• Tidak ada hasil yang ditemukan

Directory UMM :Data Elmu:jurnal:B:Brain Research:Vol886.Issue1-2.Nov2000:

N/A
N/A
Protected

Academic year: 2017

Membagikan "Directory UMM :Data Elmu:jurnal:B:Brain Research:Vol886.Issue1-2.Nov2000:"

Copied!
9
0
0

Teks penuh

(1)

www.elsevier.com / locate / bres

Interactive report

A comparison of the expression and properties of Apaf-1 and

1

Apaf-1L

*

D. Wade Walke, James I. Morgan

Department of Developmental Neurobiology, St. Jude Children’s Research Hospital, 332 N. Lauderdale St., Memphis, TN 38105-2794, USA

Accepted 12 September 2000

Abstract

Apaf-1 is a mammalian homolog of CED-4 that regulates cell death by participating in a ternary complex with cytochrome c, and procaspase-9. In the case of CED-4, two splice variants exist. The smaller (CED-4S) is proapoptotic while the larger (CED-4L) contains a short in-frame insert and is anti-apoptotic. We cloned a murine variant of apaf-1, termed apaf-1L, which contains an eleven amino acid insert similar to a recently described human apaf-1L clone. apaf-1 and apaf-1L have similar distributions in adult and fetal tissues, although apaf-1L transcripts are more abundant. Apaf-1L, undergoes homomerization and heteromerization with Apaf-1 in yeast. Apaf-1L also binds to caspase-9 and a dominant-negative isoform of caspase-9. Unlike CED-4, neither Apaf-1 variant was lethal in yeast. However, both Apaf-1 and Apaf-1L elicit cell death when cotransfected with caspase-9 into 293 EBNA cells. Although Apaf-1L was more potent than Apaf-1, their biological properties were qualitatively similar.  2000 Elsevier Science B.V. All rights reserved.

Theme: Development and regeneration

Topic: Neuronal death

Keywords: RNase protection; Two-hybrid; Dimerization; Cell death; Procaspase-9

1. Introduction ly of proteases, termed caspases [32,46]. Subsequent gene knockout studies have shown that caspases also play a Programmed cell death (PCD) is essential for the normal critical role in PCD in mammals [4,23,24,45]. Caspases development and maintenance of multicellular organisms, normally exist as inactive zymogens (procaspases) that are with perturbation of PCD leading to myriad developmental proteolytically activated by apoptotic stimuli [8,32]. In C. and pathological sequelae [19,29]. Unlike necrotic death elegans, the activation of CED-3 is mediated by CED-4 that accompanies trauma, PCD is a highly regulated [6,18,42]. A similar pathway is present in mammals in process [19]. Moreover, the molecular mechanisms under- which Apaf-1, a protein with structural homology to CED-pinning PCD have been conserved throughout the evolu- 4, exists in a complex with procaspase-9. Following tion of metazoans [4,12–14]. application of an apoptotic challenge, cytochrome c is CED-3, CED-4, and CED-9 are core components of released from the mitochondria and associates with Apaf-1 PCD that were first discovered in the nematode, Caenor- to cause the formation of a complex with procaspase-9. In habditis elegans. In C elegans, ced-3 and ced-4 are the presence of dATP, procaspase-9 is then cleaved within necessary for death while their activity is suppressed by the complex and in turn processes procaspase-3 to active the product of ced-9 [9,34,43]. CED-3 is an aspartyl- caspase-3. The latter elicits cell death [3,26,27,31,36,48]. directed cysteine protease that is structurally similar to the Two splice variants of CED-4 have been reported [35]. mammalian interleukin-1-b-converting enzyme and a fami- A shorter form, termed CED-4S is proapoptotic while a longer variant, CED-4L opposes death [35]. These distinct properties and size difference are due to the presence of a

1

Published on the World Wide Web on 5 October 2000.

24 amino acid insertion in CED-4L. It is believed that *Corresponding author. Tel.: 11-901-495-2258; fax:

11-901-495-CED-4L blocks death by binding to CED-4S and inhibiting 3143.

E-mail address: [email protected] (J.I. Morgan). its pro-death activity [5]. Therefore, we set out to isolate

(2)

Apaf-1 variants that might be functional homologs of pressed proteins corresponding to residues 1–563 (not

CED-4L. including the 11 residue insert) of the published protein

We report here the identification and characterization of sequence (PID: g2330015, Accession[: AF013263). Se-a murine vSe-ariSe-ant of ApSe-af-1, termed ApSe-af-1L in Se-accordSe-ance quences for the Not I and Xho I restriction sites were also with the nomenclature of the homologous transcript that included in these primers for convenience in cloning. was recently identified in human cells [11,15,48]. This The human apaf-1, apaf-1L, apaf-1 59, and apaf-1L 59

variant contains an eleven amino acid insert that is similar, clones were also subcloned into the yeast expression but not identical to the insert found in human Apaf-1L. vectors pSD10 or Y.lexA [40] for yeast growth assays and Ribonuclease protection analysis in mouse tissues revealed two-hybrid analysis. The same clones were also subcloned that apaf-1 and apaf-1L have similar, ubiquitous patterns into the mammalian expression vector pCMV5 [2,7] for of expression. However, apaf-1L transcripts were con- mammalian cell transfection assays. The cDNAs for sistently more abundant than those of apaf-1. The relative human procaspase-9, procaspase-9 S /b, and procaspase-3 position of the insert in Apaf-1L is different to the location were also obtained from Hela cell cDNA by PCR and of the insert in CED-4L. However, the two inserts show subcloned into the above vectors. All clones were con-some sequence similarity at the amino acid level. We show firmed by DNA sequence analysis.

that, functionally, Apaf-1L is able to form homodimers and Yeast expression vectors containing Bax, 3, CED-heterodimers with Apaf-1. Apaf-1L, like Apaf-1, also 4, and CED-9 are described previously [40]. The cDNA interacts with caspase-9 and a naturally occurring domi- for CED-4 was also cloned into the pCMV5 expression nant-negative form of caspase-9. Mammalian cell transfec- vector for use in mammalian cell transfection studies. tion experiments show that both Apaf-1 and Apaf-1L

potentiate cell death when co-expressed with caspase-9. 2.2. RNase protection assays Although Apaf-1L may be somewhat more potent than

Apaf-1 there are no fundamental differences in the binding RNase protection assays were performed using RNase or biological properties of the two variants. T2 as previously described [30]. RNA was isolated from various adult and embryonic mouse tissues using the RNeasy kit (Qiagen). An apaf-1L antisense riboprobe was

2. Materials and methods generated using the 257 bp PCR product described above, which was subcloned into the vector BSSK(1) 2.1. Cloning and plasmid constructs (Stratagene). This riboprobe, which contains 200 nt up-stream of the insert, the 33 nt insert, and 25 nt downup-stream In order to detect variants of apaf-1, a scanning PCR of the insert, gives an expected protected fragment of 257 strategy was employed. Oligonucleotide primers were nt for the apaf-1L mRNA species, while protected frag-synthesized corresponding to various regions of the pub- ments of 200 nt and 25 nt are expected for apaf-1 lished apaf-1 mRNA sequence. PCR was performed using transcript. Since the 25 nt protected fragment is difficult to mouse spleen cDNA with Turbo Pfu polymerase detect in this assay, we used the 200 nt fragment as the (Stratagene) according to the manufacturer’s recommended marker for the apaf-1 transcript.

protocol. PCR products were analyzed on an agarose gel

and compared to a DNA ladder. PCR products which 2.3. Cell culture and transfection varied from their predicted size were cloned and sequenced

(3)

was added to the cell medium 18 h after transfection at a as apaf-1L, in accord with the nomenclature of the human concentration of 0.4 mg / ml and cells were placed back in homolog. The amino acid sequences of mouse and human the incubator for 30 min. Cells expressing GFP (green) or Apaf-1L inserts are compared in Fig. 1B. Analysis of these taking up propidium iodide (red) were observed using amino acid sequences revealed no obvious structural or florescence microscopy. The number of green (living) and functional motifs. However, the insert present in CED-4L red (dead) cells were counted in four different fields per has some sequence similarity to a region in Apaf-1L that

well. contains the insert (Fig. 1B). This region of similarity in

both mouse and human Apaf-1L encompasses the insert 2.4. Yeast growth and two hybrid assays and 5 additional amino acids flanking its carboxyl terminus side that are common to Apaf-1 and Apaf-1L (Fig. 1B). Yeast growth and two hybrid assays were performed as Despite this similarity, the insert in Apaf-1L is located in a previously described [25,39]. different part of the molecule compared to the insert in CED-4L. In CED-4L, the insert is located between the Walker’s A- and B-box consensus sequences for nucleotide

3. Results binding sites [41], while the insert in Apaf-1L lies

N-terminal to both domains (Fig. 1A). Nevertheless, the 3.1. Isolation of Apaf-1L insert in Apaf-1L is still in a region of the protein that retains homology with CED-4 (stippled region, Fig. 1A). To identify apaf-1 variants that might be functional

homologs of ced-4L, a scanning PCR strategy was em- 3.2. Tissue distribution and developmental expression of ployed. Using this approach on mouse spleen RNA, we apaf-1L

identified a variant of apaf-1 that contained an inframe

insert of 33 base pairs located between nucleotide 878 and The size difference between apaf-1 and apaf-1L tran-879 of the published murine sequence (Accession scripts was too small to resolve by Northern blotting. [AF064071). The nucleotide sequence (TGGCAAGGAC- Using RT-PCR, both transcripts were detected in many ACAGATGGTGGAATAACTTCATT) codes for the 11 tissues and several tumor cell lines (data not shown). These amino acid insert shown in Fig. 1. We refer to this variant assays suggested that apaf-1L, rather than apaf-1, was the

(4)

Fig. 2. RNase protection analysis of Apaf-1 /Apaf-1L expression in various adult and fetal tissues. Total RNA (20mg) from the indicated fetal (embryonic days E14.5 and E16.5) and adult tissues was probed with the Apaf-1 /Apaf-L riboprobe. The Apaf-1L (upper) and Apaf-1 (lower) protected fragments are indicated. An unidentified band is seen between the Apaf-1L and Apaf-1 bands. Olf. bulb, olfactory bulb; Hipp, hippocampus; Cont, control yeast RNA.

major transcript in vivo and that both variants could be Apaf-1L might not bind procaspase-9. Such a property expressed in the same cell. To obtain quantitative data, could cause Apaf-1L to act in a dominant-negative manner RNase protection analysis (RPA) was performed (Fig. 2). over Apaf-1 in Apaf-1–Apaf-1L heteromeric complexes. To distinguish between apaf-1 and apaf-1L transcripts, an Alternatively, Apaf-1L might not bind procaspase-9 but antisense riboprobe composed of 200 nt upstream of the rather some other caspase, thereby placing it in a death insert, the 33 nt insert, and 25 nt downstream of the insert signaling pathway that is distinct from Apaf-1. To test was used. In adult mouse tissues, both apaf-1 and apaf-1L these hypotheses, the Apaf-1 variants were coexpressed were expressed in various regions of the brain as well as with procaspase-9 in yeast. Both Apaf-1 and Apaf-1L peripheral organs. The highest level of expression of both bound avidly to procaspase-9 with indistinguishable af-variants was seen in the spleen and lung (Fig. 2). In all finities (Table 1). Thus, procaspase-9 is a binding partner adult tissues analyzed, apaf-1L transcripts were more for both Apaf-1 variants. Whether additional caspases bind abundant than apaf-1 transcripts. A study of fetal mouse selectively to one or other of the variants is unknown, tissues revealed that both apaf-1 and apaf-1L were ex- although no interactions were detected between Apaf-1 / pressed at somewhat higher levels than in the adult (Fig. Apaf-1L and either procaspase-3 or the C. elegans caspase, 2). Again, apaf-1L transcripts were more abundant than CED-3 (Table 1). In addition, neither Apaf-1 variant those for apaf-1. Thus, at the mRNA level apaf-1L is the bound to Bax nor did they bind to CED-4, their homolog predominant form of the death regulating molecule. This in C. elegans (Table 1).

made it important to compare the biological properties of A dominant-negative isoform of procaspase-9, termed Apaf-1L with those of Apaf-1. caspase-9 S or caspase-9 b has been identified that also

Table 1 3.3. Apaf-1L can form homomers and heteromers with

Apaf-1 and Apaf-1L homo- and heteromeric interactions in the yeast

Apaf-1 and procaspase-9 a

two-hybrid system

LexA-fusion VP16-fusion proteins Apaf-1 mediates cell death by participating in a ternary

proteins

complex with procaspase-9 and cytochrome c VP16 Apaf-1 Apaf-1L

[3,26,27,31,36,48]. Since it is possible to detect these

Apaf-1 2 111 111

interactions using the yeast two-hybrid assay [40] the Apaf-1L 2 11 11

binding properties of Apaf-1L were examined in yeast. Procaspase-9 2 111 111 Both Apaf-1 and Apaf-1L underwent homomeric bind- Procaspase-9S / b 2 111 111

Procaspase-3 2 2 2

ing in the yeast two-hybrid assay (Table 1). In addition,

Bax 2 2 2

Apaf-1L bound to Apaf-1 (Table 1), indicating the

po-CED-3 2 2 2

tential for heteromeric complexes containing both variants. CED-4 2 2 2

Truncated versions of the Apaf-1 variants (Apaf-1 59 and a

Yeast S260 were cotransformed with plasmids containing the indicated Apaf-1L 59) which contain only the N-terminal domain

(5)

Table 2

interacts with Apaf-1 [33,37]. If Apaf-1L failed to bind a Apaf-1 and Apaf-1L do not kill yeast caspase-9 S / b then it would not be subject to inhibition by

Plasmids GI

this isoform of the enzyme and might exhibit increased

activity. Therefore, we determined whether caspase-9 S / b Y. LexA 1 pSD10 9.6

bound to Apaf-1L in the yeast two-hybrid assay. As shown Y. LexA 1 Bax 1.0

Apaf-1 59 1 Y.LexA 11.4

in Table 1, caspase-9 S / b bound avidly to both Apaf-1 and

Apaf-1L 59 1 Y.LexA 13.4

1L. Thus, the binding properties of 1 and

Apaf-Apaf-1 59 1 Caspase-9 21.0

1L are indistinguishable in the yeast two-hybrid system. Apaf-1L 59 1 Caspase-9 20.4

LexA-Caspase-9 1 pSD10 19.9

3.4. Neither Apaf-1 nor Apaf-1L kill yeast Y. LexA 1 VP16-Caspase-3 12.0

LexA-Caspase-9 1 VP16-Caspase-3 1.0

LexA-Caspase-9S / b 1 VP16-Caspase-3 15.0 Cell death regulatory genes from mammals and C.

a

Yeast S260 were cotransformed with the indicated genes contained in elegans function when expressed in Saccharomyces

cere-either the Y.LexA vector (left-hand column) or the pSD10 vector (middle visiae [21,40]. Furthermore, yeast expressing these genes

column). Constructs were either fused to LexA or VP16 (as indicated by exhibit many of the morphological and biochemical the appropriate prefix) or left unfused. Controls consisted of cotrans-characteristics of apoptosis [20]. Based upon these findings formation with empty vectors. Growth of the transformants, measured as a quantitative yeast cell death assay was developed [39]. In the Growth Index (GI) [39] (right-hand column), was assessed by OD660 at 22 h after switching to galactose. A growth index of 1 indicates no this system, pro- or antiapoptotic genes were expressed

growth. When Bax-expressing yeast are switched back to glucose they do under the control of an inducible GAL10 promoter [10].

not grow and are morphologically dead by electron microscopy. The data Subsequently, death was assayed by measuring the growth shown are representative of three independent experiments performed in index (GI) 22 h after induction of the respective gene(s). A duplicate.

growth index of 1 indicates no growth (i.e. cells are dead) while higher GI values are indicative of a lack of killing or

rescue from killing by an antiapoptotic gene. [26,31,32,36,48]. In S. cerevisiae, expression of CED-4, the C. elegans homolog of Apaf-1 is lethal procaspase-3 is non-toxic while expression of its active when expressed in yeast [20,40]. Moreover, CED-4 lethali- subunits results in marked lethality [21,40]. Thus, yeast do ty is caspase-independent in yeast but is blocked by co- not possess the machinery to activate procaspase-3. How-expression of CED-9, a homolog of Bcl-2 [40]. Therefore, ever, co-expression in yeast of procaspase-9 with we assessed whether either Apaf-1 variant shared this procaspase-3 resulted in marked killing (Table 2). This caspase-independent killing activity in yeast. In mam- suggested that procaspase-9 (but not procaspase-3) under-malian cells, Apaf-1 requires cytochrome c to elicit death goes autoactivation in yeast, a phenomenon also observed [3,26,27,31,36,47]. As cytochrome c from yeast and in vitro [27,36,38]. Activated caspase-9 is then supposed to mammals have significant sequence divergence, it is convert procaspase-3 to the biologically active form of the questionable whether yeast cytochrome c is able to substi- enzyme which in turn executes the cell. This interaction tute. In fact, in a cell-free system, cytochrome c from S. was specific since coexpression of caspase-9 S / b with cerevisiae was unable to initiate apoptosis [22]. A trun- procaspase-3 did not result in lethality (Table 2).

cated version of Apaf-1 which contains only the N-termi- These results establish that neither Apaf-1 variant nal domain is reported to be cytochrome c independent exhibits the caspase-independent proapoptotic activity of [1,16,17,36]. Therefore, the truncated versions of the Apaf- CED-4 in yeast. It is possible that Apaf-1 can promote the 1 variants (Apaf-1 59 and Apaf-1L 59) were used. Neither sequential activation of procaspase-9 and procaspase-3. Apaf-1 59 nor Apaf-1L 59 killed yeast (Table 2). Further- However, as procaspase-9 spontaneously activates in yeast, more, the combination of Apaf-1 59 and Apaf-1L 59 was this proposition cannot be readily tested.

not lethal (Table 2). Thus, neither Apaf-1 59nor Apaf-1L

59 homomers are lethal in yeast and neither are Apaf-1– 3.5. Apaf-1L is proapoptotic in mammalian cells Apaf-1L heteromers.

In mammals, Apaf-1 functions by activating procaspase- Although the two variants of Apaf-1 cannot be dis-9 [3,26,31,36,48]. Therefore, we examined whether tinguished on the basis of their binding properties or procaspase-9 either alone or in combination with the Apaf- apoptotic activities in yeast, it is possible that their 1 variants influenced cell killing in yeast. Neither biological activities are different in mammalian cells. To procaspase-9 alone nor caspase-9 S / b alone exhibited determine the effects of apaf-1L and apaf-1 on cell death toxicity (Table 2). Finally, neither truncated Apaf-1 variant in mammals, a cell culture transfection system was used. potentiated killing in the presence of procaspase-9 (Table In an initial experimental series, survival was monitored by

2). detection of lacZ which was expressed from a plasmid that

The procaspase-9 /Apaf-1 / cytochrome c complex medi- was cotransfected with the genes under investigation into ates the proteolytic activation of procaspase-3 which is 293 EBNA cells. Even at high concentrations of apaf-1 59

(6)

lacZ (Fig. 3). Comparison of apaf-1 and control transfect- Thereafter, the cells rapidly lost their GFP leaving a cell ed cultures indicated that both Apaf-1 variants had only remnant with a condensed positive nucleus. Thus PI-weak proapoptotic activity (compare panels A and B in GFP doubled labeled cells were very rare. Furthermore, the Fig. 3 and see Table 3). In contrast, transfection of PI-positive cells frequently detached from the substratum procaspase-9 into 293 EBNA cells along with the lacZ and could no longer be scored in the assay. Cells transfect-reporter, led to a dose-dependent decrease in b-galacto- ed with apaf-1L 59 and procaspase-9 died and detached sidase-positive cells (Fig. 3A). Since Apaf-1 is thought to from the plate with more rapid onset than parallel cultures act via procaspase-9 [17,26,28,31,36,48], these data sug- transfected with apaf-1 59 and procaspase-9 (data not gested that the zymogen protease was rate-limiting in 293 shown). Thus, although the death rate amongst remaining EBNA cells. By titrating the level of procaspase-9 DNA cells was about the same at the time of counting, more this provided an opportunity to study the relative potencies cells had been lost in the Apaf-1L condition. Nevertheless, of Apaf-1 and Apaf-1L. Each of the apaf-1 variants was both Apaf-1 variants had a procaspase-9-dependent cotransfected with a lacZ reporter and a level of proapoptotic activity.

procaspase-9 DNA (0.1mg) that caused minimal death on its own (Fig. 3). Both Apaf-1 59 and Apaf-1L 59

syner-gized with procaspase-9 to elicit marked cell killing as 4. Discussion

evidenced by an almost total loss of lacZ-positive cells in

the culture (Fig. 3). However, Apaf-1L 59was consistently CED-4 in C. elegans and Apaf-1 in mammals are more active than Apaf-1 59 at the same concentration of structurally related proteins that control cell elimination

DNA (Fig. 3B). through regulation of caspase activity

A second series of experiments quantified and character- [17,18,26,31,36,44,47,48]. CED-4 exists in two splice ized Apaf-1-mediated cell death. In this assay, cell death variants that have diametrically opposed actions on cell was detected by propidium iodide (PI) staining and death; CED-4S promotes death while CED-4L, which transfection / survival monitored by expression of green contains a 24 amino acid insert, is anti-apoptotic [5,35]. We fluorescent protein (GFP). In contrast to the previous have identified a murine splice variant of Apaf-1, termed experiments, this assay detected dying (PI-positive) as well Apaf-1L, which contains an 11 amino acid insert. A as surviving (GFP-positive) cells. Moreover, unlike the similar insert was recently identified in human Apaf-1

b-galactosidase method, this assay was performed in living [11,15,48]. It is shown here that both transcripts are cells, thereby permitting the monitoring of cell death in the ubiquitously expressed in the mouse, with higher levels of same culture over time. mRNA being present in embryonic tissues. However, apaf-Expression of either apaf-1 59or apaf-1L 59resulted in 1L mRNA is more abundant than apaf-1 mRNA, making small increases in the number of PI-positive / GFP-positive it crucial to determine whether the properties of Apaf-1L cells when compared to vector-transfected control cultures were different to those of Apaf-1. Despite the fact that the (Table 3). However, due to the variability of the assay insert in Apaf-1L, as well as a part of its flanking sequence these differences did not reach statistical significance. A have similarity to the insert in CED-4L, Apaf-1L has low dose of procaspase-9 DNA also elicited a small similar proapoptotic properties to Apaf-1 (Table 3) [15]. increase (P,0.05) in the ratio of PI / GFP staining (Table The only distinction between the proteins is that Apaf-1L 3). However, co-expression of procaspase-9 with either appears to be more potent than Apaf-1 in triggering apaf-1 59 or apaf-1L 59 resulted in highly significant caspase-9-dependent killing in mammalian cells. Zou et al. increases in PI labeling as a percentage of GFP-positive also noted that Apaf-1L had a more stable caspase-3 cells (Table 3). In contrast, the dominant-negative variant activating activity in vitro [48].

(7)
(8)

Table 3

a

Comparison of Apaf-1L and Apaf-1 lethality

Transfected DNA GFP-positive P.I.-positive % P.I to GFP

cells cells positive

pCMV5 control 93630 4.060.82 4.18

Procaspase-9 82614 7.863.0 8.68

Apaf-1 59 115627 7.863.9 6.31

Apaf-1 591Procasp-9 112625 29.9622 20.10*

Apaf-1 591Procasp-9 S / b 94637 8.565.1 8.31

Apaf-1L 59 86631 7.063.4 7.57

Apaf-1L 591Procasp-9 42617 11.165.7 21.04*

Apaf-1L 591Procasp-9 S / b 84626 3.862.1 4.26

a

Two-hundred and ninety three EBNA cells were cotransfected with pCMV5 vectors containing the indicated DNA and pEGFP. Cells were stained with propidium iodide 18 h after transfection. Transfected cells expressing green fluorescence protein (GFP) and dying cells taking up propidium iodide (P.I.) were counted under fluorescence microscopy. The numbers reported are the average cell counts from 4 separate fields per well over three independent experiments with the standard error indicated. An asterisk (*) indicates that these results were significantly different from control transfection with P,0.05.

by the WD-40 repeat region, J. Biol. Chem. 274 (1999) 20855– that both are likely to be sensitive to inhibition by this

20860. dominant-negative caspase.

[2] S. Andersson, D.L. Davis, H. Dahlback, H. Jornvall, D.W. Russell, Both Ced-4 and Apaf-1 undergo homo-oligomerization Cloning, structure, and expression of the mitochondrial cytochrome [1,17,31,36,40,44,48] and mutations that abrogate dimeri- P-450 sterol 26-hydroxylase, a bile acid biosynthetic enzyme, J. zation result in loss of activity [17,20,40,44]. It is not Biol. Chem. 264 (1989) 8222–8229.

[3] K. Cain, D.G. Brown, C. Langlais, G.M. Cohen, Caspase activation known whether 4L homodimerizes or binds to

CED-involves the formation of the aposome, a large (approximately 700 4. However, Apaf-1L undergoes homo-oligomerization and

kDa) caspase-activating complex, J. Biol. Chem. 274 (1999) 22686– heteromerization with Apaf-1. Thus, Apaf-1 and Apaf-1L 22692.

have similar binding characteristics. Moreover, as the two [4] F. Cecconi, G. Alvarez-Bolado, B.I. Meyer, K.A. Roth, P. Gruss, variants can be expressed in the same cell, this implies that Apaf1 (CED-4 homolog) regulates programmed cell death in

mammalian development, Cell 94 (1998) 727–737. Apaf-1–Apaf-1L heteromeric complexes may exist under

[5] D. Chaudhary, K. O’Rourke, A.M. Chinnaiyan, V.M. Dixit, The physiological circumstances.

death inhibitory molecules CED-9 and CED-4L use a common The present results highlight a number of similarities mechanism to inhibit the CED-3 death protease, J. Biol. Chem. 273 and distinctions between CED-4 and Apaf-1. On the one (1998) 17708–17712.

hand, both CED-4S and Apaf-1 form complexes with the [6] A.M. Chinnaiyan, D. Chaudhary, K. O’Rourke, E.V. Koonin, V.M. Dixit, Role of CED-4 in the activation of CED-3, Nature 388 (1997) caspases, CED-3 and procaspase-9, respectively. Both

728–729, [letter] [see comments]. complexes are proapoptotic and splice variants of both

[7] R.G. Chubet, B.L. Brizzard, Vectors for expression and secretion of molecules exist. On the other hand, CED-4 has an addi- FLAG epitope-tagged proteins in mammalian cells, Biotechniques tional caspase-independent mechanism of killing in yeast 20 (1996) 136–141.

that is not shared by either Apaf-1 or Apaf-1L. In addition, [8] V. Cryns, J. Yuan, Proteases to die for, Genes Dev. 12 (1998) 1551–1570, [published erratum appears in Genes Dev 1999 Feb while CED-4L is anti-apoptotic, Apaf-1L is proapoptotic.

1;13(3):371]. It is presumed that the insert in Apaf-1L provides for a

[9] H.M. Ellis, H.R. Horvitz, Genetic control of programmed cell death more subtle influence on function, as suggested by its gain in the nematode C. elegans, Cell 44 (1986) 817–829.

of potency. Future studies will be directed at establishing [10] L. Guarente, R.R. Yocum, P. Gifford, A GAL10-CYC1 hybrid yeast the functional significance of this insert in the predominant promoter identifies the GAL4 regulatory region as an upstream site,

Proc. Natl. Acad. Sci. USA 79 (1982) 7410–7414. Apaf-1 species in vivo.

[11] C. Hahn, B. Hirsch, D. Jahnke, H. Durkop, H. Stein, Three new types of Apaf-1 in mammalian cells, Biochem. Biophys. Res. Commun. 261 (1999) 746–749.

[12] M.O. Hengartner, Programmed cell death in invertebrates, Curr.

Acknowledgements

Opin. Genet. Dev. 6 (1996) 34–38.

[13] M.O. Hengartner, H.R. Horvitz, Programmed cell death in Caenor-This work was supported in part by NIH Cancer Center habditis elegans, Curr. Opin. Genet. Dev. 4 (1994) 581–586.

[14] C. Hensey, J. Gautier, Programmed cell death during Xenopus Support CORE Grant P30 CA21765 and by the American

development: a spatio-temporal analysis, Dev. Biol. 203 (1998) Lebanese Syrian Associated Charities (ALSAC).

36–48.

[15] Y. Hu, M.A. Benedict, L. Ding, G. Nunez, Role of cytochrome c and dATP/ATP hydrolysis in Apaf-1-mediated caspase-9 activation and apoptosis, Embo J. 18 (1999) 3586–3595.

References [16] Y. Hu, M.A. Benedict, D. Wu, N. Inohara, G. Nunez, Bcl-XL

interacts with Apaf-1 and inhibits Apaf-1-dependent caspase-9 [1] C. Adrain, E.A. Slee, M.T. Harte, S.J. Martin, Regulation of activation, Proc. Natl. Acad. Sci. USA 95 (1998) 4386–4391.

(9)

regulates Apaf-1 self-association and procaspase-9 activation, J. [33] D.W. Seol, T.R. Billiar, A caspase-9 variant missing the catalytic site Biol. Chem. 273 (1998) 33489–33494. is an endogenous inhibitor of apoptosis, J. Biol. Chem. 274 (1999) [18] M. Irmler, K. Hofmann, D. Vaux, J. Tschopp, Direct physical 2072–2076.

interaction between the Caenorhabditis elegans ‘death proteins’ [34] S. Seshagiri, L.K. Miller, Caenorhabditis elegans CED-4 stimulates CED-3 and CED-4, FEBS Lett. 406 (1997) 189–190. CED-3 processing and CED-3-induced apoptosis, Curr. Biol. 7 [19] M.D. Jacobson, M. Weil, M.C. Raff, Programmed cell death in (1997) 455–460.

animal development, Cell 88 (1997) 347–354. [35] S. Shaham, H.R. Horvitz, An alternatively spliced C. elegans ced-4 [20] C. James, S. Gschmeissner, A. Fraser, G.I. Evan, CED-4 induces RNA encodes a novel cell death inhibitor, Cell 86 (1996) 201–208. chromatin condensation in Schizosaccharomyces pombe and is [36] S.M. Srinivasula, M. Ahmad, T. Fernandes-Alnemri, E.S. Alnemri, inhibited by direct physical association with CED-9, Curr. Biol. 7 Autoactivation of procaspase-9 by Apaf-1-mediated oligomerization,

(1997) 246–252. Mol. Cell. 1 (1998) 949–957.

[21] J.J. Kang, M.D. Schaber, S.M. Srinivasula, E.S. Alnemri, G. [37] S.M. Srinivasula, M. Ahmad, Y. Guo, Y. Zhan, Y. Lazebnik, T. Litwack, D.J. Hall, M.A. Bjornsti, Cascades of mammalian caspase Fernandes-Alnemri, E.S. Alnemri, Identification of an endogenous activation in the yeast Saccharomyces cerevisiae, J. Biol. Chem. 274 dominant-negative short isoform of caspase-9 that can regulate

(1999) 3189–3198. apoptosis, Cancer Res. 59 (1999) 999–1002.

[22] R.M. Kluck, S.J. Martin, B.M. Hoffman, J.S. Zhou, D.R. Green, [38] H.R. Stennicke, Q.L. Deveraux, E.W. Humke, J.C. Reed, V.M. Dixit, D.D. Newmeyer, Cytochrome c activation of CPP32-like proteolysis G.S. Salvesen, Caspase-9 can be activated without proteolytic plays a critical role in a Xenopus cell-free apoptosis system, Embo processing, J. Biol. Chem. 274 (1999) 8359–8362.

J. 16 (1997) 4639–4649. [39] W. Tao, C. Kurschner, J.I. Morgan, Modulation of cell death in yeast [23] K. Kuida, T.F. Haydar, C.Y. Kuan, Y. Gu, C. Taya, H. Karasuyama, by the Bcl-2 family of proteins, J. Biol. Chem. 272 (1997) 15547–

M.S. Su, P. Rakic, R.A. Flavell, Reduced apoptosis and cytochrome 15552.

c-mediated caspase activation in mice lacking caspase 9, Cell 94 [40] W. Tao, D.W. Walke, J.I. Morgan, Oligomerized Ced-4 kills budding (1998) 325–337. yeast through a caspase-independent mechanism, Biochem. Biophys. [24] K. Kuida, T.S. Zheng, S. Na, C. Kuan, D. Yang, H. Karasuyama, P. Res. Commun. 260 (1999) 799–805.

Rakic, R.A. Flavell, Decreased apoptosis in the brain and premature [41] J.E. Walker, M. Saraste, M.J. Runswick, N.J. Gay, Distantly related lethality in CPP32-deficient mice, Nature 384 (1996) 368–372. sequences in the alpha- and beta-subunits of ATP synthase, myosin, [25] C. Kurschner, J.I. Morgan, Analysis of interaction sites in homo- kinases and other ATP-requiring enzymes and a common nucleotide

and heteromeric complexes containing Bcl-2 family members and binding fold, Embo J. 1 (1982) 945–951.

the cellular prion protein, Brain Res. Mol. Brain Res. 37 (1996) [42] D. Wu, H.D. Wallen, N. Inohara, G. Nunez, Interaction and regula-249–258. tion of the Caenorhabditis elegans death protease CED-3 by CED-4 [26] P. Li, D. Nijhawan, I. Budihardjo, S.M. Srinivasula, M. Ahmad, E.S. and CED-9, J. Biol. Chem. 272 (1997) 21449–21454.

Alnemri, X. Wang, Cytochrome c and dATP-dependent formation of [43] D. Wu, H.D. Wallen, G. Nunez, Interaction and regulation of Apaf-1 / caspase-9 complex initiates an apoptotic protease cascade, subcellular localization of CED-4 by CED-9, Science 275 (1997)

Cell 91 (1997) 479–489. 1126–1129, [see comments].

[27] G. Pan, E.W. Humke, V.M. Dixit, Activation of caspases triggered by [44] X. Yang, H.Y. Chang, D. Baltimore, Essential role of CED-4 cytochrome c in vitro, FEBS Lett. 426 (1998) 151–154, [published oligomerization in CED-3 activation and apoptosis, Science 281 erratum appears in FEBS Lett 1998 May 29;428(3):309]. (1998) 1355–1357, [see comments].

[28] H. Qin, S.M. Srinivasula, G. Wu, T. Fernandes-Alnemri, E.S. [45] H. Yoshida, Y.Y. Kong, R. Yoshida, A.J. Elia, A. Hakem, R. Hakem, Alnemri, Y. Shi, Structural basis of procaspase-9 recruitment by the J.M. Penninger, T.W. Mak, Apaf1 is required for mitochondrial apoptotic protease-activating factor 1, Nature 399 (1999) 549–557. pathways of apoptosis and brain development, Cell 94 (1998) [29] C.M. Rudin, C.B. Thompson, Apoptosis and disease: regulation and 739–750.

clinical relevance of programmed cell death, Annu. Rev. Med. 48 [46] J. Yuan, S. Shaham, S. Ledoux, H.M. Ellis, H.R. Horvitz, The C. (1997) 267–281. elegans cell death gene ced-3 encodes a protein similar to

mam-[30] C.F. Saccomanno, M. Bordonaro, J.S. Chen, J.L. Nordstrom, A malian interleukin-1 beta-converting enzyme, Cell 75 (1993) 641– faster ribonuclease protection assay, Biotechniques 13 (1992) 846– 652.

850. [47] H. Zou, W.J. Henzel, X. Liu, A. Lutschg, X. Wang, Apaf-1, a human [31] A. Saleh, S.M. Srinivasula, S. Acharya, R. Fishel, E.S. Alnemri, protein homologous to C. elegans CED-4, participates in cyto-Cytochrome c and dATP-mediated oligomerization of Apaf-1 is a chrome c-dependent activation of caspase-3, Cell 90 (1997) 405– prerequisite for procaspase-9 activation, J. Biol. Chem. 274 (1999) 413, [see comments].

17941–17945. [48] H. Zou, Y. Li, X. Liu, X. Wang, An APAF-1.cytochrome c

Gambar

Fig. 1. Homology between Apaf-1L and CED-4L inserts. (A) Schematic diagram of murine Apaf-1L and Cindicated below their insertion point
Fig. 2. RNase protection analysis of Apaf-1/Apaf-1L expression in various adult and fetal tissues
Table 2Apaf-1 and Apaf-1L do not kill yeast
Fig. 3. Apaf-1 and Apaf-1L synergize with procaspase-9 to induce apoptosis. 293 EBNA cells were cotransfected with pCMV5 vectors containing theindicated genes and a CMVgal reporter
+2

Referensi

Dokumen terkait

In Sections 5±7, the theory will be applied to obtain expressions for Ne for random mating dioecious populations, monoecious populations reproducing partly by sel®ng, and

Policymakers and the public may be misled by spurious test score increases unrelated to any fundamental educational improvement; students may be placed at increased risk of

1B shows the effect of intermittent stimulation on nerve in rats increases the expression of both POMC the expression of POMC mRNA in the contralateral (left) mRNA and b

Conse- The reason for this behavior is that spike trains produced quently, stimuli that are restricted to the receptive field by an integrate-and-fire neuron (and more realistic

Ruda, Primary sensory expression in rat dorsal root ganglion cells and spinal cord after neurons exhibit altered gene expression in a rat model of neuro- peripheral nerve injury

Alzheimer’s disease: a dysfunction of The hippocampal lamella hypothesis Mechanisms of motor learning in the.. the amyloid precursor

New aspects of sterol metabolism in obesity were as follows: low efficiency of cholesterol absorption, reduced ratios to cholesterol of serum and biliary plant sterols and

The unexpected positive response in animals on the low supplement diets, and the small increase in response to higher supplementation, may be explained by the high proportion of