoocytes increased the osmotic water permeability of the oocytes 2 – 3 times. Northern analysis showed that rice aquaporin genes are expressed in rice seedling leaves and roots, but that it disappeared from the root 6 h after osmotic stress began and that the transcript level remained low for about 24 h, then recovered. The time course of rice aquaporin gene-expression under osmotic stress was correlated with time course of turgor transition in plant. On the other hand, the levels of rice aquaporin gene-transcripts in leaves under chilling and recovery temperature depend on the pretreatment of mannitol for short time. This variation of the transcripts shown that rice aquaporin genes may play an important role in response to water stress-induced chilling tolerance. © 2000 Elsevier Science Ireland Ltd. All rights reserved.

Keywords:Rice; Water channel; Water stress; Chilling tolerance;Xenopusoocyte

www.elsevier.com/locate/plantsci

1. Introduction

Transmembrane water flow is a fundamental process of life. Although water permeability as a biophysical feature of cell membrane, the molecu-lar pathway of transmembrane water movement remained unknown until the discovery of

aquapor-ins [1]. The recent discovery that plants express numerous aquaporins in both the plasma mem-brane and the tonoplast has changed our view of how plant cells regulate transmembrane water movement [2,3]. Water channel proteins (aquapor-ins) belong to the major intrinsic protein (MIP) superfamily that permit the passage of specific molecules through biological membranes. Since the first aquaporin (AQP1) was identified in hu-man erythrocytes [1], hu-many more have been iso-lated from various organisms, including bacteria, plants, and animals [3]. In plants, many MIP genes have been isolated. They are encoded by several gene families and are hydrophobic integral mem-brane proteins that range in apparent molecular

mass from 23 to 31 kDa [4]. Since g-tonoplast

intrinsic protein (g-TIP) was first recognized as a

plant aquaporin [5], more different genes have

The nucleotide sequence data reported appeared in EMBL, Gen-Bank and DDBJ Nucleotide sequence Database under the accession number AB009665.

* Corresponding author.

E-mail address:[email protected] (Y. Kitagawa)

1Permanent address: Shanghai Institute of Plant Physiology,

Chi-nese Academy of Sciences, Shanghai 200032, People’s Republic of China.

2Present address: Institute of Plant Protection, Chinese Academy

of Agricultural Sciences, 2 West Yuanmingyuan Road, Beijing 100094, China. Le-gong Li and Shi-fang Li contributed equally to this work.

(2)

been identified [6]. Their products are located in the tonoplast and plasma membrane. Sequence comparisons have shown a high homology be-tween plant aquaporins; all published sequences are clearly of TIP or plasma membrane intrinsic protein (PIP) members. These relationships even extend to the PIP1 and PIP2 subfamilies, origi-nally introduced by Kammerloher et al. [7]; easily classified as PIP1 or PIP2 based on specific arrays of amino acids at the N- and C-termini.

Although DNA sequences with high homology to the aquaporin genes have been identified in several plant species [4], the water permeability and function haven’t been determined, only a few of the gene products have been characterized [6 – 11]. Their roles in response to various physiologi-cal and stress conditions warrants further research. Here we report the isolation of the first water channel gene to be identified in rice, the activity of its water permeability, and the possible role in response to osmotic and chilling stress.

2. Materials and methods

2.1. Plant material, osmotic and chilling treatments

Wasetoitsu (Oryza sati6a cv. Josaeng Tongil) is

a less chilling-tolerant hybrid rice variety devel-oped in the Republic of Korea. Seedlings and culture cells were prepared as described previously [12]. For treatment with mannitol and NaCl, rice seedlings at the three leaf-stage were transferred to

fresh liquid Hoagland’s medium [5 mM Ca(NO3)2,

5 mM KNO3, 2 mM MgSO4, 0.025 mM FeSO4

-EDTA in tap water] containing 0.25 M mannitol or 0.15 NaCl, at 25°C. For chilling, after mannitol treatment the seedling was washed with tap water, and transferred to fresh Hoagland’s medium, incu-bated for 24 h at 4°C and then transferred to 25°C for 24 h.

2.2. cDNA library construction and screening

Total RNA was extracted from leaves that had been treated for 30 min with 0.5 M mannitol. A

cDNA library was constructed in the NotI site of

lgt10. Aliquots of the cDNA were used as a

template for the polymerase chain reaction (PCR) with designed primers corresponding to the

se-quences surrounding the Asn-Pro-Ala motif of aquaporins [5]. A PCR product of 393 bp was subcloned into the pT7Blunt vector (Novergen, USA) and sequenced on both strands using ABI373 Applied Biosystem (USA). This DNA

fragment was radioactive labeled with [a32P]dCTP

by random DNA labeling (Takara, Japan) and

was used as a hybridization probe to screen 3×

105 plaques from the cDNA library. A positive

plaque was isolated and the insert of the phage

DNA was subcloned into a pBluescript KS+

ac-cording to the manufacturer’s protocol

(Strata-gene, USA). The subcloned cDNA, rwc1, was

sequenced and analyzed using the GENETYX

Ver-sion 8 (Software Development Co., Japan).

2.3. Northern analysis

Total RNA was prepared as described by

Koga-Ban et al. [13], and 5 mg of total RNA was

fractionated on a 1.2% denaturing formaldehyde agarose gel. The RNA was transferred to a

Hy-bond™-N+ membrane (Amersham, UK) using

200SSC [14]. Prehybridization and hybridization were performed using a rapid-hybridization buffer, as suggested by the manufacturer (Amersham).

The probe was the full-length rwc1 sequence

la-beled with 32P by the random primer method

(Takara, Japan).

2.4. Competiti6e PCR

Transcription levels of rwc1 were specifically

determined by the competitive PCR method [15]. Competitor lambda RNA (448 bases) against rice actin mRNA (accession number X15863 [16]) was made from a lambda DNA fragment placed in

between the rice actin 5%primer (5%

-AGAGCTAC-GAGCTTCCTGATGGAC-3%) and 3% primer

(5%- GAGAGATGCCAAGATGGATCCTCC - 3%)

regions. A SP6 promoter (5%

-ATTTAGGTGA-CACTATAGAATAC-3%), induced upstream of

the 5%actin primer, was used to synthesize RNA

using SP6 polymerase according to the

manufac-ture’s protocol (Takara, Japan). Competitor

lambda RNA (530 bases) againstrwc1 mRNA was

prepared in the same manner from a lambda DNA

fragment that was spaced by rwc1 5%(5%

-ATCTA-CAACAAGGACCATGCCTGGA-3%) andrwc1 3%

(5%- ATTACACGATTGAGTTGTTCAGGGT - 3%)

(3)

pro-moter. Using the rwc1 or actin-primers, fragment

sizes of 333 bp for actin and 280 bp for rwc1 are

obtained by RT-PCR using total RNA. The reac-tion mixture contained 10 ng of sample RNA,

105– 109 copies of competitor lambda RNA, 10

pmol of random 9 mer primer, 1 U of AMV reverse transcriptase, 4 U of RNase inhibitor, and

4 mM dNTP mixture in 4 ml of PCR buffer (10

mM Tris – HCl, pH 8.3, 50 mM KCl and 5 mM

MgCl2). cDNA synthesize was allowed to proceed

for 30 min at 42°C, followed by denaturation for 5

min at 99°C. The 4 ml cDNA solution was then

mixed with 16ml of PCR reaction mixture

contain-ing 1 – 4 pmol each of the particular 5%and 3%

primers, and 0.5 U of Taq polymerase in PCR

buffer. Samples were amplified by 30 cycles at 94°C for 0.5 min, 55°C for 0.5 min, and 72°C for 1 min. An aliquot of each reaction mixture was subjected to electrophoresis on 3% NuSive agarose gel.

2.5. In 6itro synthesis of rwc1 cRNA

The rwc1 gene which was cut from the plasmid

withBamHI was inserted into theBglII site of the

Xenopus expression construct pXbG/ev-1; a

pSP64T-derived pBluescript-type vector into

which Xenopus b-globin 5%and 3%untranslated

sequences were inserted [1]. Recombination of the plasmid was checked by sequencing. Capped RNA

transcripts ofrwc1 were synthesized in vitro using

T3 RNA polymerase and linearized recombinant

plasmids containing rwc1 cDNA after digestion

withBamHI (Stratagene). After ethanol

precipita-tion, the synthesis products were suspended in

diethylpyrocarbonate-treated H2O at a final

con-centration of 1 mg/ml.

2.6. Microinjection of cRNA into oocytes and water permeability analysis

Mature oocytes (1.2 – 1.3 mm diameter, stage V

and VI) were isolated from adult Xenopus la6is

[17,18] and stored in Barth’s buffer containing

Na-penicillin (10 mg/ml) and streptomycin (10 mg/

ml). The follicular cell layer was removed by

incu-bation with 2 mg/ml collagenase (Boehringer,

Germany) in Barth’s buffer for 2.0 – 2.5 h at 25°C with gentle continuous agitation. Defolliculated oocytes were injected with 46 nl of cRNA (1

mg/ml) or water using an automatic injector

(Nanoject; Drummond). The oocytes were incu-bated for 2 days at 18°C in Barth’s buffer before water permeability measurements.

Individual oocytes were transferred from

Barth’s buffer (200 mosm) to a three-fold dilution of Barth’s buffer with distilled water (70 mosm) at 20°C. Oocyte swelling was checked using an area Colony Analyzer (CA-7, Toyo Sottuki, Japan). The area covered by the oocytes was measured at 5-s intervals; the total cell volume was calculated from the cell area. The relative oocyte volume

(V/V0) was calculated from the relative oocyte

area (A/A0) using the equation V/V0=(A/A0)

3/2.

The osmotic water permeability coefficient (Pf,

cm/s) was calculated from oocyte surface area

(S=0.045 cm2), initial oocyte volume (V

0=9×

10−4 cm), water volume (Vw=18 cm3/mol), and

the initial rate of oocyte swelling, d(V/V0)/dt,

using the equation Pf=V0d(V/V0)/dt[SVw

-(osmout−osmin)], where osmout is 70 mosm and

osmin is 200 mosm.

3. Results and discussion

3.1. Isolation of rwc1 from the rice cDNA library

We used the most conserved sequences of the aquaporins to design our PCR primers, and used the cDNA library as the template. The 393-bp product showed high sequence homology to PIP1c from Arabidopsis, and it was used to probe the

same cDNA library. The 1.1-kb fragment of rwc1

contained a 49-bp 5%-untranslated sequence

pre-ceding an initiation site consensus sequence. An 870-bp open reading frame was followed by a

3%-untranslated sequence containing a

polyadeny-lation consensus sequence (accession no.

AB009665).

3.2. Deduced structure of RWC1 and homology comparisons

Analysis of the Genbank database showed that

rwc1 is a novel member of the aquaporin family.

(4)
(5)

domains as well as the functionally important B and E loops. Hydropathy analysis indicated that RWC1 has six putative bilayer-spanning domains and five connecting loops, of which loops B and E were also hydrophobic (Fig. 1b). Both hydropho-bic loops, which may form opposite leaflets, contained the NPA motif (Asn-Pro-Ala) that is present in all aquaproins (Fig. 1b),

how-ever RWC1 did not contain the cysteine

residue that confers mercury sensitivity to AQP1 [19]. In addition, the phosphorylation site seen in PM28A (Ser-274) [20] was not identified in RWC1; however, the predicted topology of RWC1 contained some distinctive features. One putative cAMP or cGMP-dependent protein kinase phos-phorylation motif (RKLS) was identified at residues 128 – 131. Two consensus sequences (SER, SSK) for protein kinase C phosphorylation were present near the N-terminal region (Fig. 1a), which was longer than the corresponding domain

in E. coli [21] and mammalian aquaporins; some

domains may have functions that are specific to plants.

Nucleotide sequence comparisons between rwc1

and other genes analysis are shown in Fig. 1C.

Related sequences were detected in human, Ara

-bidopsisand spinach genes. The phylogenetic

anal-ysis indicates thatrwc1 belongs to the MIP-related

genes and is more closely related to PIP1 of Ara

-bidopsis than to PM28A of spinach. We have

classified rwc1 as a member of the PIP1 subfamily.

The deduced amino acid sequence of RWC1

dif-fers significantly from that of g-TIP, which is

located in the tonoplast, so RWC1 may be located in plasma membrane.

3.3. Rice aquaporin genes response to osmotic

6ariation and in6ol6e into water stress-induced chilling tolerance

The expression of rice aquaporin genes was determined by Northern blotting using total RNA isolated from leaves and roots of rice seedlings at

the three-leaf stage and full-length rwc1 as the

probe. Rice aquaporin-mRNAs were detected in both leaves and roots (Fig. 2a and b). When the seedlings were treated with 0.25 M mannitol or 0.15 M NaCl, the transcript level changed. Tran-script level in root had declined drastically 6 h after the stress began and remained low for about 24 h. After that period, the transcript level of aquaporin genes increased again to at least the pre-stress level (Fig. 2A and B). The response of rice aquaporin genes to osmotic stress is similar to response of MipA and MipC genes in ice plants [11]; expression of aquaporin genes is suppressed under osmotic stress. Beside aquaporin gene-sig-nal, there are several signals in Fig. 2A and B, but

(6)

Fig. 2. Northern blot analysis of rice aquaporin-mRNA, stress response and tissue specificity. Total RNA fractions were prepared from leaves and roots, and then aliquots (5mg) of them were applied to northern analysis. The gels were stained with ethidium bromide to detect rRNAs (indicated below). (A) Mannitol treatment. 1, control; 2, 0.25 M mannitol for 1 h; 3, 0.25 M mannitol for 3 h; 4, 0.25 M mannitol for 6 h; 5, 0.25 M mannitol for 24 h; 6, 0.25 M mannitol for 48 h; 7, 0.25 M mannitol for 72 h. (B) NaCl treatment. 1, control; 2, 0.15 M NaCl for 1 h; 3, 0.15 M NaCl for 3 h; 4, 0.15 M NaCl for 6 h; 5, 0.15 M NaCl for 24 h; 6, 0.15 M NaCl for 48 h; 7, 0.15 M NaCl for 72 h. (C) Chilling treatment (leaf). 1, control; 2, 4°C for 24 h; 3, 4°C for 24 h, then transferred to 25°C for 24 h; 4, 0.25 M mannitol for 3 h; 5, 0.25 M mannitol for 3 h, then incubated at 4°C for 24 h; 6, 0.25 M mannitol for 3 h, then incubated at 4°C for 24 h and transferred to 25°C for 24 h; 7, 0.25 M mannitol for 6 h; 8, 0.25 M mannitol for 6 h, then incubated at 4°C for 24 h; 9, 0.25 M mannitol for 6 h, then incubated at 4°C for 24 h and transferred to 25°C for 24 h.

not in Fig. 2C. It is presumed that washing condi-tion of RNA blot of Fig. 2A and B was not optimal.

(7)

to 0.25 – 0.5 M mannitol over a short time before chilling treatment [12]. When Wasetoitsu seedlings pretreated with 0.25 M mannitol for 3 and 6 h were incubated at 4°C for 24 h and then trans-ferred to 25°C for 1 day, the expression of the aquaporin genes in the leaves showed fluctuation. Mannitol pretreatment for short time is helpful to down-regulate the expression of the aquaporin genes under chilling stress, and improve its expres-sion during the period in recovering (Fig. 2C). When the pretreatment time with mannitol are increased, the transcription levels of the aquaporin genes in leaves are to be lower at low temperature,

but the transcription levels are recovered signifi-cantly after the seedling transferred to 25°C (Fig. 2C). As we know, water channel is a bi-directional pore for water efflux and influx. The driving forces behind water movement are hydraulic or osmotic in nature [2]. One aspect of the chilling harm to plant is lost water. At low temperature, lower expression of aquaporin genes is beneficial to keep a suitable status of water; a fast recovery is also necessary for adaptation to standard physiological process. Characterization of the expression of aquaporin genes is just right to match the plant request. It is presumed that aquaporin genes may play an important role in response to water-stress induced chilling tolerance.

The multiplicity of MIP genes are in plants as reported before [22], it leads us to presume that many similar genes exist in rice; some may be precisely regulated by water stress, whereas other are probably not affected. In this Northern experi-ment we could not determine the specific

expres-sion of rwc1, because we used full-length rwc1 as

the probe. Next we determined the specific

expres-sion ofrwc1 in rice roots under osmotic stress and

chilling stress by competitive PCR using specific

primers for the 3%-untranslated rwc1 region. The

agarose gel results are shown in Fig. 3A, and the

calculated numbers of rwc1 transcripts per actin

transcript are shown in Fig. 3B. The specific

ex-pression of rwc1 mRNA under osmotic and

chill-ing stress is essentially similar to the results of Northern hybridization shown in Fig. 2C, and

suggests that rwc1 in particular is involved in

responses to water stress-induced chilling

tolerance.

3.4. Analysis of the water transport function of RWC1

The water channel activity of RWC1 was

as-sayed by injecting rwc1 complementary RNA

(cRNA) into Xenopus oocytes. A cRNA that was

synthesized in vitro from the cDNA, which had

been cloned in vector pXbG/ev-1. cRNA of aqp2

[23] and rwc1 synthesized using pXbG/ev-l, were

injected into oocytes. After 3 days of incubation in isotonic Barth’s buffer, the oocytes were

trans-ferred to a hypotonic buffer (1/3 Barth’s buffer),

and the relative increase in cell volume, a conse-quence of water uptake, was measured [17]. The results indicate that RWC1 has water channel

(8)

Fig. 4. Expression ofrwc1 cRNA and cell membrane perme-ability. Oocytes were injected with cRNA orF water as indi-cated. Oocyte swelling was as described in Section 2. Values are the mean9S.D. of 7 – 10 oocytes (stippled bars).

Acknowledgements

We thank Dr K. Fushimi and M. Kuwahara of Tokyo Medical and Dental University for kindly

providing the AQP2 gene and pXbG/ev-1 vector.

This work was supported by Grant-in-Aid for Scientific Research from the Ministry of Educa-tion, Science and Culture (Japan), for Special Sci-entific Research on Agriculture, Forestry and Fisheries, and by Grants from the Sumitomo Foundation (Japan) and Ciba-Geigy Foundation (Japan) for the Promotion of Science; and Na-tional nature and science foundation: 39670074 (China).

References

[1] G.M. Preston, T.P. Carroll, W.B. Guggino, P. Agre, Appearance of water channels in Xenopus oocytes ex-pressing red cell CHIP28 protein, Science 256 (1992) 385 – 387.

[2] M.J. Chrispeels, C. Maurel, Aquaporins: the molecular basis of facilitated water movement through living plant cells?, Plant Physiol. 105 (1994) 9 – 13.

[3] C. Maurel, Aquaporins and water permeability of plant membranes, Annu. Rev. Plant Physiol. Plant Mol. Biol. 48 (1997) 399 – 429.

[4] A.R. Scha¨ffner, Aquaporin function, structure, and ex-pression: are there more surprises to surface in water relations, Planta 204 (1998) 131 – 139.

[5] C. Maurel, J. Reizer, J.I. Schroeder, M.J. Chrispeels, The vacuolar membrane protein r-TIP creates water specific channels inXenopusoocytes, EMBO J. 12 (1993) 2241 – 2247.

[6] A. Weig, C. Deswarte, M.J. Chrispeels, The major intrin-sic protein family of Arabidopsis has 23 members that form three distinct groups with functional aquaporins in each group, Plant Physiol. 114 (1997) 1347 – 1357. [7] W. Kammerloher, U. Fisher, G.P. Piechottka, A.R.

Scha¨ffner, Water channels in the plant plasma membrane cloned by immunoselection from a mammalian expres-sion system, Plant J. 6 (1994) 187 – 199.

[8] M.J. Daniels, E. Mirkov, M.J. Chrispeels, The plasma membrane ofArabidopsis thalianacontains a mercury-in-sensitive aquaporin that is a homolog of the tonoplast water channel protein TIP, Plant Physiol. 106 (1994) 1325 – 1333.

[9] M.J. Daniels, F. Chaumont, T.E. Mirkov, M.J. Chrispeels, Characterization of a new vacuolar mem-brane aquaporin sensitive to mercury at a unique site, Plant Cell 8 (1996) 587 – 599.

[10] C.H. Oppermann, C.G. Taylor, M.A. Conkling, Root-knot nematode-directed expression of a plant root-spe-cific gene, Science 263 (1994) 221 – 223.

[11] S. Yamada, M. Katsuhara, W.B. Kelly, C.B. Michalowski, H.J. Bohernert, A family of transcripts encoding water channel proteins: tissue-specific

expres-activity in oocytes (Fig. 4). Our osmotic water permeability indicated that the RWC1 protein led to a swelling rate 2 – 3 times higher than that of water-injected oocytes. However, the water

permeability of the oocytes injected with rwc1

cRNA was not as great as that of oocytes

in-jected with aqp2 cRNA. Why did RWC1 show

weaker water channel activity? There are several possible reasons. One is that the phosphorylation sites and the other residues of the carboxyl-ter-minal cytoplasmic domain of RWC1 do not clar-ify function as restraints, as they do in animals. The second possibility is that, as for MIP in animals, a specific membrane environment may be required to improve the translation of the

rwc1 mRNA [24].

(9)

sion in the common ice plant, Plant Cell 7 (1995) 1129 – 1142.

[12] Y. Kitagawa, K. Yoshizaki, Water stress-induced chilling tolerance in rice; putative relationship between chilling tolerance and Ca2+ flux, Plant Sci. 137 (1998) 73 – 85.

[13] Y. Koga-Ban, M. Abe, Y. Kitagawa, Alteration in gene expression during cold treatment of rice plants, Plant Cell Physiol. 32 (1991) 901 – 905.

[14] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: a Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

[15] G. Gilliland, S. Perrin, K. Blanchard, F. Bunn, Analysis of cytokine mRNA and DNA: Detection and quantita-tion by competitive polymerase chain reacquantita-tion, Proc. Natl. Acad. Sci. USA 87 (1990) 2725 – 2729.

[16] K.S. Reece, D. McElroy, R. Wu, Genomic nucleotide sequence of four rice (Oryza sati6a) actin genes, Plant Mol. Biol. 14 (1990) 621 – 624.

[17] R. Zhang, K.A. Logee, A.S. Verkman, Expression of mRNA coding for kidney and red cell water channels in

Xenopus oocytes, J. Biol. Chem. 265 (1990) 15375 – 15378.

[18] R. Zhang, A.S. Verkman, Water and urea permeability properties of Xenopus oocytes: expression of mRNA from toad urinary bladder, Am. J. Physiol. 260 (1991) C26 – C34.

[19] G.M. Preston, J.S. Jung, W.B. Guggino, P. Agre, The

mercury-sensitive residue at cysteine 189 in the CHIP28 water channel, J. Biol. Chem. 268 (1993) 17 – 20. [20] I. Johansson, M. Karisson, V.K. Shukla, M.J.

Chrispeels, C. Larsson, P. Kjellbom, Water transport activity of the plasma membrane aquaporin PM28A is regulated by phosphorylation, Plant Cell 10 (1998) 451 – 459.

[21] G. Calamita, K. Bettina, M. Bonhivers, R. Bishai, E. Bermer, P. Agre, Regulation of theEscherichia coliwater channel geneaqp2, Proc. Natl. Acad. Sci. USA 95 (1998) 3613 – 3627.

[22] S. Yamada, T. Komori, P.N. Myers, S. Kuwata, T. Kubo, H. Imaseki, Expression of plasma membrane wa-ter channel genes under wawa-ter stress inNicotiana excel

-sior, Plant Cell Physiol. 38 (1997) 1226 – 1231.

[23] K. Fushimi, S. Uchida, Y. Hara, Y. Hirata, F. Marumo, S. Sasaki, Cloning and expression of apical membrane water channel of rat kidney collecting tubule, Nature 361 (1993) 549 – 552.

[24] S.M. Mulders, G.M. Preston, P.M.T. Deen, W.B. Gugg-ino, C.H. van Os, P. Agre, Water channel properties of major intrinsic protein of lens, J. Biol. Chem. 270 (1995) 9010 – 9016.

[25] J.B. Mariaux, C. Bockel, F. Salamini, D. Bartels, Desic-cation- and abscisic acid-responsive genes encoding ma-jor intrinsic proteins (MiPs) from the resurrection plant

Craterostigma plantagineum, Plant Mol. Biol. 38 (1998) 1089 – 1099.

Gambar

Fig. 1. (Continued)
Fig. 1. Aquaporin gene comparison and the structure of RWC1 polypeptide product. (a) Comparison of the amino acid sequenceof RWC1 and those of other aquaporins
Fig. 2. Northern blot analysis of rice aquaporin-mRNA, stress response and tissue specificity
Fig. 3. Determination of rwc1 mRNA expressed under chill-ing stress by competitive PCR
+2

Referensi

Dokumen terkait

ASTRA INTERNATIONAL. TBK

Sebuah skripsi yang diajukan untuk memenuhi salah satu syarat memperoleh gelar Sarjana Pendidikan program studi Ilmu Pendidikan Agama Islam

bahwa untuk memperbaiki struktur permodalan Perusahaan Perseroan (Persero) PT Angkasa Pura I, perlu melakukan penambahan penyertaan modal Negara Republik Indonesia

On behalf of the German Federal Ministry for Economic Cooperation and Development (BMZ), GIZ works extensively on corporate social responsibility (CSR) and inclusive business

UNIT LAYANAN PENGADAAN BARANG DAN JASA POKJA PENGADAAN JASA KONSTRUKSI DAN JASA KONSULTANSI. TAHUN

RUU KIP mengharuskan semua badan publik untuk mengumumkan informasi publik secara berkala, paling sedikit enam bulan sekali; mengumumkan secara serta-merta suatu informasi yang

Melalui riset dan pengembangan (Research & Development), Coca-Cola terus berinovasi untuk menciptakan produk, kemasan, strategi pemasaran, serta perlengkapan

oksigen terlarut merupakan salah satu parameter kimia air yang berperan pada kehidupan biota perairan dan yang paling sering diukur dalam observasi pengaruh