BIOTROPIKA Journal of Tropical Biology
https://biotropika.ub.ac.id/
Vol. 10 | No. 3 | 2022 | DOI: 10.21776/ub.biotropika.2022.010.03.04 GENOMIC PROFILE OF OsCOMT IN INDONESIAN PURPLE RICE
PROFIL GEN OsCOMT PADA PADI UNGU INDONESIA
Ernanin Dyah Wijayanti1,2,3, Anna Safitri2,4, Dian Siswanto1, Fatchiyah Fatchiyah1,2)*
ABSTRACT
The Indonesian purple rice (IPR), a crossbreeding of black and white rice, is a potential source of ferulic acid. Up to this point, the genomic similarity between the crossbreeding and its parentals has not been determined, particularly in genes involved in ferulic acid biosynthesis. In this present work, we analysed the profile of Oryza sativa caffeic acid-O- methyltransferase (OsCOMT) gene in IPR. The genomic DNA was extracted by CTAB method, then amplified with a specific primer of OsCOMT gene. The amplicon was sequenced by Sanger method and confirmed by geneID NC_029259.1. The IPR showed an amplicon of 708 bp sequence of the OsCOMT gene, indicating the gene involved in ferulic acid biosynthesis. The IPR gene profile is similar to the parentals, but there are variations in point mutations that distinguish it from the parentals. Aspartic acid was changed to Glutamine by mutations at positions 52, 69, and 79. We suggest that IPR has a novel OsCOMT gene variant that is unique as it is the crossbreed.
Keywords: ferulic acid, genomic, Indonesian purple rice, OsCOMT
ABSTRAK
Padi ungu Indonesia (Indonesian purple rice, IPR), hasil persilangan padi hitam dan putih, merupakan sumber potensial asam ferulat. Kesamaan genomik antara hasil silangan tersebut dengan parentalnya belum diketahui hingga saat ini, terutama pada gen yang terlibat dalam biosintesis asam ferulat. Pada penelitian ini, dilakukan analisis profil gen Oryza sativa caffeic acid-O-methyltransferase (OsCOMT) pada IPR. Ekstraksi DNA genomik dilakukan dengan metode CTAB, kemudian diamplifikasi dengan primer spesifik gen OsCOMT. Amplikon disekuensing dengan metode Sanger dan dikonfirmasi dengan geneID NC_029259.1. Padi IPR menunjukkan amplicon gen OsCOMT dengan sekuen 708 bp, menunjukkan gen yang terlibat dalam biosintesis asam ferulat. Profil gen IPR mirip dengan parental, tetapi terdapat variasi mutasi titik yang membedakannya dari parental.
Asam aspartat diubah menjadi Glutamin melalui mutasi pada posisi 52, 69, dan 79. Padi IPR diduga memiliki varian gen OsCOMT baru yang unik karena merupakan hasil silangan.
Kata kunci: asam ferulat, genomik, OsCOMT, padi ungu Indonesia
INTRODUCTION
The trend of pigmented rice consumption is growing due to increasing public health awareness.
Pigmented rice is richer in nutrients than non- pigmented rice because it is produced without a grinding and polishing process. Some of the biological activities of pigmented rice include antioxidants, antidiabetics, anticancer, anti- obesity, anti-inflammatory, and antimicrobial.
Pigmented rice includes black, red, brown, and purple rice [1, 2, 3, 4].
Among the pigmented rice spread in Indonesia, there is purple rice produced by crossbreeding between Mentik Wangi black rice (BR-MW) and Mentik Susu white rice (WR-MS) [5]. The crossbreeding is performed to obtain superior- quality rice from black and white rice. The expected properties are not only tasty and high production potential but also high nutritional
content and increased levels of bioactive compounds. Crossbreeding using the seeds of black rice female elders could produce purple bran colour [6].
Previous studies reported the bioactivity of purple rice. The Indonesian purple rice (IPR) has antimicrobial activity by inhibiting growth and destroying bacterial cells [5]. The Thailand purple rice showed a high nutritional source of vitamin E and iron, it has antioxidant, anti-inflammatory and antipruritic activity, potentially as a natural dye in cosmetics [7, 8]. Chinese purple rice suppresses carbohydrate absorption by inhibiting carbohydrate digesting enzyme activity [9].
Another Chinese purple rice (cultivar YF67) from a crossbreeding between black and white rice contains high levels of ferulic acid [10].
Ferulic acid (4-hydroxy-3-methoxy cinnamic acid) is the primary phenolic acid in rice [11, 12].
Ferulic acid is synthesised from L-phenylalanine or
Received : September, 1 2022 Accepted : December, 7 2022
Authors affiliation:
1)Department of Biology, Faculty of Mathematics and Natural Sciences, Brawijaya University, Jl. Veteran Malang 65145, Indonesia
2)Research Center of Smart Molecule of Natural Genetics Resources, Brawijaya University, Jl. Veteran Malang 65145, Indonesia
3)Academy of Pharmacy of Putra Indonesia Malang, Jl. Barito 5 Malang 65123, Indonesia
4)Department of Chemistry, Faculty of Mathematics and Natural Sciences, Brawijaya University, Jl. Veteran Malang 65145, Indonesia
Correspondence email:
*fatchiya@ub.ac.id
How to cite:
Wijayanti, ED, Safitri A, Siswanto D, Fatchiyah F. 2022. Genomic profile of OsCOMT in Indonesian purple rice.
Journal of Tropical Biology 10 (3): 185- 190.
L-tyrosine by the phenylpropanoid pathway [13].
Some genes that play a role in coding enzymes in the biosynthesis of ferulic acid include phenylalanine ammonia-lyase (PAL)/tyrosine ammonia lyase (TAL), cinnamate-4-hydroxylase (C4H), 4-coumarate coenzyme A ligase (4CL), quinate/shikimate p-hydroxycinnamoyl- transferase (HCT), coumarate-3-hydroxylase (C3H), caffeoyl shikimate esterase (CSE), and caffeic acid-O-methyltransferase (COMT) [14], [15]. COMT enzyme converts caffeic acid to ferulic acid [16].
The variation in the level of ferulic acid could be influenced by genetic variability among rice cultivars. The Oryza sativa caffeic acid-O- methyltransferase (OsCOMT) gene involved in the biosynthesis of ferulic acid and might affect the level of ferulic acid in rice. The analysis of this gene will confirm ferulic acid presence at genomic level and reveal the similarities between IPR and its parentals. Therefore, this study focused on investigating the profile of the OsCOMT gene on IPR.
METHODS
Sample collection. We used four cultivars of rice in this research. Indonesian purple rice (IPR), Mentik Wangi black rice (BR-MW), and Mentik Susu white rice (WR-MS) were provided by local farmer in Ngawi region, East Java, Indonesia. The BR-MW and WR-MS are the parentals of IPR.
Jeliteng black rice (BR-J) was obtained from BB- Padi, Balitbangtan, Ministry of Agriculture, Republic of Indonesia. The BR-J is the national standard of black rice.
DNA extraction. The rice genomic DNA was extracted from 20 days-old leaves. The leaves sample was added with liquid nitrogen then homogenised by mortar and pestle. The following
procedures were based on
cetyltrimethylammonium bromide (CTAB) method referred to Fatchiyah et al. [17]. The isolated DNA was quantified using a UV-vis NanoDrop spectrophotometer [18].
The OsCOMT gene amplification. The PCR was conducted to analyse the profile of gene encode the biosynthesis of ferulic acid. Oryza sativa COMT (OsCOMT) gene primers were designed in exon 1 from the NC_029259.1 sequence. The primer pair were OsCOMT (F) 171- 190 - 5’ GCTATCGTGAAGAGTTAAGC 3’ and
OsCOMT (R) 968-948 - 5’
TAGATAAAACCTCGGGCTAC 3’). A total of 50 µL of PCR mixture consisted of 25 µL of 2×
GoTaq®Green Master Mix (Promega, Cat.M712), 1 µL of each primer, 50 ng/µL genomic DNA, and ddH2O. The PCR program was set to 95°C for 30
s, 51°C for 30 s, and extension at 72°C for 120 s, for 35 cycles. The OsCOMT gene was separated by electrophoresis using 1.5% agarose gels, then visualised by chemidoc gel imaging (Biorad, Cat.
No 161-0433) [19].
The OsCOMT gene sequencing. Sequencing was performed using by Sanger method at GATC Biotech AG Cologne Germany. The gene sequence was aligned with the OsCOMT gene sequence from NCBI database (geneID NC_029259.1) using ClustalW multiple alignments by BioEdit software.
The mutations were determined based on differences in nucleotide sequences between the sample sequences and the database [20].
RESULTS AND DISCUSSION
The genomic DNA was successfully isolated from 4 different cultivars of rice leaves. The quantification of DNA yield is presented in Table 1.
Table 1. The quantification of DNA isolated from rice samples
Samples DNA concentration (ng/µL)
A260/A280
ratio
BR-J 55.75 1.83
BR-MW 55.77 2.06
WR-MS 53.79 2.01
IPR 57.69 1.91
BR-J: Jeliteng black rice, BR-MW: Mentik wangi black rice, WR-MS: Mentik susu white rice, IPR: Indonesian purple rice.
The DNA isolate concentration ranged from 53.79 to 57.69 ng/µL, which is sufficient for PCR analysis since it was more than 50 ng/µL [18, 21].
The A260/A280 ratio ranging from 1.83 to 2.06 indicated great purity. The A260/A280 ratios less than 1.8 indicate protein contaminant, whereas ratios greater than 2.0 indicate phenol contaminant [22].
PCR analysis necessitates the use of high purity DNA [21].
The PCR amplified OsCOMT gene in the rice samples. Figure 1 showed a single band of the OsCOMT gene amplicon with targeted sequences of 708 bp (A) and the nucleotide sequence of the OsCOMT gene (B). The nucleotide sequences of IPR are very similar to the parentals. However, we found some mutations occurred in IPR including the substitution of 355C>G, 406C>G, 421C>A, 436T>G, 496A>G, and 883G>A. Among these substitutions, 421C>A, 496A>G, 883G>A were also found in other rice samples. The BR-J and WR-MS also showed 421C>A substitutions, BR- MW showed 883G>C substitution, while 496A>G substitutions were detected in all rice samples.
Figure 1. Profile of the OsCOMT gene in IPR. A. PCR amplification of the OsCOMT gene, B. Sequence alignment of the OsCOMT gene. M: Marker, BR-J: Jeliteng black rice, BR-MW: Mentik wangi black rice, WR-MS: Mentik susu white rice, IPR: Indonesian purple rice.
The OsCOMT is a gene that encodes the caffeic acid-O-methyltransferase (COMT) enzyme, which plays a role in the biosynthesis of ferulic acid [14, 16]. The precursor of ferulic acid is caffeic acid [23]. The COMT facilitates the methylation of caffeic acid to ferulic acid [24]. The exon I of OsCOMT gene encode a sequence of amino acids which involved in the binding of COMT and caffeic acid to produce ferulic acid, as shown in Figure 2. Among the amino acid residue, Gly198, Asp221, and Leu222 are encoded by exon I.
The mutations in IPR can occur since it is a crossbred. Crossbreeding process contributes to genomic shock because the parental genomes are mixed, causing genomic rearrangements in the offspring. This is considered to be the source of the mutations [25].
The mutations in IPR caused changes the arrangement of triplet codon, which codes for the amino acid. The 355C>G, 406C>G, and 436T>G substitutions in IPR showed point mutation from GAC to GAG (amino acid number 52 and 69) and GAU to GAG (amino acid number 79), resulting missense mutation which changed aspartic acid (D)
to glutamine (Q), as seen in the Figure 3. The 421C>A, 496A>G, and 883G>A substitutions changed CUC to CUA, CCA to CCG, and CAG to CAA. However, these changes are silence mutation which has no effect on the encoded amino acid, thus the resulting amino acids remain leucine (L74), proline (P99), and glutamine (Q228), respectively. Fortunately, the missense mutation in IPR did not occur in the amino acid residue of COMT binding site. Therefore, COMT can still bind to caffeic acid and convert it to ferulic acid by methylation.
In performing methylation process, COMT involves S-Adenosyl methionine (SAM), which is the second most used cosubstrate after ATP [26].
The SAM binding domain is highly conserved, which is identified by the sequence LVDVGGGxG [24]. The SAM binding domain is also conserved in COMT of IPR which is indicated by the absence of mutations in the domain sequence (Figure 3).
These findings suggest that the mutations in OsCOMT of IPR have no effect on COMT main function in the methylation process, particularly in converting caffeic acid to ferulic acid.
Figure 2. The exon I of OsCOMT gene encodes for some binding sites of COMT enzyme. A. Schematic diagram of exon I, B. Amino acid sequences translated from exon I, C. The binding sites of COMT enzyme (pink colour) with caffeic acid (blue colour) involves several amino acids encoded by exon I: Gly198, Asp221, and Leu222, D. Ferulic acid, as the product of caffeic acid conversion, and its biological functions.
Figure 3. Sequence alignment of COMT enzyme in IPR. Missense mutations are labelled in blue, silence mutations are labelled in green, binding sites are labelled in pink, and S-Adenosyl methionine binding domain is labelled in yellow. BR-J: Jeliteng black rice, BR-MW: Mentik wangi black rice, WR-MS: Mentik susu white rice, IPR: Indonesian purple rice.
CONCLUSION
The IPR revealed a 708 bp OsCOMT gene with some point mutations that differed from the parentals.
ACKNOWLEDGMENT
We gratefully acknowledge Lembaga Pengelola Dana Pendidikan (LPDP), Ministry of Finance, the Republic of Indonesia for funding the research, and RISPRO-PRN-LPDP-PAJALE research grant for the laboratory facilities. We also thanked to all
members of RC SMONAGENES, Brawijaya University, for the discussions.
REFERENCES
[1] Saha S (2016) Black Rice : The new age super food (an extensive review). Am. Int. J. A Res.
Formal, Appl. Nat. Sci. 16(1): 51–55.
[2] Fatchiyah F, Sari DRT, Safitri A, Cairns JRK (2020) Phytochemical compound and nutritional value in black rice from Java Island, Indonesia. Syst. Rev. Pharm. 11(7):
414–421. doi: 10.31838/srp.2020.7.61.
[3] Seechamnanturakit V, Karrila TT, Sontimuang C, Sukhoom A (2018) The natural pigments in pigmented rice bran and their relation to human health: A literature review. KMUTNB Int. J. Appl. Sci. Technol.
11(1): 3–13. doi:
10.14416/j.ijast.2018.01.004.
[4] Sivamaruthi BS, Kesika P, Chaiyasut C (2018) Anthocyanins in Thai rice varieties:
Distribution and pharmacological significance. Int. Food Res. J. 25(5): 2024–
2032.
[5] Wijayanti ED, Safitri A, Siswanto D, Triprisila LF, Fatchiyah F (2021) Antimicrobial activity of ferulic acid in Indonesian purple rice through toll-like receptor signaling. Makara J. Sci. 25(4): 247–
257. doi: 10.7454/mss.v25i4.1266.
[6] Kristamtini, Taryono, Basunanda P, Murti RH (2019) Inheritance of pericarp pigment on crossing between black rice and white rice.
Songklanakarin J. Sci. Technol. 41(2): 383–
388. doi: 10.14456/sjst-psu.2019.48.
[7] Wongwichai T, Teeyakasem P, Pruksakorn D, Kongtawelert P, Pothacharoen P (2019) Anthocyanins and metabolites from purple rice inhibit IL-1β-induced matrix metalloproteinases expression in human articular chondrocytes through the NF-κB and
ERK/MAPK pathway. Biomed.
Pharmacother. 112: 108610. doi:
10.1016/j.biopha.2019.108610.S.
[8] Lourith N, Kanlayavattanakul M (2012) Antioxidant color of purple glutinous rice (Oryza sativa) color and its stability for cosmetic application. Adv. Sci. Lett. 17(1):
302–305. doi: 10.1166/asl.2012.4263.
[9] Shimoda H, Aitani M, Tanaka J, Hitoe S (2015) Purple rice extract exhibits preventive activities on experimental diabetes models and human subjects. Rice Res. Open Access.
03(02): 2–5. doi: 10.4172/2375- 4338.1000137.
[10] Zhang H, Shao Y, Bao J, Beta T (2015) Phenolic compounds and antioxidant properties of breeding lines between the white and black rice. Food Chem. 172: 630–639.
doi: 10.1016/j.foodchem.2014.09.118.
[11] Huang YP, Lai HM (2016) Bioactive compounds and antioxidative activity of colored rice bran. J. Food Drug Anal. 24(3):
564–574. doi: 10.1016/j.jfda.2016.01.004.
[12] Mbanjo EGN, Kretzschmar T, Jones H, Ereful N, Blanchard C, Boyd LA, Sreenivasulu N (2020) The genetic basis and nutritional benefits of pigmented rice grain. Front. Genet.
11: 1–18. doi: 10.3389/fgene.2020.00229.
[13] de Paiva LB, Goldbeck R, dos Santos WD,
Squina FM (2013) Ferulic acid and derivatives: Molecules with potential application in the pharmaceutical field.
Brazilian J. Pharm. Sci. 49(3): 395–411. doi:
10.1590/S1984-82502013000300002.
[14] Tang Y, Liu F, Xing H, Mao K, Chen G, Guo Q, Chen J (2019) Correlation analysis of lignin accumulation and expression of key genes involved in lignin biosynthesis of ramie (Boehmeria nivea). Genes (Basel). 10(5): 1–
13. doi: 10.3390/genes10050389.
[15] de Oliveira DM, Finger-Teixeira A, Mota TR, Salvador VH, Moreira-Vilar FC, Molinari HBC, Mitchell RAC, Marchiosi R, Ferrarese- Filho O, dos Santos WD (2015) Ferulic acid:
A key component in grass lignocellulose recalcitrance to hydrolysis. Plant Biotechnol.
J. 13(9): 1224–1232. doi: 10.1111/pbi.12292.
[16] Guo D, Chen F, Inoue K, Blount JW, Dixon RA (2001) Downregulation of caffeic acid 3- O-methyltransferase and caffeoyl CoA 3-O- methyltransferase in transgenic alfalfa:
Impacts on lignin structure and implications for the biosynthesis of G and S lignin. Plant Cell. 13(1): 73–88. doi: 10.1105/tpc.13.1.73.
[17] Fatchiyah, Arumingtyas EL, Widyarti S, Rahayu S (2011) Biologi molekuler: Prinsip dasar analisis. Erlangga. Jakarta.
[18] Sari DRT, Paemanee A, Roytrakul S, Cairns JRK, Safitri A, Fatchiyah F (2021) Black rice cultivar from Java Island of Indonesia revealed genomic, proteomic, and anthocyanin nutritional value. Acta Biochim.
Pol. 68(5386): 1–9.
[19] Hermawan I, Amin M, Suhadi (2022) Genetic diversity of springtails (Collembola subclass) based o n cytochrome oxidase subunit I (COI) genes in Malang. BIOTROPIKA J. Trop.
Biol. 10(1): 67–77. doi:
10.21776/ub.biotropika.2022.010.01.09.
[20] Tambunan SH, Meidinna HN, Rohmah RN, Fatchiyah F (2019) Genomic profile of rIR and rIRR in type 2 diabetes mellitus rat model toward effect of goat milk CSN1S2 protein. J.
Phys. Conf. Ser. 1374(1): 1–6. doi:
10.1088/1742-6596/1374/1/012046.
[21] Devi KD, Punyarani K, Singh NS, Devi HS (2013) An efficient protocol for total DNA extraction from the members of order Zingiberales-suitable for diverse PCR based downstream applications. Springerplus 2 (669): 1–9.
[22] Kachiprath B, Jayanath G, Solomon S, Manomi S (2018) CTAB influenced differential elution of metagenomic DNA from saltpan and marine sediments. 3 Biotech 8(44): 1–5. doi: 10.1007/s13205-017-1078-x.
[23] Silva E de O, Batista R (2017) Ferulic acid and
naturally occurring compounds bearing a feruloyl moiety: A review on their structures, occurrence, and potential health benefits.
Compr. Rev. Food Sci. Food Saf. 16(4): 580–
616. doi: 10.1111/1541-4337.12266.
[24] Trabucco G, Matos DA, Lee SJ, Saathoff AJ, Priest HD, Mockler TC, Sarath G, Hazen SP (2013) Functional characterisation of cinnamyl alcohol dehydrogenase and caffeic acid O-methyltransferase in Brachypodium distachyon. BMC Biotechnol. 13(61): 1–18.
[25] Bashir T, Mishra RC, Hasan MM, Mohanta TK, Bae H (2018) Effect of hybridisation on somatic mutations and genomic rearrangements in plants. Int. J. Mol. Sci.
19(3758): 1–14. doi: 10.3390/ijms19123758.
[26] Fukumoto K, Ito K, Saer B, Taylor G, Ye S, Yamano M, Toriba Y, Hayes A, Okamura H, Fustin J (2022) Excess S-adenosylmethionine inhibits methylation via catabolism to adenine. Commun. Biol. 5(313): 1–15. doi:
10.1038/s42003-022-03280-5.
