ANALISIS GEN PENYANDI HEMAGLUTININ VIRUS HIGHLY PATHOGENIC AVIAN INFLUENZA SUBTIPE H5N1 ISOLAT UNGGAS AIR

Teks penuh

(1)

SUBTIPE H5N1 ISOLAT UNGGAS AIR

ABSTRACT

Avian influenza viruses (AIV) subtype H5N1 isolated from waterfowls in

West Java pose the known characteristic of highly pathogenic strains, with

polybasic amino acid sequence of cleavage site QRERRRKKR and

QRESRRKKR. This research aimed to analyze the important domains of

hemagglutinin (HA) gene of those isolates. Fragment of HA gene was amplified

using RT-PCR method with specifically-designed primer pairs and sequenced

using dideoxy termination method with ABI automatic sequencer (Applied

Biosystems). Multiple alignment of nucleotide and deduced amino acid

sequences were analyzed using ClustalW of MEGA-3.1 program. Some of

biological domains of HA, i.e. antigenic sites, receptor binding pocket, and

glycosylation sites of the isolates were polymorphic. The viruses also pose

conserved glutamine (Q) and glisin (G) residues at the known receptor binding

site, at the position 222 and 224 respectively. All findings clearly show that

waterfowl might act as evolution site of the virus, while it preserves the avian

receptor specificity.

Key words: antigenic sites, glycosylation sites, receptor binding pocket,

AIV H5N1, waterfowls

ABSTRAK

Virus avian influenza (VAI) subtipe H5N1 yang diisolasi dari unggas air di

Jawa Barat bersifat patogenik dengan pola asam amino daerah pemotongan HA

QRERRRKKR dan QRESRRKKR. Penelitian ini bertujuan untuk menganalisis

domain-domain penting gen penyandi hemaglutinin (HA) isolat-isolat tersebut.

Fragmen gen HA diamplifikasi dengan metode RT-PCR menggunakan pasangan

primer yang didisain khusus, dan disekuensing dengan metode dideoksi dengan

ABI automatic sequencer (Applied Biosystems). Runutan nukleotida hasil

sekuensing dan asam amino turunannya disepadankan dengan ClustalW dari

program MEGA 3.1. Domain asam amino daerah antigenik, posisi glikosilasi dan

kantong pengikat reseptor virus yang dianalisis menunjukkan adanya

polimorfisme. Sedangkan domain residu pengikat reseptor, semua isolat

mempunyai glutamin (Q) dan glisin (G) berturut-turut pada asam amino nomor

222 dan 224. Temuan-temuan tersebut menunjukkan dengan jelas bahwa

unggas air berperan sebagai tempat evolusi virus AI, namun spesifisitas reseptor

avian α-2,3NeuAcGal masih tetap dipertahankan.

Kata kunci: daerah antigenik, posisi glikosilasi, kantong pengikat reseptor,

VAI H5N1, unggas air

(2)

PENDAHULUAN

Patogenesitas virus avian influenza (VAI) secara molekuler ditentukan

berdasarkan sekuen asam amino daerah pemotongan (cleavage site) HA.

Daerah pemotongan hemaglutinin (HA) bersifat spesifik dan spesifisitas jenis

protease membatasi distribusi jaringan yang dapat diinfeksi virus ini (Munch et al.

2001). Meskipun VAI H5N1 secara molekuler bersifat patogenik, namun

patogenesitasnya berbeda-beda pada setiap spesies hospes bahkan pada

spesies hospes yang sama (Hulse et al. 2004).

Selain ditentukan oleh sekuen asam amino daerah pemotongan HA,

patogenesitas virus ditentukan oleh residu asam amino pada beberapa domain

HA (Plotkin & Dushoff 2003; Hulse et al. 2004). Domain-domain dimaksud antara

lain adalah daerah antigenik, kantong pengikat reseptor, residu pengikat reseptor

dan posisi glikosilasi. Daerah antigenik dan posisi glikosilasi fungsinya berkaitan

erat dengan pertahanan terhadap respon imun hospes, sementara kantong

pengikat reseptor dan posisi glikosilasi fungsinya berkaitan dengan daya

adaptasi pada hospes dan patogenesitas strain (Hulse et al. 2004; Gambaryan et

al

. 2006; Smith et al. 2006a; Stevens et al. 2006).

Daerah antigenik adalah asam amino sebagai target pengenalan dan

netralisasi oleh antibodi. Substitusi asam amino pada daerah antigenik

meningkatkan potensi terjadinya hanyutan antigenik (antigenic drift), karena

berkaitan dengan mekanisme virus untuk menghindar dari respon imun hospes.

Substitusi ini disebabkan tekanan seleksi untuk menghindar dari respon antibodi

hospes, termasuk penghindaran pengenalan antibodi yang terbentuk akibat

vaksinasi (Plotkin & Dushoff 2003; Smith et al. 2004; Campitelli et al. 2006).

Posisi glikosilasi adalah sekuen asam amino yang berpotensi sebagai

tempat penempelan oligosakarida. Penempelan oligosakarida ini sangat penting

dalam orientasi pelipatan HA untuk berikatan dengan reseptor sel atau antibodi.

Substitusi asam amino pada posisi glikosilasi merupakan strategi virus untuk

mask

(menutup) atau unmask (membuka) daerah antigenik dari pengenalan

antibodi sel hospes (Rajakumar et al. 1990; Hoffmann et al 2005; Campitelli et al.

2006; Stevens et al. 2006). Penambahan glikan pada posisi berdekatan dengan

asam amino residu pengikat reseptor dapat mengubah efisiensi ikatan HA pada

(3)

reseptor sel (Mishin et al. 2005). Sekuen asam amino yang berpotensi sebagai

posisi penempelan oligosakarida adalah sekuen asam amino dengan pola NXT

dan NXS (Hoffman et al. 2005; Smith et al. 2006a; Stevens et al. 2006).

Residu pengikat reseptor adalah asam amino yang berikatan secara

langsung dengan reseptor sel hospes. Substitusi asam amino pada residu

pengikat reseptor menyebabkan perubahan spesifisitas reseptor. Bagian dari HA

yang berikatan dengan reseptor adalah asam amino nomor 222 dan 224

(penomoran menurut H5). Glikoprotein HA virus influenza strain manusia yang

mempunyai asam amino leusin pada posisi 222 dan serin pada 224 hanya dapat

berikatan dengan asam sialat α-2,6NeuAcGal. Sementara HA virus influenza

strain unggas yang mempunyai asam amino glutamin pada posisi 222 dan glisin

pada 224 hanya dapat berikatan dengan asam sialat α-2,3NeuAcGal (Vines et al.

1998; Zhou et al. 1999; Suzuki et al. 2000; Leung 2007).

Kantong pengikat reseptor adalah asam amino yang terlibat

mempertahankan integritas struktur residu pengikat reseptor. Substitusi asam

amino kantong pengikat reseptor menyebabkan perubahan pelipatan protein

sehingga mengubah afinitas ikatan virus pada reseptor (Harvey et al. 2004;

Gambaryan et al. 2006; Auewarakul et al. 2007). VAI strain avian yang

mengalami perubahan afinitas pada reseptor hospes berpeluang memunculkan

strain virus yang berafinitas tinggi pada sel mamalia (Campitelli et al. 2006).

Adaptasi selalu dilakukan virus influenza, baik adaptasi terhadap tekanan

imun maupun adaptasi pada spesies hospes baru (Taubenberger et al. 2005).

Adaptasi merupakan kekuatan utama dari evolusi. Perbedaan spesies hospes

dan perbedaan tekanan menyebabkan pebedaan kecepatan evolusi virus

influenza (Brown et al. 2001). Keberadaan daerah antigenik, kantong pengikat

reseptor dan posisi glikosilasi menyebabkan subunit HA1 mempunyai tingkat

substitusi nonsinonim lebih tinggi dibanding substitusi sinonim (Plotkin & Dushoff

2003). Kecepatan mutasi substitusi nonsinonim gen HA1 sebesar 5,7 x10

-3

per

posisi per tahun (Bush et al. 1999). Meskipun tingkat mutasi HA paling tinggi

dibanding protein lain, namun pada bagian-bagian tertentu dari HA bersifat stabil

pada semua influenza A (Wagner et al. 2005).

Disamping domain-domain di atas, terdapat suatu domain yang dikenal

sebagai peptida fusi. Domain ini berperan pada fusi membran saat infeksi virus

(4)

influenza ke dalam sel hospes, sehingga berperan dalam patogenesis virus.

Domain ini diketahui bersifat stabil pada semua influenza A (Cross et al. 2001).

Penelitian ini bertujuan untuk menganalisis domain-domain penting gen

penyandi hemaglutinin virus HPAI H5N1 isolat unggas air, seperti daerah

antigenik, kantong pengikat reseptor, residu pengikat reseptor, posisi glikosilasi

dan peptida fusi. Primer yang digunakan adalah dua pasang primer yang didisain

khusus untuk mengamplifikasi nukleotida nomor 1 sampai dengan nomor 1200

dari gen HA.

METODE

PENELITIAN

RNA dari 9 isolat VAI subtipe H5N1 asal unggas air di Jawa Barat

diekstraksi dengan Trizol

®

LSReagent

(Invitrogen) sesuai manual. RT-PCR

dilakukan dengan menggunakan Superscript

TM

III One-step RT-PCR system.

Reaksi PCR dibuat sebanyak 50 μl dengan komposisi 25 μl 2x reaction mix, 2 μl

primer forward (10 μM), 2 μl primer reverse (10 μM), 2 μl Superscript III

RT/Platinum Taq Mix, 3 μl sampel RNA dan ultrapure H2O sampai volume 50 μl.

Primer yang digunakan untuk mengamplifikasi gen H5 adalah 2 pasang primer

yang didisain khusus, yaitu primer HA01-HA645 yang mengamplifikasi nukleotida

1-645, dan primer HA548-HA1215 yang mengamplifikasi nukleotida 548-1215

(Tabel 10). Program PCR untuk primer HA01-HA645 adalah 45

o

C reaksi RT 60

menit, predenaturasi 95

o

C 5 menit, 35 siklus terdiri dari denaturasi 95

o

C 30

detik, anneling 55

o

C 30 detik, ekstensi 72

o

C 40 detik, dan post ekstensi 72

o

C

10 menit. Program PCR untuk primer HA548-HA1215 menggunakan suhu

anneling

51

o

C. Isolat yang tidak dapat diamplifikasi dengan primer HA01-HA645,

dilakukan amplifikasi menggunakan primer H5-155F-H5-699R dengan anneling

50

o

C. Adanya pita DNA spesifik hasil PCR diidentifikasi dengan elektroforesis

pada gel agarose 2%.

(5)

Tabel 10. Sekuen nukleotida primer untuk mengamplifikasi gen HA

Primer

Sekuen basa

Fragmen gen Produk

(bp)

1

a

HA01: 5’ ATGGAGAAAATAGTGCTTCTTCTTGC’3

HA645: 5’ GGAAATATAGGTGGTTGGGTTTTG’3

H5

(basa 1-645)

645

2

a

HA548F: 5’CCAACCRAGARGATCTTTTGG’3*

HA1215R: 5’AYRGCCTCAAACTGAGTGTTC’3*

H5

(bada 548-1215)

667

3

b

H5-155F: 5’ACACATGCYCARGACATACT’3*

H5-699R: 5’CTYTGRTTYAGTGTTGATGT’3*

H5

(basa 155-699)

545

* Y=(CT), R=(AG)

a

didisain oleh Dr. Drh. IGN Mahardika & Drh. R. Susanti, MP

b

Lee et al. (2001)

PCR dengan pasangan primer H5-155F dan H5-699R menghasilkan pita

DNA target dan pita-pita nonspesifik, sehingga dilakukan purifikasi dengan

Wizard

®

SV Gel and PCR Clean-Up System

(Promega) sesuai manual. Pita DNA

target pada gel elektroforesis dipotong dan dimasukkan pada tabung 15 ml,

kemudian ditambah membrane binding solution sebanyak 10µl/10mg gel.

Setelah divortek, diinkubasi pada suhu 50-65

o

C sampai gel terlarut sempurna.

Larutan gel dimasukkan pada SV minicolumn (pada tabung koleksi), diinkubasi

pada suhu kamar selama 1 menit, dan disentrifuse pada 16000 g selama 1

menit. Tabung koleksi dan larutan isinya dibuang, SV minicolumn dipindahkan

pada tabung koleksi baru. Pada SV minicolumn dimasukkan 700 ul membrane

wash solution

, kemudian disentrifus 16000 g selama 1 menit. Larutan di dalam

tabung koleksi dibuang, SV minicolumn kembali dimasukkan pada tabung

koleksi. Pada SV minocolumn dimasukkan 500 µl membrane wash solution,

kemudian disentrifus pada 16000 g selama 1 menit. Larutan di dalam tabung

koleksi dibuang, SV minicolumn kembali dimasukkan pada tabung koleksi,

kemudian disentrifus pada 16000 g selama 1 menit. SV minicolumn dipindahkan

ke tabung 1,5 ml yang bersih, kemudian dimasukkan 50 µl nuclease free water.

Setelah diinkubasi pada suhu kamar selama 1 menit, SV minocolumn disentrifus

16000 g selama 1 menit. DNA hasil purifikasi yang terdapat pada tabung 1,5 ml

selanjutnya disimpan pada suhu -20

o

C.

Sekuensing dilakukan di 1

st

BASE Malaysia dengan metode dideoksi

menggunakan ABI automatic sequencer (Applied Biosystems). Runutan

(6)

nukleotida gen hemaglutinin hasil sekuensing dan turunan asam aminonya

disepadankan dengan program ClustalW (MEGA 3.1) (Kumar et al. 2004), dan

didokumentasikan di GenBank.

HASIL DAN PEMBAHASAN

Hasil PCR gen HA pada 9 isolat VAI subtipe H5N1 menggunakan primer

HA01-HA645 yang mengamplifikasi nukleotida 1 sampai 645, dan primer

HA548-HA1215 yang mengamplifikasi nukleotida 548 sampai 1215, berturut-turut terlihat

pada Gambar 8 dan Gambar 9. Sebanyak 4 isolat VAI H5N1 (IPB6-RS, IPB7-RS,

IPB8-RS, IPB9-RS) tidak dapat diamplifikasi dengan primer HA01-HA645,

sehingga dilakukan amplifikasi dengan primer H5-155F-H5-699R (Gambar 10).

M P 1 2 3

bp

2000 1650 1000 850 650 500 400 300 200 100

645bp

Gambar 8. Elektroforegram RT-PCR dengan primer HA01dan HA645 (produk

645bp). Sumur M: DNA ladder 100bp. Sumur P: Kontrol positif VAI

subtipe H5. Sumur 1-3:VAI isolat unggas air subtipe H5N1

(7)

M P 1 2 3 4 5 6 7 8 9 10 11

bp

2000 1650 1000 850 650 500 400 300 200 100

667 bp

Gambar 9. Elektroforegram RT-PCR dengan primer HA548 dan HA1215 (produk

667bp). Sumur M: DNA ladder 100bp. Sumur P: Kontrol positif VAI

subtipe H5. Sumur 1-11: VAI isolat unggas air subtipe H5N1

M 1 2 3 4 5 P

bp

2000 1650 1000 850 650 500 400 300 200 100

545 bp

Gambar 10. Elektroforegram RT-PCR dengan primer H5-155F dan H5-699R

(produk 545bp). Sumur M: DNA ladder 100bp. Sumur P: Kontrol

positif VAI subtipe H5. Sumur 1-5: VAI isolat unggas air subtipe

H5N1

Sekuen nukleotida penyandi protein HA dari 9 virus AI subtipe H5N1 isolat

unggas air dalam penelitian ini dapat diakses di GenBank dengan nomor akses

EF646265-EF646273.

Sekuen nukleotida unggas air yang disepadankan dengan nukleotida

Gs/GD/1/96 (Lampiran 2 dan 3) menunjukkan bahwa jumlah kodon substitusi

bervariasi dari 23 sampai 50, dan jumlah substitusi nonsinonim bervariasi dari

5-18 (Tabel 11). Tingkat mutasi yang tinggi akibat lemahnya mekanisme

proofreading

dari RdRp, menyebabkan perubahan nukleotida terjadi terus

(8)

merupakan determinan antigenik utama dan jumlah NA pada permukaan virion

hanya 1/5 jumlah HA (Plotkin & Dushoff 2003).

Protein internal tidak berperan dalam pengikatan dengan reseptor sel

hospes dan tersembunyi dari antibodi, sehingga protein ini lebih stabil dibanding

glikoprotein permukaan (Plotkin & Dushoff 2003; Berkhoff et al. 2005). Struktur

dan fungsi protein internal juga sangat mendasar sehingga tidak menguntungkan

virus jika mutasi terjadi secara cepat. Hal ini menyebabkan VAI menghadapi

konflik intragenom tentang kecepatan mutasi. Gen tertentu dan residu spesifik

dalam genom tersebut mengalami seleksi untuk berubah. Sementara gen lain

mengalami seleksi pemurnian untuk tidak berubah (Plotkin & Dushoff 2003).

Substitusi nonsinonim disebabkan oleh tekanan seleksi tergantung

frekuensi, artinya semakin sering mengalami tekanan semakin tinggi kecepatan

untuk substitusi nonsinonim (Plotkin & Dushoff 2003). Adanya tekanan seleksi

akan menyebabkan munculnya varian dengan tingkat efektivitas replikasi yang

tinggi (Jong et al. 2000). Lima virus AI subtipe H5N1 isolat unggas air (IPB1-RS

s/d IPB5-RS), mengalami substitusi nonsinonim 3 asam amino kantong pengikat

reseptor. Sebanyak 11 substitusi nonsinonim pada isolat IPB6-RS, 10

diantaranya merupakan daerah antigenik, posisi glikosilasi dan kantong pengikat

reseptor. Dari 17-18 substitusi nonsinonim pada 3 isolat virus (IPB7-RS, IPB8-RS

dan IPB9-RS), 16 substitusi diantaranya merupakan daerah antigenik, posisi

glikosilasi dan kantong pengikat reseptor.

Tabel 11. Jumlah substitusi sinonim dam nonsinonim gen hemaglutinin virus

avian influenza subtipe H5N1 isolat unggas air

No Isolat

Jumlah

kodon yang

terbaca

Jumlah

Substitusi

Jumlah

Substitusi

Sinonim

Jumlah

Substitusi

Nonsinonim

1 IPB1-RS

(Entok)

440

23

18

5

2 IPB2-RS

(Angsa)

440

25

19

6

3 IPB3-RS

(Itik)

439

23

18

5

4 IPB4-RS

(Angsa)

398

24

19

6

5 IPB5-RS

(Entok)

388

24

17

7

6 IPB6-RS

(Itik)

398

39

28

11

7 IPB7-RS

(Angsa)

395

50

32

18

8 IPB8-RS

(Itik)

398

48

31

17

9 IPB9-RS

(Itik)

398

47

30

17

(9)

Virus AI subtipe H5N1 garis Asia menunjukkan jumlah asam amino yang

mengalami seleksi positif meningkat dari tahun ke tahun, terutama pada daerah

antigenik, posisi glikosilasi dan kantong pengikat reseptor. Hal ini kemungkinan

berhubungan dengan peningkatan patogenesitas dan kemampuan virus untuk

transmisi ke manusia (Campitelli et al. 2006). Mekanisme virus untuk menghindar

dari sistem imun hospes merupakan tekanan untuk mutasi secara gradual

sehingga muncul strain-strain virus baru yang secara imunologik berbeda

(hanyutan antigenik) (Munch et al. 2001; Smith et al. 2004). Hanyutan antigenik

berjalan lambat namun progresif dan cenderung menimbulkan penyakit yang

terbatas pada suatu kawasan tertentu (Tumpey et al. 2002; Swayne & Suarez

2003).

Seperti organisme lainnya, substitusi sinonim pada virus influenza juga

berkaitan dengan kelimpahan tRNA (Plotkin & Dushoff 2003; Lavler & Kotlar

2005; Wu & Freeland 2005). Semakin banyak tRNA, kecepatan translasi semakin

cepat. Namun, mengingat translasi mRNA virus menggunakan mekanisme

translasi sel hospes, substitusi sinonim ini lebih dikarenakan seleksi penyesuaian

terhadap penggunaan kodon (codon usage) sel hospes (Garmory et al. 2003).

Daerah antigenik (antigenic sites)

Sekuen nukleotida gen hemaglutinin dan turunan asam aminonya dari 9

VAI subtipe H5N1 isolat unggas air terlihat pada Gambar 11-19. Asam amino

daerah antigenik pada 5 isolat VAI unggas air (IPB1-RS s/d IPB5-RS) sama

dengan isolat Gs/GD/1/96. Isolat VAI IPB6-RS mengalami substitusi nonsinonim

pada 4 asam amino daerah antigenik (N45D, S84N, H138Q dan R140S),

sementara 3 isolat VAI unggas air lainnya (IPB7-RS, IPB8-RS dan IPB9-RS)

mengalami substitusi nonsinonim pada 8 asam amino daerah antigenik (N45D,

S84N, A86T, N124D, H138L, R140S, S141P dan K189R) (Tabel 12).

(10)

Tabel 12. Asam amino daerah antigenik pada hemaglutinin virus avian influenza

subtipe H5N1 isolat unggas air

Daerah antigenik *

Isolat

4

5

8

3

8

4

8

6

1

2

1

1

2

4

1

2

5

1

2

9

1

3

7

1

3

8

1

4

0

1

4

1

1

5

5

1

8

9

2

1

2

2

2

3

2

6

3

Gs/GD/1/96

N A S A S N H S Y H R S S

K K S A

IPB1-RS (entok)

N A S A S N H S Y H R S S

K K S A

IPB2-RS (angsa)

N A S A S N H S Y H R S S

K K S A

IPB3-RS (itik)

N A S A S N H S Y H R S S

K K S A

IPB4-RS (angsa)

N A S A S N H S Y H R S S

K K S A

IPB5-RS (entok)

N A S A S N H S Y H R S S

K K S A

IPB6-RS (itik)

D A N A S N H S Y Q S S S

K K S A

IPB7-RS (angsa)

D A N T S D H S Y L S P S

R K S A

IPB8-RS (itik)

D A N T S D H S Y L S P S

R K S A

IPB9-RS (itik)

D A N T S D H S Y L S P S

R K S A

* Penomoran menurut H5. (Guan et al. 2004; Hoffman et al. 2005; WHO 2005b;

Campitelli et al. 2006; Smith et al. 2006a)

Substitusi asam amino pada daerah antigenik meningkatkan potensi

terjadinya hanyutan antigenik, karena berkaitan dengan mekanisme virus untuk

menghindar dari respon imun hospes. Substitusi ini disebabkan tekanan seleksi

untuk menghindar dari respon antibodi hospes, termasuk penghindaran

pengenalan antibodi yang terbentuk akibat vaksinasi atau infeksi sebelumnya

(Plotkin & Dushoff 2003; Smith et al. 2004; Campitelli et al. 2006). Substitusi

asam amino pada daerah antigenik merupakan salah satu pendorong evolusi

gen hemaglutinin (Shih et al. 2007).

Substitusi asam amino 138 dan 140 juga berhubungan dengan

patogenesitas virus, karena asam amino ini juga terlibat dalam ikatan dengan

reseptor (Hulse et al. 2004). Substitusi N124S, L138Q dan K189R pada genotipe

Z kemungkinan berhubungan dengan adaptasi virus pada mamalia (Guan et al.

2004). Daerah antigenik pada asam amino 189 (R atau K) pada isolat unggas air

dalam penelitian ini sama dengan isolat Hongkong, Vietnam dan Singapura

(Hoffman et al. 2005). Daerah antigenik pada asam amino 45, 84, 86, 124, 138,

140 dan 141 pada isolat unggas air dalam penelitian ini menunjukkan adanya

polimorfisme. Daerah antigenik A-E pada asam amino 86, 138, 140 dan 141

isolat unggas dan manusia di Indonesia dan Vietnam mengalami seleksi positif

(Smith et al. 2006a). Analisis sekuen asam amino subunit HA1 pada virus

(11)

influenza A tahun 1968-2005 berhasil mengidentifikasi 95 substitusi pada 63

asam amino, dan 57 substitusi diantaranya adalah asam amino daerah antigenik

(Shih et al. 2007).

Posisi glikosilasi (glycosilation sites)

Posisi glikosilasi dari VAI H5N1 isolat unggas air menunjukkan bahwa

asam amino nomor 84-86 dan 154-156 pada 5 isolat unggas air (IPB1-RS s/d

IPB5-RS) tidak berpotensi sebagai tempat penempelan oligosakarida. Asam

amino isolat unggas air IPB6-RS mengalami substitusi pada A156T, sehingga

terbentuk sekuen N-S-T pada asam amino 154-156 yang berpotensi sebagai

posisi glikosilasi. Akibat substitusi pada A86T dan A156T pada 3 VAI isolat

unggas air (IPB7-RS, IPB8-RS, IPB9-RS) menginduksi munculnya posisi

glikosilasi pada asam amino 84-86 dan 154-156 (Tabel 13).

Tabel 13. Sekuen asam amino hemaglutinin virus avian influenza subtipe H5N1

isolat unggas air yang berpotensi sebagai posisi glikosilasi

Posisi glikosilasi*

Isolat

10-12

23-25

84-86

154-156

165-167

193-195

286-288

Gs/GD/1/96

NNS NVT -

- NNT NPT NSS

IPB1-RS (entok)

NNS NVT

- -

NNT

NPT

NSS

IPB2-RS (angsa)

NNS NVT

- -

NNT

NPT

NSS

IPB3-RS (itik)

NNS NVT

- -

NNT

NPT

NSS

IPB4-RS (angsa)

NNS NVT

- -

NNT

NPT

NSS

IPB5-RS (entok)

- -

NNT

NPT

NSS

IPB6-RS (itik)

- NST NNT NPT NSS

IPB7-RS (angsa)

NPT NST NNT NPT NSS

IPB8-RS (itik)

NPT NST NNT NPT NSS

IPB9-RS (itik)

NPT NST NNT NPT NSS

* Penomoran menurut H5. (Matrosovich et al. 1999; WHO 2005b; Campitelli

et al

. 2006; Gambaryan et al. 2006; Smith et al. 2006a; Stevens et al.

(12)

Posisi glikosilasi pada asam amino posisi 154-156 dan 193-195 berdekatan

dengan daerah antigenik dan residu pengikat reseptor, sehingga mempengaruhi

afinitas ikatan pada reseptor dan mekanisme virus menghindar respon imun

hospes (Matrosovich et al. 1999; WHO 2005b; Campitelli et al. 2006; Gambaryan

et al

. 2006; Smith et al. 2006a). Substitusi pada A156T pada VAI H5N1 garis

Asia dihubungkan dengan adaptasi virus pada hospes unggas darat dan

meningkatkan virulensi pada unggas darat ini (WHO 2005b; Smith et al. 2006a;

Stevens et al. 2006). Posisi glikosilasi pada asam amino 84-86 merupakan

mekanisme VAI untuk menghindar pengenalan daerah antigenik oleh antibodi

(WHO 2005b; Smith et al. 2006a).

Kantong pengikat reseptor (receptor binding pocket)

Kantong pengikat reseptor adalah asam amino yang terlibat

mempertahankan integritas struktur residu pengikat reseptor. Secara struktural,

terdapat 3 elemen dasar kantong pengikat reseptor VAI H5N1 yaitu α-helix

(asam amino HA1 188-190), loop-130 (asam amino HA1 134-138) dan loop-220

(asam amino HA1 221-228) (Stevens et al. 2006). Substitusi asam amino

kantong pengikat reseptor menyebabkan perubahan struktur sekunder protein

sehingga mempengaruhi afinitas ikatan virus pada reseptor (Harvey et al. 2004;

Gambaryan et al. 2006; Auewarakul et al. 2007). Virus AI strain avian yang

mengalami perubahan afinitas pada reseptor hospes berpeluang memunculkan

strain virus yang berafinitas tinggi pada reseptor sel mamalia (Campitelli et al.

2006).

Virus AI subtipe H5N1 isolat unggas air (IPB1-RS, IPB2-RS, IPB3-RS,

IPB4-RS dan IPB5-RS), mengalami 3 substitusi nonsinonim pada asam amino

kantong pengikat reseptor (L175M, E212K dan P217S). VAI H5N1 isolat

IPB6-RS mengalami 7 substitusi nonsinonim asam amino kantong pengikat reseptor

(D94N, T108I, D126E, H138Q, R140S, E212K dan P217S). Tiga VAI H5N1 isolat

unggas air (IPB7-RS, IPB8-RS, IPB9-RS) mengalami substitusi nonsinonim pada

10 asam amino pembentuk kantong pengikat reseptor (D94S, T108I, N124D,

D126E, H138L, R140S, D183N, K189R, E212K dan P217S) (Tabel 14).

(13)

Tabel 14. Asam amino pembentuk kantong pengikat reseptor pada hemaglutinin

virus avian influenza subtipe H5N1 isolat unggas air

Kantong pengikat reseptor *

Isolat 9 4 9 7 1 0 8 1 2 4 1 2 6 1 2 9 1 3 0 1 3 2 1 3 8 1 4 0 1 4 9 1 5 1 1 7 5 1 7 9 1 8 3 1 8 6 1 8 8 1 8 9 1 9 0 2 1 2 2 1 7 2 1 8 2 2 1 2 2 2 2 2 3 2 2 4 2 6 3 Gs/GD/1/96 D D T N D S G S H R W I L H D E T K L E P K G Q S G A IPB1-RS (entok) D D T N D S G S H R W I M H D E T K L K S K G Q S G A IPB2-RS (angsa) D D T N D S G S H R W I M H D E T K L K S K G Q S G A IPB3-RS (itik) D D T N D S G S H R W I M H D E T K L K S K G Q S G A IPB4-RS (angsa) D D T N D S G S H R W I M H D E T K L K S K G Q S G A IPB5-RS (entok) D D T N D S G S H R W I M H D E T K L K S K G Q S G A IPB6-RS (itik) N D I N E S G S Q S W I L H D E T K L K S K G Q S G A IPB7-RS (angsa) S D I D E S G S L S W I L H N E T R L K S K G Q S G A IPB8-RS (itik) S D I D E S G S L S W I L H N E T R L K S K G Q S G A IPB9-RS (itik) S D I D E S G S L S W I L H N E T R L K S K G Q S G A

* Penomoran menurut H5. (Hulse et al. 2004; WHO 2005b; Campitelli et al. 2006;

Gambaryan et al. 2006; Smith et al. 2006a; Stevens et al. 2006).

Patogenesitas VAI H5N1 pada hospes sangat dipengaruhi oleh susunan

asam amino kantong pengikat reseptor. VAI H5N1 dengan asam amino D97,

I108, E126, L138, K212 dan S217 menunjukkan fenotipe highly pathogenic,

sementara asam amino T108, D126, H/Q138 menunjukkan fenotipe patogenik

moderat (Hulse et al. 2004). Tiga VAI H5N1 isolat unggas air (IPB7-RS, IPB8-RS

dan IPB9-RS) kemungkinan mempunyai fenotipe patogenik tinggi, karena

mempunyai asam amino kantong pengikat reseptor khas D97, I108, E126, L138,

K212 dan S217 (Tabel 14). Sementara 5 VAI H5N1 isolat unggas air lainnya

(IPB1-RS s/d IPB5-RS) mempunyai asam amino khas (T108, D126, H138)

penanda fenotipe patogenik moderat. Fenotipe patogenesitas VAI H5N1 isolat

unggas air dalam penelitian ini perlu dikaji lebih lanjut dengan uji biologis.

Residu pengikat reseptor (receptor binding sites)

Residu pengikat reseptor pada VAI H5N1 isolat unggas air dalam penelitian

ini adalah glutamin (Q) dan glisin (G) berturut-turut pada asam amino nomor 222

dan 224 (Tabel 14). Residu pengikat reseptor seperti itu dianggap spesifik

berikatan dengan reseptor avian α-2,3NeuAcGal (Gambaryan et al. 2006; Smith

(14)

Peptida fusi (fusion peptide)

Peptida fusi adalah peptida yang berperan pada fusi membran saat infeksi

virus influenza ke dalam sel hospes. Sekuen asam amino peptida fusi yang

terdapat pada ujung N subunit HA2 dari VAI H5N1 isolat unggas air dalam

penelitian ini terdiri dari 23 asam amino kaya glisin, yaitu

GLFGAIAGFIEGGWQGMVDGWYG. Sekuen peptida fusi VAI H5N1 isolat

unggas air dalam penelitian ini sama dengan isolat VAI H5N1 penyebab wabah

di Asia. Jika dibandingkan dengan peptida fusi virus influenza penyebab pandemi

flu di Hongkong tahun 1968 (GLFGAIAGFIENGWEGMIDGWYG), peptida fusi ini

hanya mengalami substitusi 3 asam amino selama hampir 40 tahun (Cross et al.

2001; Smith et al. 2006a). Peptida ini bersifat stabil pada semua influenza A

(Cross et al. 2001).

Adanya variasi domain-domain spesifik daerah antigenik, posisi glikosilasi

dan kantong pengikat reseptor pada VAI H5N1 isolat unggas air dalam penelitian

ini, mengindikasikan bahwa unggas air merupakan tempat evolusi bagi virus ini.

Liu (2007) menyatakan bahwa virus influenza tidak selamanya bersifat stasis

secara evolusioner pada hospes alami, dan biologi virus dapat berubah secara

dramatis pada unggas air domestik. VAI subtipe H5N1 pada unggas air di Cina

secara progresif menunjukkan peningkatan patogenesitas pada hewan model

mencit (Chen et al. 2004). Strurm-Ramirez et al (2005) juga melaporkan bahwa

VAI H5N1 isolat itik di Asia tahun 2002-2004 tidak hanya bereplikasi pada

saluran pencernaan tetapi juga pada saluran respirasi bagian atas. Dengan

demikian, evolusi biologis secara in vivo VAI H5N1 isolat unggas air dalam

penelitian ini perlu diteliti lebih lanjut.

(15)

SIMPULAN

Domain asam amino daerah antigenik, posisi glikosilasi dan kantong

pengikat reseptor virus avian influenza subtipe H5N1 isolat unggas air yang

dianalisis menunjukkan adanya polimorfisme. Sedangkan pada domain residu

pengikat reseptor, semua isolat mempunyai glutamin (Q) dan glisin (G)

berturut-turut pada asam amino nomor 222 dan 224. Temuan-temuan tersebut

menunjukkan dengan jelas bahwa unggas air berperan sebagai tempat evolusi

virus AI, namun spesifisitas reseptor avian α-2,3NeuAcGal masih tetap

dipertahankan.

SARAN

Perlu segera dilakukan penelitian lebih lanjut evolusi biologis virus avian

influenza subtipe H5N1 isolat unggas air secara in vivo.

(16)

1 HA1 ATG GAG AAA ATA GTG CTT CTT CTT GCA ATA GTC AGT CCT GTT AAA AGT GAT CAG ATT TGC M E K I V L L L A I V S P V K S D Q I C 4 ATT GGT TAC CAT GCA AAC AAC TCG ACA GAG CAG GTT GAC ACA ATA ATG GAA AAG AAC GTT I G Y H A N N S T E Q V D T I M E K N V 24 ACT GTT ACA CAT GCC CAA GAC ATA CTG GAA AAG ACA CAC AAC GGG AAG CTC TGC GAT CTA T V T H A Q D I L E K T H N G K L C D L 44

AAT GGA GTG AAG CCT CTC ATT TTG AGA GAT TGT AGT GTA GCT GGA TGG CTC CTC GGA AAC N G V K P L I L R D C S V A G W L L G N 64 ● ● CCT ATG TGT GAC GAA TTC ATC AAT GTG CCG GAA TGG TCT TAC ATA GTG GAG AAG GCC AGT P M C D E F I N V P E W S Y I V E K A S 84 ● ♦ ♦

CCA GCC AAT GAC CTC TGT TAC CCA GGG GAT TTC AAC GAC TAT GAA GAA CTG AAA CAC CTA P A N D L C Y P G D F N D Y E E L K H L 104 ♦ ♦● TTG AGC AGC ACA AAC CAT TTT GAG AAA ATT CAG ATC ATC CCC AAA AGT TCT TGG TCC AAT L S S T N H F E K I Q I I P K S S W S N 124 ● ♦● ♦ ♦ ● ♦● ♦● ●

CAT GAT GCC TCA TCA GGG GTG AGC TCA GCA TGT CCA TAC CAT GGG AGG TCC TCC TTT TTC H D A S S G V S S A C P Y H G R S S F F 144 ♦ ♦ ●

AGA AAT GTG GTA TGG CTT ATC AAA AAG AAC AGT GCA TAC CCA ACA ATA AAG AGG AGC TAC R N V V W L I K K N S A Y P T I K R S Y 164 ♦ ♦ ♦

AAT AAT ACC AAC CAA GAA GAT CTT TTG GTA ATG TGG GGG ATT CAC CAT CCT AAT GAT GCG N N T N Q E D L L V M W G I H H P N D A 184 ♦ ♦ ♦● ♦

GCA GAG CAG ACA AAG CTC TAT CAA AAC CCA ACC ACC TAT ATT TCC ATT GGG ACA TCA ACA A E Q T K L Y Q N P T T Y I S I G T S T 204 ♦● ♦ ♦ ♦ ▲ ♦● ▲

CTA AAC CAG AGA TTG GTA CCA AAA ATA GCT ACT AGA TCC AAA GTA AAC GGG CAA AGT GGA L N Q R L V P K I A T R S K V N G Q S G 224 AGG ATG GAG TTC TTC TGG ACA ATT TTA AAA CCT AAT GAT GCA ATC AAC TTC GAG AGT AAT R M E F F W T I L K P N D A I N F E S N 244 ♦●

GGA AAT TTC ATT GCT CCA GAA TAT GCA TAC AAA ATT GTC AAG AAA GGG GAC TCA GCA ATT G N F I A P E Y A Y K I V K K G D S A I 264 ATG AAA AGT GAA TTG GAA TAT GGT AAC TGC AAC ACC AAG TGT CAA ACT CCA ATG GGG GCG M K S E L E Y G N C N T K C Q T P M G A 284 ATA AAC TCT AGT ATG CCA TTC CAC AAC ATA CAC CCT CTC ACC ATC GGG GAA TGC CCC AAA I N S S M P F H N I H P L T I G E C P K 304 ♣ ♣ ♣ TAT GTG AAA TCA AAC AGA TTA GTC CTT GCG ACT GGA CTC AGA AAT ACC CCT CAA AGA GAG Y V K S N R L V L A T G L R N T P Q R E 324 ♣ ♣ ♣ ♣ ♣ ♣ 1 HA2 AGA AGA AGA AAA AAG AGA GGA CTA TTT GGA GCT ATA GCA GGT TTT ATA GAG GGA GGA TGG

R R R K K R G L F G A I A G F I E G G W 14 CAG GGA ATG GTA GAT GGT TGG TAT GGG TAC CAC CAT AGC AAT GAG CAG GGG AGT GGG TAC Q G M V D G W Y G Y H H S N E Q G S G Y 34 GCT GCA GAC AAA GAA TCC ACT CAA AAG GCA ATA GAT GGA GTC ACC AAT AAG GTC AAC TCA A A D K E S T Q K A I D G V T N K V N S 54 ATT ATT GAC AAA ATG AAC ACT CAG GTT GAA GGC TAT I I D K M N T Q V E G Y 66 ● : daerah antigenic ▲ : residu pengikat reseptor ♦ :kantong pengikat reseptor ♣ : daerah pemotongan Æ : batas subunit HA1 : peptida fusi

Garis bawah: posisi glikosilasi : signal promoter

Gambar 11. Gen penyandi hemaglutinin dan turunan asam aminonya virus isolat

A/muscovy duck/Klapanunggal/IPB1-RS/2006(H5N1)

(17)

1 HA1 ATG GAG AAA ATA GTG CTT CTT CTT GCA ATA GTC AGT CTT GTT AAA AGT GAT CAG ATT TGC M E K I V L L L A I V S L V K S D Q I C 4

ATT GGT TAC CAT GCA AAC AAC TCG ACA GAG CAG GTT GAC ACA ATA ATG GAA AAG AAC GTT I G Y H A N N S T E Q V D T I M E K N V 24

ACT GTT ACA CAT GCC CAA GAC ATA CTG GAA AAG ACA CAC AAC GGG AAG CTC TGC GAT CTA T V T H A Q D I L E K T H N G K L C D L 44

AAT GGA GTG AAG CCT CTC ATT TTG AGA GAT TGT AGT GTA GCT GGA TGG CTC CTC GGA AAC N G V K P L I L R D C S V A G W L L G N 64 ● ● CCT ATG TGT GAC GAA TTC ATC AAT GTG CCG GAA TGG TCT TAC ATA GTG GAG AAG GCC AGT P M C D E F I N V P E W S Y I V E K A S 84 ● ♦ ♦

CCA GCC AAT GAC CTC TGT TAC CCA GGG GAT TTC AAC GAC TAT GAA GAA CTG AAA CAC CTA P A N D L C Y P G D F N D Y E E L K H L 104 ♦ ● ♦● TTG AGC AGC ACA AAC CAT TTT GAG AAA ATT CAG ATC ATC CCC AAA AGT TCT TGG TCC AAT L S S T N H F E K I Q I I P K S S W S N 124 ● ♦● ♦ ♦ ● ♦● ♦● ●

CAT GAT GCC TCA TCA GGG GTG AGC TCA GCA TGT CCA TAC CAT GGG AGG TCC TCC TTT TTC H D A S S G V S S A C P Y H G R S S F F 144 ♦ ♦ ●

AGA AAT GTG GTA TGG CTT ATC AAA AAG AAC AGT GCA TAC CCA ACA ATA AAG AGG AGC TAC R N V V W L I K K N S A Y P T I K R S Y 164 ♦ ♦ ♦

AAT AAT ACC AAC CAA GAA GAT CTT TTG GTA ATG TGG GGG ATT CAC CAT CCT AAT GAT GCG N N T N Q E D L L V M W G I H H P N D A 184 ♦ ♦ ♦● ♦

GCA GAG CAG ACA AAG CTC TAT CAA AAC CCA ACC ACC TAT ATT TCC ATT GGG ACA TCA ACA

A E Q T K L Y Q N P T T Y I S I G T S T 204 ♦● ♦ ♦ ♦ ▲ ♦● ▲

CTA AAC CAG AGA TTG GTA CCA AAA ATA GCT ACT AGA TCC AAA GTA AAC GGG CAA AGT GGA

L N Q R L V P K I A T R S K V N G Q S G 224 AGG ATG GAG TTC TTC TGG ACA ATT TTA AAA CCT AAT GAT GCA ATC AAC TTC GAG AGT AAT

R M E F F W T I L K P N D A I N F E S N 244 ♦●

GGA AAT TTC ATT GCT CCA GAA TAT GCA TAC AAA ATT GTC AAG AAA GGG GAC TCA GCA ATT

G N F I A P E Y A Y K I V K K G D S A I 264 ATG AAA AGT GAA TTG GAA TAT GGT AAC TGC AAC ACC AAG TGT CAA ACT CCA ATG GGG GCG

M K S E L E Y G N C N T K C Q T P M G A 284 ATA AAC TCT AGT ATG CCA TTC CAC AAC ATA CAC CCT CTC ACC ATC GGG GAA TGC CCC AAA

I N S S M P F H N I H P L T I G E C P K 304 ♣ ♣ ♣

TAT GTG AAA TCA AAC AGA TTA GTC CTT GCG ACT GGG CTC AGA AAT AGC CCT CAA AGA GAG

Y V K S N R L V L A T G L R N S P Q R E 324 ♣ ♣ ♣ ♣ ♣ ♣ 1 HA2

AGA AGA AGA AAA AAG AGA GGA CTA TTT GGA GCT ATA GCA GGT TTT ATA GAG GGA GGA TGG R R R K K R G L F G A I A G F I E G G W 14 CAG GGA ATG GTA GAT GGT TGG TAT GGG TAC CAC CAT AGC AAT GAG CAG GGG AGT GGG TAC

Q G M V D G W Y G Y H H S N E Q G S G Y 34 GCT GCA GAC AAA GAA TCC ACT CAA AAG GCA ATA GAT GGA GTC ACC AAT AAG GTC AAC TCA

A A D K E S T Q K A I D G V T N K V N S 54 ATT ATT GAC AAA ATG AAC ACT CAG GTT GAG GCT

I I D K M N T Q V E A 65 ● : daerah antigenik ▲ : residu pengikat reseptor ♦ :kantong pengikat reseptor ♣ :daerah pemotongan Æ : batas subunit HA1 :peptida fusi

Garis bawah: posisi glikosilasi :signal promoter

Gambar 12. Gen penyandi hemaglutinin dan turunan asam aminonya virus isolat

A/goose/Bojonggenteng/IPB2-RS/2006(H5N1)

(18)

1 HA1 GAG AAA ATA GTG CTT CTT CTT GCA ATA GTC AGT CTT GTT AAA AGT GAT CAG ATT TGC ATT E K I V L L L A I V S L V K S D Q I C I 5 GGT TAC CAT GCA AAC AAC TCG ACA GAG CAG GTT GAC ACA ATA ATG GAA AAG AAC GTT ACT G Y H A N N S T E Q V D T I M E K N V T 25

GTT ACA CAT GCC CAA GAC ATA CTG GAA AAG ACA CAC AAC GGG AAG CTC TGC GAT CTA AAT V T H A Q D I L E K T H N G K L C D L N 45 GGA GTG AAG CCT CTC ATT TTG AGA GAT TGT AGT GTA GCT GGA TGG CTC CTC GGA AAC CCT G V K P L I L R D C S V A G W L L G N P 65 ● ●

ATG TGT GAC GAA TTC ATC AAT GTG CCG GAA TGG TCT TAC ATA GTG GAG AAG GCC AGT CCA M C D E F I N V P E W S Y I V E K A S P 85 ● ♦ ♦

GCC AAT GAC CTC TGT TAC CCA GGG GAT TTC AAC GAC TAT GAA GAA CTG AAA CAC CTA TTG A N D L C Y P G D F N D Y E E L K H L L 105 ♦ ● ♦● ● AGC AGC ACA AAC CAT TTT GAG AAA ATT CAG ATC ATC CCC AAA AGT TCT TGG TCC AAT CAT S S T N H F E K I Q I I P K S S W S N H 125 ♦● ♦ ♦ ● ♦● ♦● ●

GAT GCC TCA TCA GGG GTG AGC TCA GCA TGT CCA TAC CAT GGG AGG TCC TCC TTT TTC AGA D A S S G V S S A C P Y H G R S S F F R 145 ♦ ♦ ●

AAT GTG GTA TGG CTT ATC AAA AAG AAC AGT GCA TAC CCA ACA ATA AAG AGG AGC TAC AAT N V V W L I K K N S A Y P T I K R S Y N 165 ♦ ♦ ♦

AAT ACC AAC CAA GAA GAT CTT TTG GTA ATG TGG GGG ATT CAC CAT CCT AAT GAT GCG GCA N T N Q E D L L V M W G I H H P N D A A 185 ♦ ♦ ♦● ♦

GAG CAG ACA AAG CTC TAT CAA AAC CCA ACC ACC TAT ATT TCC ATT GGG ACA TCA ACA CTA E Q T K L Y Q N P T T Y I S I G T S T L 205 ♦● ♦ ♦ ♦ ▲ ♦● ▲

AAC CAG AGA TTG GTA CCA AAA ATA GCT ACT AGA TCC AAA GTA AAC GGG CAA AGT GGA AGG N Q R L V P K I A T R S K V N G Q S G R 225 ATG GAG TTC TTC TGG ACA ATT TTA AAA CCT AAT GAT GCA ATC AAC TTC GAG AGT AAT GGA M E F F W T I L K P N D A I N F E S N G 245 ♦●

AAT TTC ATT GCT CCA GAA TAT GCA TAC AAA ATT GTC AAG AAA GGG GAC TCA GCA ATT ATG N F I A P E Y A Y K I V K K G D S A I M 265 AAA AGT GAA TTG GAA TAT GGT AAC TGC AAC ACC AAG TGT CAA ACT CCA ATG GGG GCG ATA K S E L E Y G N C N T K C Q T P M G A I 285 AAC TCT AGT ATG CCA TTC CAC AAC ATA CAC CCT CTC ACC ATC GGG GAA TGC CCC AAA TAT N S S M P F H N I H P L T I G E C P K Y 305 ♣ ♣ ♣ ♣ GTG AAA TCA AAC AGA TTA GTC CTT GCG ACT GGA CTC AGA AAT ACC CCT CAA AGA GAG AGA V K S N R L V L A T G L R N T P Q R E R 325 ♣ ♣ ♣ ♣ ♣ 1 HA2 AGA AGA AAA AAG AGA GGA CTA TTT GGA GCT ATA GCA GGT TTT ATA GAG GGA GGA TGG CAG R R K K R G L F G A I A G F I E G G W Q 15 GGA ATG GTA GAT GGT TGG TAT GGG TAC CAC CAT AGC AAT GAG CAG GGG AGT GGG TAC GCT G M V D G W Y G Y H H S N E Q G S G Y A 35 GCA GAC AAA GAA TCC ACT CAA AAG GCA ATA GAT GGA GTC ACC AAT AAG GTC AAC TCA ATT A D K E S T Q K A I D G V T N K V N S I 55 ATT GAC AAA ATG AAC ACT CAG GTT GAG GCT I D K M N T Q V E A 65 ● :daerah antigenik ▲ : residu pengikat reseptor ♦ :kantong pengikat reseptor ♣ :daerah pemotongan Æ : batas subunit HA1 : peptida fusi

Garis bawah: posisi glikosilasi : signal promoter

Gambar 13. Gen penyandi hemaglutinin dan turunan asam aminonya virus isolat

A/duck/Leuwiliang/IPB3-RS/2006(H5N1)

(19)

1 HA1 AAA ATA GTG CTT CTT CTT GCA ATA GTC AGT CTT GTT AAA AGT GAT CAG ATT TGC ATT GGT K I V L L L A I V S L V K S D Q I C I G 6 TAC CAT GCA AAC AAC TCG ACA GAG CAG GTT GAC ACA ATA ATG GAA AAG AAC GTT ACT GTT Y H A N N S T E Q V D T I M E K N V T V 26

ACA CAT GCC CAA GAC ATA CTG GAA AAG ACA CAC AAC GGG AAG CTC TGC GAT CTA AAT GGA T H A Q D I L E K T H N G K L C D L N G 46 GTG AAG CCT CTC ATT TTG AGA GAT TGT AGT GTA GCT GGA TGG CTC CTC GGA AAC CCT ATG V K P L I L R D C S V A G W L L G N P M 66 ● ● ● TGT GAC GAA TTC ATC AAT GTG CCG GAA TGG TCT TAC ATA GTG GAG AAG GCC AGT CCA GCC C D E F I N V P E W S Y I V E K A S P A 86

AAT GAC CTC TGT TAC CCA GGG GAT TTC AAC GAC TAT GAA GAA CTG AAA CAC CTA TTG AGC ♦ ♦ N D L C Y P G D F N D Y E E L K H L L S 106 ♦ ● ♦● ●

AGC ACA AAC CAT TTT GAG AAA ATT CAG ATC ATC CCC AAA AGT TCT TGG TCC AAT CAT GAT S T N H F E K I Q I I P K S S W S N H D 126 ♦● ♦ ♦ ● ♦● ♦● ●

GCC TCA TCA GGG GTG AGC TCA GCA TGT CCA TAC CAT GGG AGG TCC TCC TTT TTC AGA AAT A S S G V S S A C P Y H G R S S F F R N 146 ♦ ♦ ●

GTG GTA TGG CTT ATC AAA AAG AAC AGT GCA TAC CCA ACA ATA AAG AGG AGC TAC AAT AAT V V W L I K K N S A Y P T I K R S Y N N 166 ♦ ♦ ♦ ♦ ACC AAC CAA GAA GAT CTT TTG GTA ATG TGG GGG ATT CAC CAT CCT AAT GAT GCG GCA GAG T N Q E D L L V M W G I H H P N D A A E 186 ♦ ♦● ♦

CAG ACA AAG CTC TAT CAA AAC CCA ACC ACC TAT ATT TTC ATT GGG ACA TCA ACA CTA AAC Q T K L Y Q N P T T Y I F I G T S T L N 206

♦● ♦ ♦ ♦ ▲ ♦● ▲

CAG AGA TTG GTA CCA AAA ATA GCT ACT AGA TCC AAA GTA AAC GGG CAA AGT GGA AGG ATG Q R L V P K I A T R S K V N G Q S G R M 226 GAG TTC TTC TGG ACA ATT TTA AAA CCT AAT GAT GCA ATC AAC TTC GAG AGT AAT GGA AAT E F F W T I L K P N D A I N F E S N G N 246 ♦●

TTC ATT GCT CCA GAA TAT GCA TAC AAA ATT GTC AAG AAA GGG GAC TCA GCA ATT ATG AAA F I A P E Y A Y K I V K K G D S A I M K 266 AGT GAA TTG GAA TAT GGT AAC TGC AAC ACC AAG TGT CAA ACT CCA ATG GGG GCG ATA AAC S E L E Y G N C N T K C Q T P M G A I N 286 TCT AGT ATG CCA TTC CAC AAC ATA CAC CCT CTC ACC ATC GGG GAA TGC CCC AAA TAT GTG S S M P F H N I H P L T I G E C P K Y V 306 ♣ ♣ ♣ ♣ ♣ AAA TCC AAC CGA TTA GTC CTT GCG ACT GGA CTC AGA AAT ACC CCT CAA AGA GAG AGA AGA K S N R L V L A T G L R N T P Q R E R R 326 ♣ ♣ ♣ ♣ 1 HA2 AGA AAA AAG AGA GGA CTA TTT GGA GCT ATA GCA GGT TTT ATA GAG GGA GGA TGG CAG GGA R K K R G L F G A I A G F I E G G W Q G 16 ATG GTA GAT GGT TGG TAT GGG TAC CAC CAT AGC AAT GAG CAG GGG AGT GGG TAC GCT GCA M V D G W Y G Y H H S N E Q G S G Y A A 36 GAC AAA GAA TCC ACT CAA AAG GCA ATA GAT GGA GTC ACC AAT AAG GTC AAC TCA D K E S T Q K A I D G V T N K V N S 54 ● :daerah antigenik ▲ : residu pengikat reseptor ♦ :kantong pengikat reseptor ♣ :daerah pemotongan Æ : batas subunit HA1 :peptida fusi

Garis bawah: posisi glikosilasi :signal promoter

Gambar 14. Gen penyandi hemaglutinin dan turunan asam aminonya virus isolat

A/goose/Leuwiliang/IPB4-RS/2006(H5N1)

(20)

● HA1 ACA CAT GCT CAG GAC ATA CTG GAA AAG ACA CAC AAC GGG AAG CTC TGC GAT CTA AAT GGA T H A Q D I L E K T H N G K L C D L N G 46 GTG AAG CCT CTC ATT TTG AGA GAT TGT AGT GTA GCT GGA TGG CTC CTC GGA AAC CCT ATG V K P L I L R D C S V A G W L L G N P M 66 ● ● ● TGT GAC GAA TTC ATC AAT GTG CCG GAA TGG TCT TAC ATA GTG GAG AAG GCC AGT CCA GCC C D E F I N V P E W S Y I V E K A S P A 86

AAT GAC CTC TGT TAC CCA GGG GAT TTC AAC GAC TAT GAA GAA CTG AAA CAC CTA TTG AGC ♦ ♦ N D L C Y P G D F N D Y E E L K H L L S 106 ♦ ● ♦● ●

AGC ACA AAC CAT TTT GAG AAA ATT CAG ATC ATC CCC AAA AGT TCT TGG TCC AAT CAT GAT S T N H F E K I Q I I P K S S W S N H D 126 ♦● ♦ ♦ ● ♦● ♦● ●

GCC TCA TCA GGG GTG AGC TCA GCA TGT CCA TAC CAT GGG AGG TCC TCC TTT TTC AGA AAT A S S G V S S A C P Y H G R S S F F R N 146

GTG GTA TGG CTT ATC AAA AAG AAC AGT GCA TAC CCA ACA ATA AAG AGG AGC TAC ♦ ♦ AAT AAT V V W L I K K N S A Y P T I K R S Y N N 166 ♦ ♦ ♦ ♦

ACC AAC CAA GAA GAT CTT TTG GTA ATG TGG GGG ATT CAC CAT CCT AAT GAT GCG GCA GAG T N Q E D L L V M W G I H H P N D A A E 186 ♦ ♦● ♦

CAG ACA AAG CTC TAT CAA AAC CCA ACC ACC TAC ATT TCC GTT GGA ACA TCA ACA ATA AAT Q T K L Y Q N P T T Y I S V G T S T I N 206 ♦● ♦ ♦ ♦ ▲ ♦● ▲

CAA AGG TTG GTA CCA AAA ATA GCT ACT AGA TCC AAA GTA AAC GGG CAA AGT GGA AGG ATG Q R L V P K I A T R S K V N G Q S G R M 226

GAG TTC TTC TGG ACA ATT TTA AAA CCT AAT GAT GCA ATC AAC TTC GAG AGT AAT GGA AAT E F F W T I L K P N D A I N F E S N G N 246 ♦●

TTC ATT GCT CCA GAA TAT GCA TAC AAA ATT GTC AAG AAA GGG GAC TCA GCA ATT ATG AAA F I A P E Y A Y K I V K K G D S A I M K 266 AGT GAA TTG GAA TAT GGT AAC TGC AAC ACC AAG TGT CAA ACT CCA ATG GGG GCG ATA AAC S E L E Y G N C N T K C Q T P M G A I N 286 TCT AGT ATG CCA TTC CAC AAC ATA CAC CCT CTC ACC ATC GGG GAA TGC CCC AAA TAT GTG S S M P F H N I H P L T I G E C P K Y V 306 ♣ ♣ ♣ ♣ ♣ AAA TCA AAC AGA TTA ATC CTT GCG ACT GGA CTC AGA AAT ACC CCT CAA AGA GAG AGA AGA K S N R L I L A T G L R N T P Q R E R R 326 ♣ ♣ ♣ ♣ 1 HA2 AGA AAA AAG AGA GGA CTA TTT GGA GCT ATA GCA GGT TTT ATA GAG GGA GGA TGG CAG GGA R K K R G L F G A I A G F I E G G W Q G 16 ATG GTA GAT GGT TGG TAT GGG TAC CAC CAT AGC AAT GAG CAG GGG AGT GGG TAC GCT GCA M V D G W Y G Y H H S N E Q G S G Y A A 36 GAC AAA GAA TCC ACT CAA AAG GCA ATA GAT GGA GTC ACC AAT AAG GTC AAC TCG D K E S T Q K A I D G V T N K V N S 54 ● :daerah antigenik ▲ : residu pengikat reseptor ♦ :kantong pengikat reseptor ♣ :daerah pemotongan Æ : batas subunit HA1 : peptida fusi

Garis bawah: posisi glikosilasi

Gambar 15. Gen penyandi hemaglutinin dan turunan asam aminonya virus isolat

A/muscovy duck/Cileungsi/IPB5-RS/2006(H5N1)

(21)

● HA1 ACA CAT GCT CAA GAC ATA CTG GAA AAG ACA CAC AAC GGG AAG CTC TGC GAT CTA GAT GGA T H A Q D I L E K T H N G K L C D L D G 46 GTG AAG CCT CTA ATT TTG AGA GAT TGT AGT GTA GCT GGA TGG CTC CTC GGA AAC CCA ATG V K P L I L R D C S V A G W L L G N P M 66 ● ● ● TGT GAC GAA TTC ATC AAT GTG CCG GAA TGG TCT TAC ATA GTG GAG AAG GCC AAT CCA GCC C D E F I N V P E W S Y I V E K A N P A 86 ♦ ♦

AAT GAC CTC TGT TAC CCA GGG AAT TTC AAC GAC TAT GAA GAA CTG AAA CAC CTA TTG AGC N D L C Y P G N F N D Y E E L K H L L S 106 ♦ ● ♦● ●

AGA ATA AAC CAT TTT GAG AAA ATT CAA ATC ATC CCC AAA AGT TCT TGG TCC AAT CAT GAA R I N H F E K I Q I I P K S S W S N H E 126 ♦● ♦ ♦ ● ♦● ♦● ●

GCC TCA TCA GGG GTG AGC TCA GCA TGT CCA TAC CAG GGA AGT TCC TCC TTT TTT AGA AAT A S S G V S S A C P Y Q G S S S F F R N 146 ♦ ♦ ●

GTG GTA TGG CTT ATC AAA AAG AAC AGT ACA TAC CCA ACA ATA AAG AGG AGC TAC AAT AAT V V W L I K K N S T Y P T I K R S Y N N 166 ♦ ♦ ♦ ♦ ACC AAC CAA GAA GAT CTT TTG GTA CTG TGG GGA ATT CAC CAT CCT AAT GAT GCG GCA GAG T N Q E D L L V L W G I H H P N D A A E 186 ♦ ♦● ♦

CAG ACA AAG CTA TAT CAA AAC CCA ACC ACC TAT ATT TCC GTT GGA ACA TCA ACA CTA AAC Q T K L Y Q N P T T Y I S V G T S T L N 206

♦● ♦ ♦ ♦ ▲ ♦● ▲

CAA AGA TTG GTA CCA AAA ATA GCT ACT AGA TCC AAA GTA AAC GGG CAA AGT GGA AGG ATG Q R L V P K I A T R S K V N G Q S G R M 226 GAG TTC TTC TGG ACA ATT TTA AAA CCT AAT GAT GCA ATC AAC TTC GAG AGT AAT GGA AAT E F F W T I L K P N D A I N F E S N G N 246 ♦●

TTC ATT GCT CCA GAA TAT GCA TAC AAA ATT GTC AAG AAA GGG GAC TCA GCA ATT ATG AAA F I A P E Y A Y K I V K K G D S A I M K 266 AGT GAA TTG GAA TAT GGT AAC TGC AAC ACC AAG TGT CAA ACT CCA ATG GGG GCG ATA AAC S E L E Y G N C N T K C Q T P M G A I N 286 TCT AGT ATG CCA TTC CAC AAC ATA CAC CCT CTC ACC ATC GGG GAA TGC CCC AAA TAT GTG S S M P F H N I H P L T I G E C P K Y V 306 ♣ ♣ ♣ ♣ ♣ AAA TCA AAC AGA TTA GTC CTT GCG ACT GGG CTC AGA AAT AGC CCT CAA AGA GAG AGA AGA K S N R L V L A T G L R N S P Q R E R R 326 ♣ ♣ ♣ ♣ 1 HA2 AGA AAA AAG AGA GGA CTA TTT GGA GCT ATA GCA GGT TTT ATA GAA GGA GGA TGG CAG GGG R K K R G L F G A I A G F I E G G W Q G 16 ATG GTA GAT GGT TGG TAT GGG TAC CAC CAT AGC AAT GAG CAG GGG AGT GGG TAC GCT GCA M V D G W Y G Y H H S N E Q G S G Y A A 36 GAC AAA GAA TCC ACT CAA AAG GCA ATA GAT GGA GTC ACC AAT AAG GTC AAC TCA ATT ATT D K E S T Q K A I D G V T N K V N S I I 56 GAC AAA ATG AAC ACT CAG GTT GAG GCT ATA AAA D K M N T Q V E A I K 67 ● :daerah antigenik ▲ : residu pengikat reseptor ♦ :kantong pengikat reseptor ♣ :daerah pemotongan Æ : batas subunit HA1 : peptida fusi

Garis bawah: posisi glikosilasi

Gambar 16. Gen penyandi hemaglutinin dan turunan asam aminonya virus isolat

A/duck/Nagrak/IPB6-RS/2006(H5N1)

(22)

● HA1 ACA CAT GCT CAA GAC ATA CTG GAA AAG ACA CAC AAC GGG AAG CTC TGC GAT CTA GAT GGA T H A Q D I L E K T H N G K L C D L D G 46 GTG AAG CCT CTA ATT TTA AGA GAT TGT AGT GTA GCT GGA TGG CTC CTC GGG AAC CCA ATG V K P L I L R D C S V A G W L L G N P M 66 ● ● ● TGT GAC GAA TTC ATC AAT GTA CCG GAA TGG TCT TAC ATA GTG GAG AAG GCC AAT CCA ACC C D E F I N V P E W S Y I V E K A N P T 86 ♦ ♦

AAT GAC CTC TGT TAC CCA GGG AGT TTC AAC GAC TAT GAA GAA CTG AAA CAC CTA TTG AGC N D L C Y P G S F N D Y E E L K H L L S 106 ♦ ● ♦● ●

AGA ATA AAC CAT TTT GAG AAG ATT CAA ATC ATC CCC AAA AGT TCT TGG TCC GAT CAT GAA R I N H F E K I Q I I P K S S W S D H E 126 ♦● ♦ ♦ ● ♦● ♦● ●

GCC TCA TCA GGA GTG AGC TCA GCA TGT CCA TAC CTG GGA AGT CCC TCC TTT TTT AGA AAT A S S G V S S A C P Y L G S P S F F R N 146 ♦ ♦ ●

GTG GTA TGG CTT ATC AAA AAG AAC AGT ACA TAC CCA ACA ATA AAG AAA AGC TAC AAT AAT V V W L I K K N S T Y P T I K K S Y N N 166 ♦ ♦ ♦ ♦ ACC AAC CAA GAA GAT CTT TTG GTA CTG TGG GGA ATT CAC CAT CCT AAT AAT GCG GCA GAG T N Q E D L L V L W G I H H P N N A A E 186 ♦ ♦● ♦

CAG ACA AGG CTA TAT CAA AAC CCA ACC ACC TAT ATT TCC ATT GGG ACA TCA ACA CTA AAC Q T R L Y Q N P T T Y I S I G T S T L N 206 ♦● ♦ ♦ ♦ ▲ ♦● ▲

CAA AGA TTG GTA CCA AAA ATA GCT ACT AGA TCC AAA GTA AAC GGG CAA AGT GGA AGG ATG Q R L V P K I A T R S K V N G Q S G R M 226 GAG TTC TTC TGG ACA ATT TTA AAA CCT AAT GAT GCA ATC AAC TTC GAG AGT AAT GGA AAT E F F W T I L K P N D A I N F E S N G N 246 ♦●

TTC ATT GCT CCA GAA TAT GCA TAC AAA ATT GTC AAG AAA GGG GAC TCA GCA ATT ATG AAA F I A P E Y A Y K I V K K G D S A I M K 266 AGT GAA TTG GAA TAT GGT AAC TGC AAC ACC AAG TGT CAA ACT CCA ATG GGG GCG ATA AAC S E L E Y G N C N T K C Q T P M G A I N 286 TCT AGT ATG CCA TTC CAC AAC ATA CAC CCT CTC ACC ATC GGG GAA TGC CCC AAA TAT GTG S S M P F H N I H P L T I G E C P K Y V 306 ♣ ♣ ♣ ♣ ♣ AAA TCA AAC AGA TTA GTC CTT GCG ACT GGA CTC AGA AAT ACC CCT CAA AGA GAG AGA AGA K S N R L V L A T G L R N T P Q R E R R 326 ♣ ♣ ♣ ♣ 1 HA2 AGA AAA AAG AGA GGA CTA TTT GGA GCT ATA GCA GGT TTT ATA GAG GGA GGA TGG CAG GGA

R K K R G L F G A I A G F I E G G W Q G 16 ATG GTA GAT GGT TGG TAT GGG TAC CAC CAT AGC AAT GAG CAG GGG AGA GGG TAC GCT GCA M V D G W Y G Y H H S N E Q G R G Y A A 36 GAC AAA GAA TCC ACT CAA AAG GCA ATA GAT GGA GTC ACC AAT AAG GTC AAC TCA ATT ATT D K E S T Q K A I D G V T N K V N S I I 56 GAC AAA ATG AAC ACC D K M N T 60 ● :daerah antigenik ▲ : residu pengikat reseptor ♦ :kantong pengikat reseptor ♣ :daerah pemotongan Æ : batas subunit HA1 : peptida fusi

Garis bawah: posisi glikosilasi

Gambar 17. Gen penyandi hemaglutinin dan turunan asam aminonya virus isolat

A/goose/Klapanunggal/IPB7-RS/2006(H5N1)

(23)

● HA1 ACA CAT GCT CAG GAC ATA CTG GAA AAG ACA CAC AAC GGG AAG CTC TGC GAT CTA GAT GGA T H A Q D I L E K T H N G K L C D L D G 46 GTG AAG CCT CTA ATT TTA AGA GAT TGT AGT GTA GCT GGA TGG CTC CTC GGG AAC CCA ATG V K P L I L R D C S V A G W L L G N P M 66 ● ● ● TGT GAC GAA TTC ATC AAT GTA CCG GAA TGG TCT TAC ATA GTG GAG AAG GCC AAT CCA ACC C D E F I N V P E W S Y I V E K A N P T 86 ♦ ♦

AAT GAC CTC TGT TAC CCA GGG AGT TTC AAC GAC TAT GAA GAA CTG AAA CAC CTA TTG AGC N D L C Y P G S F N D Y E E L K H L L S 106 ♦ ● ♦● ●

AGA ATA AAC CAT TTT GAG AAG ATT CAA ATC ATC CCC AAA AGT TCT TGG TCC GAT CAT GAA R I N H F E K I Q I I P K S S W S D H E 126

♦● ♦ ♦ ● ♦● ♦● ●

GCC TCA TCA GGA GTG AGC TCA GCA TGT CCA TAC CTG GGA AGT CCC TCC TTT TTT AGA AAT A S S G V S S A C P Y L G S P S F F R N 146 ♦ ♦ ●

GTG GTA TGG CTT ATC AAA AAG AAC AGT ACA TAC CCA ACA ATA AAG AAA AGC TAC AAT AAT V V W L I K K N S T Y P T I K K S Y N N 166 ♦ ♦ ♦ ♦ ACC AAC CAA GAA GAT CTT TTG GTA CTG TGG GGA ATT CAC CAT CCT AAT AAT GCG GCA GAG T N Q E D L L V L W G I H H P N N A A E 186 ♦ ♦● ♦

CAG ACA AGG CTA TAT CAA AAC CCA ACC ACC TAT ATT TCC ATT GGG ACA TCA ACA CTA AAC Q T R L Y Q N P T T Y I S I G T S T L N 206 ♦● ♦ ♦ ♦ ▲ ♦● ▲

CAG AGA TTG GTA CCA AAA ATA GCT ACT AGA TCC AAA GTA AAC GGG CAA AGT GGA AGG ATG Q R L V P K I A T R S K V N G Q S G R M 226

GAG TTC TTC TGG ACA ATT TTA AAA CCT AAT GAT GCA ATC AAC TTC GAG AGT AAT GGA AAT E F F W T I L K P N D A I N F E S N G N 246

♦●

TTC ATT GCT CCA GAA TAT GCA TAC AAA ATT GTC AAG AAA GGG GAC TCA GCA ATT ATG AAA F I A P E Y A Y K I V K K G D S A I M K 266 AGT GAA TTG GAA TAT GGT AAC TGC AAC ACC AAG TGT CAA ACT CCA ATG GGG GCG ATA AAC S E L E Y G N C N T K C Q T P M G A I N 286 TCT AGT ATG CCA TTC CAC AAC ATA CAC CCT CTC ACC ATC GGG GAA TGC CCC AAA TAT GTG S S M P F H N I H P L T I G E C P K Y V 306 ♣ ♣ ♣ ♣ ♣ AAA TCA AAC AGA TTA GTC CTT GCG ACT GGA CTC AGA AAT ACC CCT CAA AGA GAG AGA AGA K S N R L V L A T G L R N T P Q R E R R

♣ ♣ ♣ ♣ 1 HA2 AGA AAA AAG AGA GGA CTA TTT GGA GCT ATA GCA GGT TTT ATA GAG GGA GGA TGG CAG GGA

R K K R G L F G A I A G F I E G G W Q G 16 ATG GTA GAT GGT TGG TAT GGG TAC CAC CAT AGC AAT GAG CAG GGG AGT GGG TAC GCT GCA M V D G W Y G Y H H S N E Q G S G Y A A 36 GAC AAA GAA TCC ACT CAA AAG GCA ATA GAT GGA GTC ACC AAT AAG GTC AAC TCA ATT ATT D K E S T Q K A I D G V T N K V N S I I 56

GAC AAA ATG AAC ACT CAG GTT GAG GCT ATA D K M N T Q V E A I 66

● :daerah antigenik ▲ : residu pengikat reseptor ♦ :kantong pengikat reseptor ♣ :daerah pemotongan Æ : batas subunit HA1 : peptida fusi

Garis bawah: posisi glikosilasi

Gambar 18. Gen penyandi hemaglutinin dan turunan asam aminonya virus isolat

A/duck/Parung/IPB8-RS/2006(H5N1)

(24)

● HA1 ACA CAT GCT CAA GAC ATA CTG GAA AAG ACA CAC AAC GGG AAG CTC TGC GAT CTA GAT GGA T H A Q D I L E K T H N G K L C D L D G 46 GTG AAG CCT CTA ATT TTA AGA GAT TGT AGT GTA GCT GGA TGG CTC CTC GGG AAC CCA ATG V K P L I L R D C S V A G W L L G N P M 66 ● ● ● TGT GAC GAA TTC ATC AAT GTA CCG GAA TGG TCT TAC ATA GTG GAG AAG GCC AAT CCA ACC C D E F I N V P E W S Y I V E K A N P T 86 ♦ ♦

AAT GAC CTC TGT TAC CCA GGG AGT TTC AAC GAC TAT GAA GAA CTG AAA CAC CTA TTG AGC N D L C Y P G S F N D Y E E L K H L L S 106 ♦ ● ♦● ●

AGA ATA AAC CAT TTT GAG AAG ATT CAA ATC ATC CCC AAA AGT TCT TGG TCC GAT CAT GAA R I N H F E K I Q I I P K S S W S D H E 126 ♦● ♦ ♦ ● ♦● ♦● ●

GCC TCA TCA GGA GTG AGC TCA GCA TGT CCA TAC CTG GGA AGT CCC TCC TTT TTT AGA AAT A S S G V S S A C P Y L G S P S F F R N 146 ♦ ♦ ●

GTG GTA TGG CTT ATC AAA AAG AAC AGT ACA TAC CCA ACA ATA AAG AAA AGC TAC AAT AAT V V W L I K K N S T Y P T I K K S Y N N 166 ♦ ♦ ♦ ♦ ACC AAC CAA GAA GAT CTT TTG GTA CTG TGG GGA ATT CAC CAT CCT AAT AAT GCG GCA GAG T N Q E D L L V L W G I H H P N N A A E 186 ♦ ♦● ♦

CAG ACA AGG CTA TAT CAA AAC CCA ACC ACC TAT ATT TCC ATT GGG ACA TCA ACA CTA AAC Q T R L Y Q N P T T Y I S I G T S T L N 206

♦● ♦ ♦ ♦ ▲ ♦● ▲

CAG AGA TTG GTA CCA AAA ATA GCT ACT AGA TCC AAA GTA AAC GGG CAA AGT GGA AGG ATG Q R L V P K I A T R S K V N G Q S G R M 226 GAG TTC TTC TGG ACA ATT TTA AAA CCT AAT GAT GCA ATC AAC TTC GAG AGT AAT GGA AAT E F F W T I L K P N D A I N F E S N G N 246 ♦●

TTC ATT GCT CCA GAA TAT GCA TAC AAA ATT GTC AAG AAA GGG GAC TCA GCA ATT ATG AAA F I A P E Y A Y K I V K K G D S A I M K 266 AGT GAA TTG GAA TAT GGT AAC TGC AAC ACC AAG TGT CAA ACT CCA ATG GGG GCG ATA AAC S E L E Y G N C N T K C Q T P M G A I N 286 TCT AGT ATG CCA TTC CAC AAC ATA CAC CCT CTC ACC ATC GGG GAA TGC CCC AAA TAT GTG S S M P F H N I H P L T I G E C P K Y V 306 ♣ ♣ ♣ ♣ ♣ AAA TCA AAC AGA TTA GTC CTT GCG ACT GGA CTC AGA AAT ACC CCT CAA AGA GAG AGA AGA K S N R L V L A T G L R N T P Q R E R R 326 ♣ ♣ ♣ ♣ 1 HA2 AGA AAA AAG AGA GGA CTA TTT GGA GCT ATA GCA GGT TTT ATA GAG GGA GGA TGG CAG GGA R K K R G L F G A I A G F I E G G W Q G 16 ATG GTA GAT GGT TGG TAT GGG TAC CAC CAT AGC AAT GAG CAG GGG AGT GGG TAC GCT GCA M V D G W Y G Y H H S N E Q G S G Y A A 36 GAC AAA GAA TCC ACT CAA AAG GCA ATA GAT GGA GTC ACC AAT AAG GTC AAC TCA ATT ATT D K E S T Q K A I D G V T N K V N S I I 56 GAC AAA ATG AAC ACT CAG GTT GAG GCA TAT D K M N T Q V E A Y 66 ● :daerah antigenik ▲ : residu pengikat reseptor ♦ :kantong pengikat reseptor ♣ :daerah pemotongan Æ : batas subunit HA1 :peptida fusi

Garis bawah: posisi glikosilasi

Gambar 19. Gen penyandi hemaglutinin dan turunan asam aminonya virus isolat

A/duck/Parung/IPB9-RS/2006(H5N1)

Figur

Memperbarui...

Referensi

Memperbarui...

Related subjects :