• Tidak ada hasil yang ditemukan

EXPRESSION OF BCL-2 AND CASPASE-3 IN ICR MICE

N/A
N/A
Nguyễn Gia Hào

Academic year: 2023

Membagikan "EXPRESSION OF BCL-2 AND CASPASE-3 IN ICR MICE "

Copied!
98
0
0

Teks penuh

EFFECTS OF POLYVINYL CHLORIDE (PVC) MICROPLASTICS ON BCL-2 AND CASPASE-3 GENE EXPRESSION IN ICR MICE. Therefore, the mRNA expression of genes related to the regulation of apoptosis such as BCL-2 and caspase-3 was used to evaluate the effects of MP PVC in rats.

Table    Page
Table Page

Objectives of Study

Overview of Microplastics

Types and Sources of Microplastics

Route of Human Exposure to Microplastics

Types of MPs that are commonly in commercial use include polyethylene (PE), polystyrene (PS), polyamide (PA), polypropylene (PP), polyester (PES), polyvinyl chloride (PVC), and acrylic (AC) (de Sá et al., 2018). Therefore, the potential risks of toxicity of MPs and impacts on human health have become a global concern.

Plastic Additives as Co-Contaminants in MPs

According to Ašmonaitė et al. 2020), MPs possess strong affinity and adsorption for hydrophobic organic chemical contaminants that can be transported into the organism's body via ingestion and potentially result in harmful effects in the organisms. MPs and the toxic chemicals adhered to it can result in both physical and chemical damage to the organisms after ingestion (Cole et al., 2011).

Polyvinyl Chloride (PVC)

Overview of PVC

Different types of pollutants have been identified on the surface of plastic waste such as persistent organic pollutants (POPs), polycyclic aromatic hydrocarbons (PAHs) and pesticides (Hasan Anik et al., 2021). 9 high rigidity therefore used in building and construction for water pipes, siding and window frames.

Feedstock Chemicals and Additives in PVC Microplastics

In addition, a finding showed that rats exposed to BPA have mitochondrial dysfunction due to increased formation of reactive oxygen species (ROS), decreased mitochondrial membrane permeability and swelling of mitochondria (Kobroob et al., 2018). In addition, the apoptosis regulation-related gene expression was examined by an in vitro study using BPA-treated macrophages revealed decreased BCL-2 mRNA level and increased caspase-3 mRNA level (Huang et al., 2018 ).

Adverse Effects and Toxicity of Microplastics

Oxidative Stress and Cytotoxicity

Previous studies reported that DEHP exposure significantly induces oxidative stress in the liver of mice by excessive ROS production (Zhao et al., 2019). Previous studies done by Geiser et al. 2008) showed that non-membrane-bound MPs can be phagocytosed by macrophages and lead to cellular damage.

Alteration of Metabolism and Energy Balance

Furthermore, negative energy balance may result from exposure of MPs due to increased energy consumption. Research has shown that exposure to MPs increased the food consumption rate of rats due to elevated energy demand (Deng et al., 2017).

Interference of Immune Function

Toxic contaminants incorporated into MPs have the potential risk of causing neurotoxicity associated with neurodegenerative diseases. These findings suggest that exposure to MPs has a potential risk of causing neurotoxicity in humans, which could increase the risk of developing neurodegenerative diseases.

Association of BCL-2 and Caspase-3 in Mediating Apoptosis

Caspase-3 encodes proteins called cysteine-aspartic acid protease that function in the execution phase of apoptotic processes to induce apoptotic cell death (GeneCards Database, 2016b). Smac/DIABLO also inhibits the inhibitors of apoptosis proteins (IAP) activity to further promote apoptosis, which in turn activates procaspase-3 and increases the expression of caspase-3, leading to apoptosis as shown in Figure 2.3 (Zimmermann and Green, 2001; Elmore, 2007). Therefore, executioner caspases such as caspase-3 could not be activated to perform apoptotic cell death.

This suggests that deregulation of apoptosis-related gene expression may interfere with the normal apoptotic processes and possibly increase the risk of cancer formation.

Figure 2.1: Cytogenic location of BCL-2 gene (GeneCards Database, 2016a).
Figure 2.1: Cytogenic location of BCL-2 gene (GeneCards Database, 2016a).

Materials

  • Microplastics
  • Mice
  • Chemicals, Reagents, and Equipment
  • Housing
  • Treatment

In this study, extra virgin olive oil was used as a vehicle to facilitate the suspension of MPs in mice through oral gavage. In addition, extra virgin olive oil is loaded with relatively high amounts of monounsaturated fats and low in polyunsaturated fats. The water treatment group was only used to compare the effect of olive oil in causing any

High-dose treatment was prepared by adding 20 mg of PVC MPs to 8 ml of extra virgin olive oil.

Figure 3.1: Overview of methodology.
Figure 3.1: Overview of methodology.

Mice Dissection and Liver Harvesting

High dose treatment was prepared as a stock solution and the low and medium doses were derived from the stock solution by dilution. Therefore, to prepare an average dosage, 1.2 ml of stock solution was suspended in 4.8 ml of olive oil. Meanwhile, the low dose was prepared by adding 120 µl stock solution to 5.88 ml olive oil.

The treatment volume was given based on the body weight of the mice according to the OECD (2014) guideline, as attached in Appendix E.

RNA Extraction

DEPC Treatment

Approximately 700 µL of the sample mixture was transferred to the RB column and centrifuged at 16,000 x g for 1 minute, and the flow-through was discarded. Next, the flow-through was discarded and the RB column was then put back into the collection tube. Approximately 400 µL of Pre-Wash Buffer was added to the RB Column and centrifuged at 16,000 x g for 30 seconds.

Then the flow-through was poured out and the RB column was placed back in the collection tube.

Quantification of RNA Samples

28 was poured out and the RB column was returned to the collection tube and 600 µL of wash buffer was pipetted into the RB column followed by centrifugation at 16,000 x g for 30 seconds. The dried RB column was then placed in a new and clean 1.5 mL RNase-free microcentrifuge tube and carefully pipetted 50 µL of RNase-free water to the center of the column matrix and left for 3 minutes to ensure that the RNase- free water was fully absorbed by the matrix. The RB column was discarded and the microcentrifuge tube containing the purified RNA was labeled appropriately and stored at -20 °C for further use.

29 the measuring surface and the lid were wiped before being used for the subsequent RNA sample.

Qualification of RNA Samples

The RNA sample with ratio values ​​of 2.0–2.2 was generally considered high RNA purity (Carpinetti et al., 2021). 30 added to the tank until it covered the entire gel to a depth of approx. 1 mm. Before loading the RNA samples into the wells, 1 µL of Novel Juice was mixed with 5 µL of RNA samples on a clean parafilm.

A volume of 2 µL of 1 kb ladder DNA was also mixed with 1 µL of Novel fluid and loaded into the first and last well of the gel.

Complementary DNA (cDNA) Synthesis

Quantification and Qualification of cDNA Samples

The concentration and purity of the synthesized cDNA was assessed as described in Section 3.5.3. A cDNA sample with a ratio value of about 1.8 was considered to have high DNA purity. A ratio value of less than 1.8 may indicate contamination by protein or phenolic residues, while a ratio value greater than 1.8 may indicate RNA contamination in the cDNA samples (DeNovix, 2019). The forward and reverse nucleotide sequences of the three primer pairs are listed in Table 3.3.

Table 3.3: Nucleotide sequence of primers used in qPCR.
Table 3.3: Nucleotide sequence of primers used in qPCR.

Real Time Quantitative PCR

Melting curve analysis was performed to evaluate the efficiency of the PCR reactions, the sensitivity of the primers and the detection of the presence of contaminants. Cq values ​​obtained from the qPCR output were used to quantify relative BCL-2 and caspase-3 gene expression. The Livak method or the double delta Ct method (2-ΔΔCq method) was used in this present study to calculate the folding gene expression of BCL-2 and caspase-3 in housekeeping gene (18S rRNA) normalization.

The relative fold change in gene expression of BCL-2 and caspase-3 was then compared between four treatment groups (control group, low dose, medium dose and high dose treatment groups).

Table 3.5: Stages and conditions for qPCR of BCL-2 and caspase-3.
Table 3.5: Stages and conditions for qPCR of BCL-2 and caspase-3.

Statistical Analysis

The difference (Δ) in the threshold cycle (Cq) between the target and the housekeeping gene was included in the ΔΔCq method of 2-ΔΔCq.

Body Weight Measurement of mice

  • Weight of the Mice Livers
  • Qualification of Extracted RNA Samples
  • Quantification of Extracted RNA Samples
  • Qualification of cDNA Samples
  • Quantification of cDNA Samples
  • Gene Expression Level of BCL-2 in Mice Liver

The mean liver weights of mice among the five treatment groups were calculated and listed in Table 4.3. Compared to the control (olive oil), the liver weight of mice from the three MP treatment groups shows an increase. 43 Table 4.4: Mean concentration and purity of RNA samples extracted from the livers of mice from all five treatment groups.

The gene expression levels of caspase-3 (CASP3) in mouse livers between four treatment groups were also measured and compared.

Figure 4.1: Gross photography of livers from water treatment (A), control (B),  low dose (C), medium dose (D) and high dose (E) group mice
Figure 4.1: Gross photography of livers from water treatment (A), control (B), low dose (C), medium dose (D) and high dose (E) group mice

Body Weight of Mice

52 Not to mention, most findings showed that exposure to high concentrations of MP clearly reduced body weight in marine organisms. According to the previous study done by Li et al. 2021), the feeding and growth of the marine organism called tripneustes gratilla was prevented by MEPs. The findings revealed that ingested microplastics accumulate in the digestive tract thereby clogging the digestive tract.

This led to a decrease in food intake activity and a decrease in energy reserves in the body, which is why the growth of marine organisms was inhibited and thereby caused weight loss.

Effects of PVC MPs in Hepatic System of Mice

PVC MPs Induce Inflammation in Liver

The results revealed that gene expression of BCL-2 was downregulated, whereas caspase-3 was upregulated in rat insulinoma cells treated with DEHP, which showed consistent results obtained in this current study (Li et al., 2021). Inhibition of PI3K/Akt regulatory pathway remarkably reduced the expression level of BCL-2, as BCL-2 anti-apoptotic protein is the downstream molecule of Akt (Trejo-Solís et al., 2018). Previous study reported that DEHP increased the p53 level, which in turn reduced the expression of BCL-2 and thereby increased the release of cytochrome c leading to the activation of downstream caspase-9 and caspase-3 in rat testis tissue (Fu et al . , 2020).

A previous study reported that DEHP exposure altered the expression profile of miRNAs that target mRNAs involved in the PI3K/Akt signaling pathway by reducing miR-19a-3p (Zhang et al., 2019).

Other Factors that Lead to Variation in the Mice Body Weight

Limitations of Study

Recommendation in Future Studies

Last but not least, molecular analysis can be included in the study to determine the epigenetic effects of MPs in the targeted genes. In this study, no significant difference was observed in the body weight changes of all mice among five treatment groups through the 28-day repeated single-dose oral gavage of PVC MPs. A detailed review of potential effects of microplastics and additives of concern on human health.

Investigating the effects of microplastics on aquatic organisms: what do we know and where should we focus our efforts in the future. Bisphenol A-induced oxidative damage in rat liver and heart tissues: the modulatory role of sesame lignans. Prolonged oral intake of microplastics caused inflammation in the liver tissues of C57BL/6J mice through polarization of macrophages and increased infiltration of natural killer cells.

Gambar

Table    Page
Figure 2.1: Cytogenic location of BCL-2 gene (GeneCards Database, 2016a).
Figure  2.2:  Cytogenic  location  of  caspase-3  gene  (GeneCards  Database,  2016b)
Figure 3.1: Overview of methodology.
+7

Referensi

Dokumen terkait

The increase in the average percent positive caspase-3 in the anaerobic physical exercise groups four and 12 weeks indicates that cardiomyocyte apoptosis may play an

The increased caspase 3 expression might be due to reduced intratesticular testosterone in consequence of long term repeated injections of TU+DMPA that caused

In conclusion, this study showed that glutathione administration in a TBI rat model decreased NR2B gene- and caspase-3 protein-expression that lead to the inhibition of brain

Master in Commerce (Research) Specialization Islamic Economics EPPE8394. Doctor of Philosophy (Economics)

flava stem by measuring the expression of caspase-3 in acetaminophen-induced rat’s liver, as well as the serum glutamic oxaloacetic transaminase (SGOT), serum glutamic pyruvic

LIST OF PRIMERS Primer name Sequence 5'->3' Purpose EgPDSgRNA1FP CCTCTAATACGACTCACTATAGGCCATAAAGTTAGCCCTCTTC GTTTAAGAGCTATGC Forward primer contains a T7 promoter underlined,

LIST OF FIGURES AND TABLES Table 1 Seed stocks Table 2 Primers used for PCR amplification of targeted gene regions Table 3 PCR conditions for amplification of targeted gene regions

v CONTENTS List of Tables vi List of Figure vii Foreword viii Preface x Acknowledgements xii Chapter 1 Understanding Cooperatives 1 Chapter 2 Historical Development of