CHAPTER 3
3.2.9 Restriction Enzyme (SacI ;NEB, England) 3.2.10 Distillation water
3.2.11 30 % acrylamide (29:1) (Bio-Rad, USA) 3.2.12 10% Ammonium persulfate (make fresh) 3.2.13 TEMED (Tetramethylethylenediamine) 3.2.14 10x Tris-borate-EDTA buffer (TBE)
3.3 Study population
This study was consisted of 100 children diagnosed with ALL and 200 healthy children with no history of cancer in Thai population. Healthy controls were assessed by normal complete blood counts at the Division of Hematology and Oncology, Department of Pediatric, Faculty of Medicine, Siriraj Hospital, Mahidol University. Patients were classified by risk-based assignment protocol (Smith M, et al.,1996), assessed by complete blood counts, French-American-British morphology, immunophenotype and chromosome abnormalities at the Department of Pediatrics, Faculty of Medicine, Ramathibodi Hospital. This study was ethic approved by the Ethics Committee, Faculty of Medicine Ramathibodi Hospital, Mahidol University.
Peripheral blood was collected in EDTA-containing tubes from patients and healthy controls, and DNA was extracted using salting out method in healthy controls, but DNA from ALL patients were extracted using phenol chloroform method.
3.4 DNA isolation
3.4.1 DNA extraction in healthy control group
Genomic DNA was isolated from 3 ml of peripheral blood by proteinase K digestion and salting-out method. Red blood cells were lysed with 1X Rbc lysis buffer mix 10 minute and incubated at 4◦C for 10 minutes, then centrifuged at 4000 rpm for 10 minutes at 4◦C. Remove supernatant and repeat step again for lysed. The pellet of white blood cells was incubated in 1X nuclei lysis buffer 3 ml, 25 µl of 20 mg/ml proteinase K and 200 µl of 10% sodium dodecyl sulfate (SDS) incubated at 37◦C overnight or incubated at 57◦C at 4 hours. The solution was mixed 15 seconds with
6M NaCl, centrifuged at 4000 rpm for 10 minutes at 4◦C. Use pasteur pipette for remove sample to new centrifuge tube. DNA was precipitated by absolute ethanol and inverting gently. Remove DNA pellet to microtube 1.5 ml and DNA pellet was washed with 1 ml of cold 75% ethanol, centrifuged 13,000 rpm for 10 minutes at 4◦C, the washing step was repeated three times. The pellet was dried by placing the tube upside down on the rack. It shouldn’t take longer than 30 minutes. DNA pellet was then dissolved in sterile water and quantitated by measurement with nano drop spectrophotometer Final preparation was stored at -20◦C. and used as template for polymerase chain reaction. (Miller, et al., 1988)
3.4.2 DNA extraction in patients group
Genomic DNA in patient was isolated from 3 ml of peripheral blood by phenol chloroform method. Transfer the peripheral blood to a 15 ml centrifuge tube.
Red blood cells were lysed with 1X Rbc lysis buffer, mix the contents of the tube until an emulsion form. Incubate at room temperature for 10 minutes, then centrifuge at 4000 rpm at 4◦C for 10 minutes. Carefully remove the supernatant without disturbing the pellet and repeat steps again. Add 4 ml of 1X STE buffer and shake the pellet. The solution were mixed with 20 µl of 20 mg/ml proteinase K and 200 µl of 10% SDS, then incubated at 37 - 50◦C overnight. Add 2 ml of phenol and chloroform-isoamyl alcohol. Mix briefly until an emulsion forms and centrifuge at 4000 rpm for 10 minutes at 4◦C. The aqueous phase (upper) and organic phase (lower) should be well separated. Carefully remove the aqueous layer to a new tube, being careful to avoid the interface. Dump bottom layer into waste container. To remove traces of phenol, add 4 ml of chloroform-isoamyl alcohol and mix briefly, then centrifuge at 4000 rpm at 4◦C for 10 minutes. Use a pasteur pipette to remove the organic phase into waste container. Add 400 µl of 4N NaCl and 10 ml of cold 100% ethanol. Mix solution well and then centrifuge at 4000 rpm or 10 minutes at 4◦C. Decant supernatant carefully without disturbing the pellet. Wash pellet by adding 1 ml of 75% ethanol and mix well. Centrifuge at 4000 rpm for 10 minutes at 4◦C. Carefully decant supernatant.
Repeat step again for washing. Dry the pellet by placing the tube upside down on the rack. It shouldn’t take longer than 30 minutes. Dissolve pellet in the appropriate volume of sterile water and then quantitated by a measurement of nano drop
spectrophotometer. Final preparation was stored at -20 ◦C. and used as template for polymerase chain reaction. (Sambrook, et al., 2001)
3.5 Genotyping of the miR 146a (G>C) polymorphism
The miR146a (G>C) polymorphism was performed by polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) analysis. Genotyping was done using forward primer 5’-CATGGGTTGTGTCAGTGTCAGAGCT-3’ and reverse primer 5’- TGCCTTCTGTCTCCAGTCTT CCAA-3’ as described previously.
(Yue, et al., 2011) DNA was amplified in a 25 µl reaction mixture, containing 100 ng of template DNA, 20 µM with 0.5 µl for each one of the forward and reverse primer, 5 µl of 10X buffer, 2.5 µl of 5X Q-solution, 1 µl with 10mM of each dNTP mix, 0.5 µl of 250 U Hotstar taq DNA polymerase (Qiagen, USA) and distilled water 14 µl.
Thermal cycling was performed in a PCR thermal cycle (Biomatra,). The PCR cycling conditions were the initial denaturation of 95◦ C for 15 minutes followed by 35 cycles of 94◦ C for 30 seconds, 64◦ C for 40 seconds, and 72◦ C for 45 seconds, with a final elongation at 72◦ C for 10 minutes. The PCR products were found to be 147 bp in length by electrophoresis on 2% agarose gel, stained with 0.5 µg/ml ethidium bromide and then visualized using the gel documentation.
3.6 Polymerase chain reaction-restriction fragment length polymorphisms (PCR- RFLP) for miR 146a (G>C) polymorphism
For RFLP analysis, PCR products were digested with SacI , consisting of 10 µl PCR products, 1 µl of enzyme SacI (NEB,England), 2 µl of 10X buffer and
distilled water 15 µl and incubated at 37◦ C for overnight.
3.7 Polyacrylamide gel electrophoresis
The product sizes were verified on 10% polyacrylamide gel electrophoresis (add 3.75 ml for 30% acrylamide, 167 µl for 10% APS, 1.25 ml for 10xTBE, 9.8 ml for distillation water and 20 µl for TEMED), stained with 0.5 µg/ml ethidium bromide
and then visualized using the gel documentation. The product presented 3 different patterns : a single 147 bp fragment for the GG genotype; two fragments of 122 and 25 bp for the CC genotype ; and three fragments of 147, 122 and 25 bp for the GC genotype, respectively.
3.8 Quality control procedures
The reagents for PCR were carefully aliquoted to avoid PCR contamination.
A negative control (no DNA template) was added in each assay to monitor PCR contamination.
3.9 Statistical analysis
Comparisons between the genotype distribution between ALL cases and normal control group including the association study between miR 146a genotypes and ALL susceptibility were analyzed by Chi-square test. Moreover, the association between the demographic including clinico-pathological data and the distribution of the miR 146a genotypes in ALL patients were calculated by Chi-square test. SPSS version 17.0 program (SPSS Inc., Chicago, USA) was used for statistical analysis.
Crude odds ratios (OR) and 95% confidence intervals (CI) were also calculated. P values less that 0.05 were considered statistically significance.