DAFTAR PUSTAKA. Brodie BB Potato. Di dalam : Barker KR, Gary AP., Gary L, editor. Plant and Nematode Interactions. Wisconsins Soc. Agronomy.

(1)

38

DAFTAR PUSTAKA

[BPS] Badan Pusat Statistik. 2008. Data Produksi Kentang di Indonesia tahun

2004, 2005, 2006 dan 2007. http://www.bps.go.id/sector/agri/horti/index.html. [20 Desember 2008].

Brodie BB. 1984. Nematode parasites of potato. Di dalam: Nickle WR, editor. Plants and Insect Nematodes. Narcell Dekker Inc, New York. Hlm 167-212. Brodie BB. 1998. Potato. Di dalam : Barker KR, Gary AP., Gary L, editor. Plant

and Nematode Interactions. Wisconsins Soc. Agronomy.

Been TH & Schomaker CH. 2000. Development and Evaluation of sampling methods for fields with infestation foci of Potato Cyst Nematodes (Globodera rostochiensis & G. pallida). Am.Phyt. Soc. Vol 9 No. 6 : 647 - 656

CAB International. 2007. Crop Protection Compendium (CD-ROM) Wallingford, UK : CABI. 2 CD-ROM dengan penuntun didalamnya.

Clark, Hennesy. 1984. Movement of Globodera rostochiensis (Wollenweber) juveniles stimulates by potato –root exudates. Nematologia 30 : 206-212. Cunha D, Jose MM,Conceicao, et al. 2008. Assesment of the use of high

performance capillary gel electrophoresis to differentiate isolates of Globodera spp. http://literature.lalisio.com/ingenta-info.html. [29 Nopember 2008] .

Devine KJ, Jones PW. 2000. Response of Globodera rostochiensis to exogenously applied hatching factors in soil. Ann App Biol. 137: 21-29. Direktorat Perlindungan Tanaman Pangan (DITLIN TP). 1986. Evaluasi Data

Iklim untuk Pertanian Tanaman Pangan.

Direktorat Perlindungan Tanaman Hortikultura. 2007. Pengenalan dan Pengendalian NSK (Nematoda Siste Kuning). http://ditlin.hortikultura.deptan.go.id . [29 Nopember 2008].

Dropkin VH. 1999. Pengantar Nematology Tumbuhan. Supratoyo, penerjemah. Yogyakarta : Universitas Gajah Mada Press. Terjemahan dari : Introduction to Plant Nematology.

Evans K. 1993. New Approaches for potato cyst nematode management. Nematropica. 23 : 221 – 231.

Evans K & Turner JT. 1998. The origins, Global Distribution and Biology of Potato Cyst Nematodes (Globodera rostochiensis (Woll.) and Globodera pallida stone). Pp. 7-26 Di dalam : Potato Cyst Nematodes-Biology, Distribution and Control. Marks RJ, Brodie BB, editor. Publ. CAB International.

(2)

39 Fenwick DW. 1949. Methodes for the recovery and counting of cyst of

Heterodera schachtii from soil. J Helminthol 18 : 155 – 172.

Fleming CC, Turner SJ, Powers TO, et al. 1998. Diagnostic of cyst nematodes : use of the polymerase chain reaction to determine species and estimate populations levels. Aspect of Applied Biology. 52: 375-382.

Fullaondo A, Salazar A, Barrena E, Ritter E. 1999. Comparison of moleculer patterns and virulence behaviour of potato cyst nematodes. Fund and App Nematol 20:425-434.

Hadisoeganda A, Widjaja W. 2006. Nematoda Sista Kentang; Kerugian, Deteksi, Biografi, dan Pengendalian Nematoda Terpadu. Balai Penelitian Tanaman Sayuran. Pusat Penelitian dan Pengembangan Hortikultura. Badan Penelitian dan Pengembangan Pertanian.

Huang SP, Pereira AC. 1994. Influence of inoculum density, host, and low temperature period on delayed hatch of Meloidogyne javanica eggs. J Nematology 26: 72-75.

Ibrahim SK, Minnis ST, Barker ADP, at al. 2001. Evaluation of PCR, IEF and Elisa Techniques for the detection and identification of potato cyst nematodes from field soil samples in England and Wales. Pest Manag. Sci. 57:1068-1074

Jogaite V, Cepulyte R, Stanelis A, Buda V. 2007. Monitoring of Globodera spp. In Lithuania using diagnostic morphometric analysys and Polimerase Chain Reaction. Acta Zoologica Lituanica 17 : 184187.

Jones MGK, Northcote DH. 1972. Nematode-induced syncytium-a multinucleate transfer cell. J Cell Scie 10 : 789 m: 809.

Joosten A. 1991. Geniteu rslijst voor Aardappelrassen. Postbus 32, 6700 AA. Kenyon D. 2000. Determination of relative proporsions of Globodera spesies in

mixed populations of PCNs using PCR product melting peak analisis. National institut of Agricultural Botani. (Abstract).

Lisnawita. 2007. Identifikasi, kajian Biologi dan ketahanan tanaman terhadap Nematoda Sista Kentang (Globodera spp.) Indonesia [disertasi]. Sekolah Pascasarjana Institut Pertanian bogor.

Luc M, Sikora RA, Bridge J. 2005. Plant Parasitic Nematodes in Subtropical and Tropical Agriculture. CABI Publishing. Wallingford UK.

Luc M, Sikora RA, Bridge J. 1995. Nematoda Parasitik Tumbuhan di Pertanian Subtropik dan Tropik. Gadjah Mada University Press.

Marks RJ and Brodie BB. 1998. Potato Cyst Nematodes Biology, Distribution and Control. Department of Plant Pathology Cornell University Ithaca, New York, USA.

(3)

40 Marshal JW. 1993. Detecting the presence and distribution of Globodera

rostochiensis and Globodera pallida mixed populations in New Zealand. New Zealand Journal of Crop & Horticultural Science. Vol. 21 : 219-223. Mulder JG, Van der Wal AF. 1997. Relationship between potato cyst nematodes

and their principal host. I. A literature review. Pot Res 40 : 317-326.

Mulder A. 1988. Temperature response of Globodera rostochiensis and Globodera pallida (abstract). Nematologic 34 : 281.

Mulholland U, Carde L. O’Donnel KL., Fleming CC and Powers. 1996. Use of the polymerase chain reaction to discriminate potato cyst nematode at spesies level. In : Marshall G (ed) Proceeding of Diagnostics in Crop Production Symposium (pp 247.252). British Crop Production Symposium (pp 247-252). British Crop Production Council, Fernham, UK.

Pylypenko LA, Uehara T, Phillips MS, Sigareva DD, Blok VC. 2005. Identification of Globodera rostochiensis and Globodera pallida in the Ukraine by PCR. European Journal of Plant Pathology (2005) III : 39-46. Rawsthorne D, Brodie BB. 1986. Relationship between root growth of potato,

root diffusate production, and hatching of Globodera rostochiensis. J. Nematology 18 : 379 : 384.

Reid A, Pickup J. 2005. Mplecular characterization of a morphologically unusual potato cyst nematode. Bulletin OEPP/EPPO Bulletin 35 : 69-72.Scottish Agricultural Science Agency.

Rukmana R. 1997. Kentang, Budidaya dan Pasca Panen. Kanisius. Yogyakarta.

Rustiani UM. 2006. Ilmu Penyakit benih. Bahan Ajar Pelatihan Teknis Dasar Calon POPT Ahli. Balai Uji Standar karantina Tumbuhan. Jakarta

Said Amiri, Sergei A Subbotin and Maurice Moens, 2002. Identification of the beet cyst nematode Heterodera schactii by PCR. European Journal of Plant Pathology 108 : 497-506. Kluwer Academic Publishers.

Sedlak P, Melounova M, Skupinova S, Veji P, Domkarova. 2004. Study of European and Czech populations of potato cyst nematodes (Globodera rostochiensis ang G. pallida) by RAPD method. Plant Soil Environ. 50 (2) : 70-74.

Southey, JF. 1974. Methods for detection of potato cyst nematodes. EPPO Bulletin 4 : 463 – 473.

Spears, Joseph F. 1968. The Golden Nematode Handbook. Survey, Laboratory, Control, and Quarantine Procedurs. Washington, D.C. USDA. Agriculture Research Services.

Stone AR. 1973. Heterodera rostochiensis. C.I.H. Description of Plant Parasitic Nematodes. Set 2, No. 16. London : William Clowes & Sons.

(4)

41 Stevenson WR, Rosemary L, Gary DF, Weingartner DP. 2001. Compendium of

Potato Disease. Second Edition. The American Phytopathological Society. Subbotin SA, Deliang P, Maurice M. 2001. A rapid method for the identification

of the Soybean cyst nematode Heterodera glycines using duplex PCR. Nematology 3(4) : 365-371.

Supramana. 2004. Distribusi Nematoda Sista Kentang (Globodera spp.) di dunia dan perkembangan keberadaannya di Indonesia. Lokakarya Inovasi Teknologi : Bogor, 13 – 15 Desember 2004. Diselenggarakan oleh Pusat Penelitian & Pengembangan Hortikultura.

Suwardiwijaya E. Raga IN, Lanya H. 2007. Penyebaran vertikal dan horisontal sista Globodera sp., di sentra penanaman kentang di Pegunungan Dieng, Propinsi Jawa Tengah. Makalah pada Pertemuan Koordinasi Kelompok Kerja Penanganan NSK. Bandung, 2-4 Mei 2007.

Thiery M, Mugniery D. 1996. Interspesific rDNA restriction fragment length polymorphism in Globodera species, parasites of Solanaceaous plants. Fund and App Nem 19 : 471-479.

Trifonova Z. 1999. Temperature influence on the potato cyst nematode (Globodera rostochiensis Woll. 1923) development. Bulg. J. Sci., 5: 863 – 866.

Wharton DA, Goodall G, Marshall. 2002. Freezing rate affects the survival of a short-term freezing stress in Panagrolaimus davidi, an Antartic nematode that survives intracellular freezing, Cryoletters 23 : 5-10. Di dalam : Randy Gaugler, Al Bilgrami 2004. Nematode Behaviour.

Wulandari I. 2006. Polymerase Chain reaction (PCR). Bahan Ajar Pelatihan Teknis Dasar Calon POPT Ahli. Balai Uji Standar karantina Tumbuhan. Jakarta

(5)

42

(6)

43 Lampiran 1 Lokasi Pengambilan sampel sista NSK

Kelas Desa Ketinggian

tempat

A. <1250 m - Ds. Wanayasa, Kec. Wanayasa, Kab. Banjarnegara 1188 m B. 1250 - 1500 m - Ds. Buntu Kec. Kejajar Kab. Wonosobo 1275 m - Ds. Wanaraja Kec. Wanayasa Kab. Banjarnegara 1355 m - Ds. Kejajar Kec. Kejajar Kab. Wonosobo 1363 m - Ds Legok Sayem, Kec. Wanayasa Kab. Banjarnegara 1370 m - Dsn. Kejajar ds. Kejajar Kec. Kejajar Kab. Wonosobo 1435 m - Ds. Serang Kec. Kejajar Kab. Wonosobo 1460 m - Dsn. Kejajar ds. Kejajar Kec. Kejajar Kab. Wonosobo 1474 m

C. 1500 - 1750 m - Ds. Grogol Kec. Pejawaran Kab. Banjarnegara 1570 m - Dsn. Sidareja Ds. Batur Kec. Batur Kab. Banjarnegara 1597 m

- Dsn. Tembok Ds. Grogol Kec. Pejawaran Banjarnegara 1606 m - Dsn. Kalianget Ds. Batur Kec. Batur Kab. Banjarnegara 1626 m - Dsn. Bujang sari Ds. Batur Kec. Batur Kab. Banjarnegara 1651 m

D. 1750 - 2000 m - Ds. Bakal Kec. Batur Kab. Banjarnegara 1787 m - Ds. Bakal Kec. Batur Kab. Banjarnegara 1830 m - Ds. Bakal Kec Batur Kab. Banjarnegara 1895 m - Dsn. Buntu Kec. Batur Kab. Banjarnegara 1952 m - Ds. Patak Banteng Kec. Kejajar Kab. Wonosobo 1974 m

- Dsn. Buntu Ds. Bakal Kec. Batur 1980 m

- Ds. Karang tengah Kec. Batur Kab. Banjarnegara 1994 m

E. > 2000 m - Dsn. Karang Tengah Ds. Karang Tengah Kec. Batur 2037 m

Kab. Banjarnegara

- Dsn. Pawuhan Ds. Karang Tengah Kec. Batur 2053 m

Kab. Banjarnegara

- Dsn. Telaga Merdada Ds. Karang Tengah Kec. Batur 2055 m

Kab. Banjarnegara

- Ds. Dieng Kulon Kec. Batur Kab. Banjarnegara 2090 m - Ds. Karang sari Kec. Batur Kab. Banjarnegara 2089 m - Dsn. Pawuhan Ds. Karang Tengah Kec. Batur 2123 m

(7)

44 Lampiran 2 Daerah sebar NSK di Dataran Tinggi Dieng Jawa Tengah

No Kelas Desa Ketinggian Posisi Suhu Umur Jumlah

Urut tempat Geografi Tanah Tanaman Sista

A

1 <1250 m Ds. Wanayasa 1188 m S: 07° 14' 13,6" 24°C 60 hari 0 Kec. Wanayasa E: 109° 45' 29,3" 14.00wib

Kab. Wonosobo

2 B Ds. Buntu 1275 m S: 07° 16' 26,2" 21°C 90 hari 0

1250 - 1500 m Kec. Kejajar E: 109° 56' 48,3" 8.30wib Kab. Wonosobo

3 Ds. Wanaraja 1355 m S: 07° 13' 26,2" 22°C 90 hari 0

Kec. Wanayasa E: 109° 45' 48,9" 15.30wib Kab. Banjarnegara

4 Ds. Kejajar 1363 m S: 07° 16' 76,8" 20°C 50 hari 0

Kec. Kejajar E: 109° 56' 37,1" Kab. Wonosobo

5 Ds. Legok Sayem 1370 m S: 07° 12' 46,5" 25°C 90 hari 0 Kec. Wanayasa E: 109° 46' 36,6" 15.00wib

Kab. Banjarnegara 6 Dsn. Kejajar 1435 m S: 07° 15' 27,7" 25°C 70 hari ds. Kejajar E: 109° 57' 18,8" 13.30wib Kec. Kejajar Kab. Wonosobo 7 Ds. Serang 1460 m S: 07° 14' 39,7" 23°C 70 hari 94 Kec. Kejajar E: 109° 57' 04,8" Kab. Wonosobo 8 Dsn. Kejajar 1474 m S: 07° 15' 02,6" 22°C 55 hari 0 ds. Kejajar E: 109° 57' 17,0" Kec. Kejajar Kab. Wonosobo 9 C Ds. Grogol (B) 1570 m S: 07° 12' 22,8" 19°C 60 hari 0 1500 - 1750 m Kec. Pejawaran E: 109° 48' 08,7" Kab. Banjarnegara 10 Dsn. Sidareja 1597 m S: 07° 12' 56,0" 21-23°C 60 hari 190 Ds. Batur E: 109° 49' 35,8" 10.00wib Kec. Batur Kab. Banjarnegara 11 Dsn. Tembok 1606 m S: 07° 12' 13,7" 24°C 55 hari Ds. Grogol E: 109° 48' 20,9" 13.00wib Kec. Pejawaran Kab. Banjarnegara

(8)

45

12 Dsn. Kalianget 1626 m S: 07° 12' 11,0" 20°C 70 hari 547 Ds. Batur E: 109° 48' 38,7" 11.00wib

Kec. Batur Kab. Banjarnegara

13 Dsn. Bujang sari 1651 m S: 07° 12' 19,2" 20°C 80 hari 327 Ds. Batur E: 109° 49' 21,6" 16.30wib

14 D Ds. Bakal 1787 m S: 07° 13' 22,4" 18.5°C 80 hari 287 1750 - 2000 m Kec. Batur E: 109° 52' 16,6" 10.30wib

Kab. Banjarnegara

15 Ds. Bakal 1830 m S: 07° 13' 09,0" 20°C 70 hari 167

Kec. Batur E: 109° 52' 45,6" 17.00wib Kab. Banjarnegara

16 Ds. Bakal 1895 m S: 07° 13' 08,1" 21°C 100 hari 397

Kec Batur E: 109° 52' 43,8" 12.30wib Kab. Banjarnegara

17 Dsn. Buntu 1952 m S: 07° 13' 00,8" 18°C 90 hari 289

Ds. Bakal E: 109° 53' 07,3" 17.15wib Kec. Batur

Kab. Banjarnegara

18 Ds. Patak Banteng 1974 m S: 07° 12' 63,0" 18°C 50 hari 413 Kec. Kejajar E: 109° 55' 47,7" 10.00wib

Kab. Wonosobo

19 Dsn. Buntu 1980 m S: 07° 12' 52,9" 21°C 80 hari 258

Ds. Bakal E: 109° 53' 12,3" 09.30wib Kec. Batur

20 Ds. Karang tengah 1994 m S: 07° 12' 39,1" 17°C 75 hari 1007 Kec. Batur E: 109° 53' 05,7" 17.45wib

Kab. Banjarnegara

21 E. Dsn. Karang Tengah 2037 m S: 07° 12' 17,2" 19°C 80 hari 571 > 2000 m Ds. Karang Tengah E: 109° 53' 13,0" 10.15wib

22 Dsn. Pawuhan 2053 m S: 07° 11' 56,8" 20°C 90 hari 636

Ds. Karang Tengah E: 109° 53' 59,3" 10.45wib Kec. Batur

Kab. Banjarnegara

23 Dsn. Telaga Merdada 2055 m S: 07° 12' 14,3" 16°C 60 hari 718 Ds. Karang Tengah E: 109° 53' 25,3" 18.00wib

(9)

46

24 Ds. Dieng Kulon 2090 m S: 07° 12' 10,4" 22°C 50 hari 57 Kec. Batur E: 109° 54' 21,2" 09.50wib

Kab. Banjarnegara

25 Ds. Karang sari 2089 m S: 07° 12' 47,6" 23°C 85 hari 157 Kec. Batur E: 109° 54' 36,7" 11.45wib

Kab. Banjarnegara

26 Dsn. Pawuhan 2123 m S: 07° 12' 15,3" 21°C 100 hari 102 Ds. Karang Tengah E: 109° 53' 59,3" 11.20wib bera

(10)

47 Lampiran 3 Data prevalensi NSK di Dataran Tinggi Dieng Jawa Tengah

No Kelas Prevalensi NSK A B C D E < 1250 m 1250 – 1500 m 1500 – 1750 m 1750 -2000 m > 2000 m 0 14,3 % 60 % 100 % 100 %

(11)

48 Lampiran 4 Hasil analisis regresi : Jumlah sista NSK versus ketinggian tempat

Persamaan regresi

Jumlah Sista = - 686 + 0.543 Ketinggian Predictor Coef SE Coef T P

Constant -685.9 292.1 -2.35 0.027

Ketinggian 0.5433 0.1671 3.25 0.003

(12)

49 Lampiran 5 Hasil analisis regresi : Jumlah sista NSK versus suhu tanah

Persamaan regresi :

Jumlah Sista = 1996 - 83.8 Suhu Tanah Predictor Coef SE Coef T P Constant 1996 388.1 5.14 0.000 Ketinggian -83.79 18.52 -4.52 0.000 S = 218.727 R-Sq = 46.0% R-Sq(adj) = 43.8%

(13)

50 Lampiran 6 Identifikasi morfologi sista NSK

Ketinggian

tempat Sampel

Jarak anus Diameter Rasio ridge

Hasil - Fenestra (µm) fenestra (µm) Granek 1250 - 1500 m B1 81.07 21.91 3.70 27 G. rostochiensis B2 40.9 20.85 1.96 11 G. pallida B3 52.01 26.14 1.99 16 G. rostochiensis B4 64.16 25.31 2.53 13 G. rostochiensis B5 60.24 19.1 3.15 19 G. rostochiensis B6 58.1 17.63 3.30 12 G. pallida B7 59.65 16.43 3.63 17 G. rostochiensis B8 53.86 19.74 2.73 11 G. pallida B9 57.7 19.67 2.93 15 G. rostochiensis B10 63.37 22.22 2.85 16 G. rostochiensis 1500 - 1750 m C1 51.49 33.24 1.55 17 G. rostochiensis C2 39.47 23.22 1.70 9 G. pallida C3 42 31.19 1.35 11 G. pallida C4 46 20.3 2.27 11 G. pallida C5 43.1 21.8 1.98 13 G. rostochiensis C6 39.34 14.96 2.63 9 G. pallida C7 69.05 18.7 3.69 17 G. rostochiensis C8 42.37 19.94 2.12 11 G. pallida C9 74.39 33.83 2.20 21 G. rostochiensis C10 55.76 23.93 2.33 17 G. rostochiensis 1750 - 2000 m D1 64.49 21.27 3.03 19 G. rostochiensis D2 50.21 18.3 2.74 17 G. rostochiensis D3 60.55 23.54 2.57 12 G. pallida D4 71.96 25.6 2.81 16 G. rostochiensis D5 39.77 22.39 1.78 8 G. pallida D6 43.2 23.15 1.87 9 G. pallida D7 53.7 28 1.92 12 G. pallida D8 44.07 32.73 1.35 8 G. pallida D9 72.09 33.58 2.15 17 G. rostochiensis D10 41.69 22.79 1.83 11 G. pallida > 2000 m E1 42.26 13.15 3.21 14 G. pallida E2 64.47 21.2 3.04 11 G. pallida E3 68.34 20.99 3.26 17 G. rostochiensis E4 51.76 15.29 3.39 13 G. pallida E5 60.01 19.99 3.00 11 G. pallida E6 66.31 23.11 2.87 15 G. rostochiensis E7 88.95 29.72 2.99 24 G. rostochiensis E8 64.84 37.44 1.73 14 G. rostochiensis E9 32.61 19.3 1.69 11 G. pallida E10 90.3 30.87 2.93 17 G. rostochiensis

(14)

51 Lampiran 5 Hasil pengamatan sidik pantat sista NSK

G. rostochiensis G. pallida G. rostochiensis G. pallida G. rostochiensis G. pallida

(15)

52 >BKT_9_F GCGCTGCTGCGCTTGTGTGCTCGTCCGTGGCCGTGATGAGACGACGTGTTAGGACCCGTG CCTGGCATTGGCACGTGGTTTAAGACTTGATGAGGGGCCCGCAGGCACCGCCAGCTTTTT CCCATTTTTATTTATTTTTTATGCNATTCNATTGCTAAAATATTCTAGTCTTATCGGNGG ATCACTCNGCTCGNGGATCGATGAAGATCGCTTAGCCTTCTGCAANNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAAANNNNNNNNNCCTTTTTTNNCCNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN >BKT_10_R GCNCGGGNCGCTGCGCCNACGGNAGAAGCACGCCCACAGGGCACCCTAACGGCTGTGCTG GCGTCTGTGCGTCGTTGAGCGGTTGTTGCGCCTANGGCAGATATGCTAACATGGAGTGTA GCTGCTACTCCATGTTGTACGTGCCGTACCTTGCGGCATGTCTGCGCTTGTGTGCTACGT CCGTGGCCGTGATGAGACGACGTGTTAGGACCCGTGCCTGGCATTGGCACGTGGTTTAAG ACTTGATGAGTGCCCGCAGGCACCGCCAGCTTTTTCCCATTTTTATTTATTTTTTATGCA ATTCGATTGCTAAAATATTCTAGTCTTATCGGTGGATCACTCGGCTCGTGGATCGATGAA GATCGCTTAGCCTTCTGCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN >BKT_9F_5.8S TGATCCGANCCGAGTGATCCCCGATAAGACTAGAATATTTTAGCAATCGAATTGCATAAA AAATAAATAAAAATGGGAAAAAGCTGGCGGTGCCTGCGGGCACTCATCAAGTCTTAAACC ACGTGCCAATGCCAGGCACGGGTCCTAACACGTCGTCTCATCNCGGCCACGGACGTAGCA CACAAGCGCANACNTGCCGCAAGGTACGGGCACGTACAACAAANNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

(16)

53 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN >BKT_10R_5.8S TNTCCGNCCGAGTGACCCCNATAAGACTAGAATATTTTAGCAATCGAATTGCATAAAAAA TAAATAAAAATGGGAAAAAGCTGGCGGTGCCTGCGGGCACTCATCAAGTCTTAAACCACG TGCCAATGCCAGGCACGGGTCCTAACACGTCGTCTCATCACGGCCACGGACGTAGCACAC AAGCGCANACATGCCGCAAGGTACGGCACGTACAACATGGAGTAGCAGCTACACTCCATG TTAGCATATCTGCGCAAGGNGCAACAACCGCTCAACGACGCACAGACGCCAGCACAGCCG TTAGGGTGCCCTGTGGGCGTGCTTCCTCCGTTGGCGCAGCGACCCGACGACAACAGCAAT GGTTCGAGTCACCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNN

(17)

54

Lampiran

Survei NSK

Hubungan antara ketinggian tempat dengan jumlah sista

0 200 400 600 800 1000 1200 0 500 1000 1500 2000 2500 Ketinggian Tempat (m) Ju m lah S ist a

(18)

55

Berdasarkan plot di atas, dugaan hubungan antara ketinggian dengan jumlah sista:

Regression Analysis: Jumlah Sista versus Ketinggian

The regression equation is

Jumlah Sista = - 686 + 0.543 Ketinggian

Predictor Coef SE Coef T P Constant -685.9 292.1 -2.35 0.027 Ketinggian 0.5433 0.1671 3.25 0.003 S = 248.054 R-Sq = 30.6% R-Sq(adj) = 27.7% Analysis of Variance Source DF SS MS F P Regression 1 650746 650746 10.58 0.003 Residual Error 24 1476736 61531 Total 25 2127482

Hubungan Suhu tanah dengan jumlah sista

0 200 400 600 800 1000 1200 0 5 10 15 20 25 30 Suhu Tanah (C) Ju m lah S is ta

Berdasarkan plot, dugaan persamaan regresi:

Regression Analysis: Jumlah Sista versus Suhu Tanah

Jumlah Sista = 1996 - 83.8 Suhu Tanah

Predictor Coef SE Coef T P Constant 1996.0 388.1 5.14 0.000 Suhu Tanah -83.79 18.52 -4.52 0.000 S = 218.727 R-Sq = 46.0% R-Sq(adj) = 43.8% Analysis of Variance Source DF SS MS F P Regression 1 979291 979291 20.47 0.000

(19)

56

Residual Error 24 1148191 47841 Total 25 2127482

Hubungan jumlah nanaman dengan jumlah sista

0 200 400 600 800 1000 1200 0 2000 4000 6000 8000 10000 12000 14000 16000 18000 Jumlah tanaman Ju m lah S ista

Dugaan persamaan regresi

Regression Analysis: Jumlah Sista versus Jumlah tanaman

Jumlah Sista = 243 + 0.0007 Jumlah tanaman

Predictor Coef SE Coef T P Constant 243.5 156.4 1.56 0.133 Jumlah tanaman 0.00073 0.01439 0.05 0.960 S = 297.717 R-Sq = 0.0% R-Sq(adj) = 0.0% Analysis of Variance Source DF SS MS F P Regression 1 228 228 0.00 0.960 Residual Error 24 2127254 88636 Total 25 2127482

Hubungan jumlah sista dengan ketinggian dan suhu tanah

Regression Analysis: Jumlah Sista versus Ketinggian, Suhu Tanah

Jumlah Sista = 1172 + 0.265 Ketinggian - 66.2 Suhu Tanah

Predictor Coef SE Coef T P Constant 1171.5 644.5 1.82 0.082 Ketinggian 0.2654 0.1683 1.58 0.129

(20)

57 Suhu Tanah -66.18 21.16 -3.13 0.005 S = 212.257 R-Sq = 51.3% R-Sq(adj) = 47.1% Analysis of Variance Source DF SS MS F P Regression 2 1091267 545634 12.11 0.000 Residual Error 23 1036215 45053 Total 25 2127482 Source DF Seq SS Ketinggian 1 650746 Suhu Tanah 1 440521 Korelasi:

Correlations: Ketinggian, Jumlah Sista, Suhu Tanah, Jumlah tanaman

Ketinggian Jumlah Sista Suhu Tanah Jumlah Sista 0.553 0.003 Suhu Tanah -0.528 -0.678 0.006 0.000 Jumlah tanam -0.028 0.010 0.120 0.891 0.960 0.559

Cell Contents: Pearson correlation P-Value

(21)

58