• Tidak ada hasil yang ditemukan

Directory UMM :Data Elmu:jurnal:B:Brain Research:Vol887.Issue2.Dec2000:

N/A
N/A
Protected

Academic year: 2017

Membagikan "Directory UMM :Data Elmu:jurnal:B:Brain Research:Vol887.Issue2.Dec2000:"

Copied!
9
0
0

Teks penuh

(1)

www.elsevier.com / locate / bres

Research report

The cardiac sodium channel mRNA is expressed in the developing

and adult rat and human brain

a ,

*

b b c

Laurel M. Donahue

, Penelope W. Coates , Vaughan H. Lee , Denise C. Ippensen ,

c c

Steven E. Arze , Shirley E. Poduslo

a

Cascade Biologics, Inc., 4475 SW Scholls Ferry Road, Portland, OR 97225, USA

b

Department of Cell Biology and Biochemistry, Texas Tech University Health Sciences Center, Lubbock, TX 79430, USA

c

Division of Neurology, Texas Tech University Health Sciences Center, Lubbock, TX 79430, USA Accepted 26 September 2000

Abstract

Expression of the rat (RH-I / SkM2) and human (hH1 / SCN5A) tetrodotoxin-resistant (TTX-R), voltage-sensitive sodium channels is thought to be specific to cardiac tissue. We detected RH-I / SkM2 mRNA in newborn rat brain using both RNase protection assay analysis and in situ hybridization and in adult rat brain using RNase protection assay analysis. This expression was observed primarily in developing limbic structures of the cerebrum and diencephalon, and in the medulla of the brain stem. Using RT-PCR analysis, we detected hH1 / SCN5A mRNA in both fetal and adult human brain. Interestingly, mutations in the human cardiac sodium channel are known to lead to cardiac abnormalities, which result in arrhythmias and frequently in sudden cardiac death. If these mutant channels were also expressed in limbic regions of the brain, alterations in channel function could have drastic effects on the brain’s signaling ability, possibly promoting seizure activity.  2000 Elsevier Science B.V. All rights reserved.

Theme: Excitable membranes and synaptic transmission

Topic: Sodium channels

Keywords: Cardiac sodium channel; RH-1 / SkM2; hH1 / SCN5A; Limbic; mRNA expression; Long QT3 syndrome

1. Introduction

cardiac cells [2,3,6,10,11,20,22,23,34,42,46,48,49,54,60].

In addition, they are also expressed in glial cells

Voltage gated sodium channels (sodium channels) are

[3,6,10,24,48,51]

and

other

peripheral

tissues

essential for the electrical excitability of neurons and other

[3,8,20,23,24,26,28,35,36,42]. Although the sodium

chan-excitable cells. Sodium channels comprise a multigene

nel isoforms were originally defined based on the tissue or

family with two subfamilies determined by sequence

cell type from which they were isolated (rat brain I, II, and

homology [10]. Within each family, the channel subtypes

III, the cardiac channel, and the glial channel), they are

are distinguished by their single channel conductance and

actually expressed in a variety of tissues. In fact, many

sensitivity to pharmacological agents [22,34,60]. Sodium

tissues

express

multiple

channel

isoforms

[5,7–

channels are expressed in a number of different cell types,

10,17,18,21,22,24,29,39,47,53,56,57]. For example, the rat

including excitable cells, such as central nervous system

brain I and II sodium channels, as well as the glial sodium

(CNS) neurons, peripheral nervous system (PNS) sensory

channel, are expressed in rat spinal sensory neurons [9].

neurons, neuroendocrine cells, skeletal muscle cells, and

Sodium channels vary in their sensitivity to tetrodotoxin

(TTX), a guanidinium neurotoxin that interacts exclusively

with sodium channels [22,28,60]. Sodium channels are

broadly divided into three classes based on their sensitivity

to TTX [18,62]. Those demonstrating the highest TTX

*Corresponding author. Tel.: 11-503-292-9521; fax: 1

1-503-292-sensitivity are designated TTX-sensitive (TTX-S) channels

0566.

E-mail address: [email protected] (L.M. Donahue).

and are blocked with low concentrations of TTX (1–5

(2)

nM); those with intermediate sensitivity, TTX-resistant

2. Materials and methods

(TTX-R) channels, require higher concentrations of TTX

(0.2–1

m

M) for inactivation; and those with the lowest

2.1. RNA isolation and quantification

sensitivity, TTX-insensitive (TTX-I) channels, are blocked

only with very high concentrations of TTX (30–100

m

M).

Total RNA from adult rat heart, and adult and postnatal

To date, there are five cloned sodium channels that are not

day 0 (P0) Sprague–Dawley rat brains was isolated as

1

TTX-S: the rat RH-I / SkM2 and the human HH1 / SCN5A

described previously [19]. Poly (A)

RNA from HeLa

cardiac sodium channel genes, whose gene products are

cells (human cervical epithelial carcinoma cells; American

TTX-R [60], the rat and the human NaN / SNS2 sensory

Type Culture Collection, Rockville, MD) was also isolated

neuron sodium channel gene products which are TTX-I

as described previously [17]. Total RNA from adult human

[13], and the rat SNS / PN3 sensory neuron sodium channel

heart, and adult and fetal human brain was obtained from

gene product, which is TTX-I [2,46].

Clontech Laboratories, Inc. (Palo Alto, CA). The

con-One of the most extensively studied sodium channels is

centration of each RNA was estimated by optical density

the cardiac sodium channel. It has been cloned from rat

measurements and the relative amounts of RNAs used in

(RH-I / SkM2) and human (HH1 / SCN5A) cardiac cDNA

the RNase protection assays were normalized to

cyto-libraries [25,33,45,55]. Electrophysiological studies of rat

plasmic actin mRNA levels.

and human cardiac sodium channels expressed in Xenopus

oocytes demonstrated that RH-I / SkM2 and HH1 / SCN5A

are the functional TTX-R sodium channels expressed by

2.2. RNase protection assay

cardiac cells [22,32]. RH-I / SkM2 is expressed in neonatal

and adult rat heart: neonatal heart expresses solely RH-I /

RNase protection assays were performed as previously

SkM2, whereas adult heart expresses both RH-I / SkM2 and

described ([19]; RPA II kit, Ambion, Austin, TX). In

a TTX-S NaCh current [33,45,49]. RH-I / SkM2 expression

assays for RH-1 / SkM2 expression, 50

m

g of total RNA

is also present in neonatal skeletal muscle and in de-

from P0 and adult rat brain, 5

m

g of total RNA from adult

nervated adult muscle, but is absent in innervated adult

rat heart, and 5

m

g of total RNA from yeast were

4 32

muscle [33,45]. The expression of HH1 / SCN5A has only

hybridized to 5

3

10 cpm of the

P-labeled RH-1 / SkM2

been examined in adult tissues and while generally re-

antisense RNA probe. The 414 nucleotide (nt)

gene-spe-ported to be specific to cardiac tissue [25], a few reports

cific probe for RH-1 / SkM2 was generated by BamHI

demonstrate its localization in adult rat brain [18,30,59,61].

linearization of the plasmid SK- / 15-2-1 and transcription

To date, the sodium channel genes that have been cloned

with T7 polymerase. The Sk- / 15-2-1 plasmid ([33]; gift

from rat brain are TTX-S (I, II, III, and NaCh6

from Dr. Roland Kallen, University of Pennsylvania,

[4,16,27,38,50,53]). Although earlier studies failed to

Philadelphia, PA) contained nucleotides 6718–7076 from

distinguish between the TTX-R and TTX-I sodium channel

the 3

9

untranslated region of the mRNA. The expected size

currents, several studies suggest that both kinds of current

of the protected fragment was 358 nt. RPAs were also

exist in the CNS [14,31,43,52,58,60]. However, the genes

performed using a cytoplasmic actin antisense RNA probe

responsible for the TTX-R and the TTX-I currents in the

to control for RNA load. In this case, 5

m

g of each of the

4 32

CNS have not yet been identified. Because we demon-

RNAs were hybridized to 1

3

10 cpm of the

P-labeled

strated expression of the rat RH-I / SkM2 cardiac channel

actin antisense RNA probe. The template for cytoplasmic

mRNA in the neuronal cell lines, RT4-B8 and RT4-E5

actin (pTRI-

b

-Actin-125-Rat) was obtained from Ambion

[17] and others detected its expression in B104 neuro-

(Austin, TX); a 218 nt antisense RNA probe was

syn-blastoma cells [29], we hypothesized that expression of

thesized using SP6 polymerase. The predicted size of the

this gene might be responsible for the TTX-R current in

protected fragment was 126 nt. Both the RH-1 / SkM2 and

the nervous system. In fact, using RNase protection assays

actin antisense RNA probes were synthesized using the

of total brain RNA, we and others have observed RH-I /

Riboprobe System kit (Promega Corporation, Madison,

SkM2 mRNA expression in neonatal and adult rat brain

WI). RPAs were visualized both by autoradiography and

[18,59,61].

by using a Molecular Dynamics PhosphoImager 445SI

In this study, we demonstrate that RH-I / SkM2 and

(Sunnyvale, CA). Band intensities were quantified using

HH1 / SCN5A mRNAs were expressed in both developing

ImageQuaNT software (Molecular Dynamics).

and adult rat and human brain by RNase protection assay

and RT-PCR analyses. In situ hybridization of P0 rat brain

further demonstrated that RH-I / SkM2 mRNA expression

2.3. In situ hybridization

was localized to limbic and certain autonomic structures of

(3)

m

m serial coronal sections. Sections were de-paraffinized,

expression of the RH-I / SkM2 cardiac sodium channel

dehydrated through a series of ethanol washes, washed in

gene in P0 and adult rat brain (Fig. 1). When qualitatively

PBS, subjected to Proteinase K (20

m

g / ml) digestion, and

normalized to levels of cytoplasmic actin mRNA

expres-pre-hybridized for 2–4 h at room temperature [32,38].

sion (Fig. 1B), RH-I / SkM2 mRNA was detected at

Sections were hybridized at 50

8

C for 16–20 h with 2 ng of

roughly equal levels in both P0 and adult rat brain in three

35

either the

S-labeled RH-1 / SkM2 sense or antisense RNA

separate experiments (representative example shown in

probe from the plasmid SK- / 15-2-1 ([33]; specific activity

Fig. 1A). As expected, RH-I / SkM2 mRNA was detected

of the probes ranged from 12 to 23

m

Ci /

m

g). The sense

in the rat heart RNA positive control, but not in the

probe was generated by linearizing the SK- / 15-2-1 plas-

negative control, yeast RNA.

mid with SalI followed by transcription with T3

poly-merase. The antisense probe was generated by linearizing

the plasmid with SacI followed by transcription with T7

polymerase. After hybridization, the sections were washed

for 30 min in 50% formamide, 1

3

SSC (0.15 M NaCl /

0.015 M Na citrate), 10 mM DTT at 50

8

C, followed by a

30-min wash in 0.5

3

SSC at room temperature. The

sections were then treated for 30 min with 20

m

g / ml

RNase A at room temperature, washed for 2 h in 0.1

3

SSC at 75

8

C, and dehydrated through a series of ethanol

washes. Sections were dipped in NTB2 emulsion (Eastman

Kodak Company, Rochester, NY), exposed for 3 weeks at

4

8

C, developed, and counterstained with Harris modified

hematoxylin [37,44]. The sections were examined under

both brightfield and darkfield optics on an Olympus BX-60

microscope. Identification of rat P0 brain regions was

based on Paxinos et al. [41].

2.4. RT-PCR amplification

The GeneAmp RNA PCR Core Kit (Perkin Elmer

Cetus, Norwalk, CT) was used to reverse transcribe and

amplify 500 ng of DNase-treated human heart and brain

total RNAs, as well as 200–500 ng of DNase-treated HeLa

1

poly (A)

RNA. Here, 100 pmol of each primer were used

in 50

m

l reactions. The primers used were from the domain

I-II linker region of hH1 / SCN5A [55] and were used to

amplify a 410 base pair (bp) fragment. The forward primer

was 5

9

-(CAGGACTTCTATGAAGCCACG)-3

9

, which

ex-tends from nucleotides 1698 to 1718, and the reverse

primer

was

5

9

-(AAGCCATCTACACACGGAGC)-3

9

,

which extends from nucleotides 2089 to 2108 [55].

Ampli-fication conditions were 95

8

C for 5 min, 30 cycles of 94

8

C

for 1 min, 62

8

C for 1.5 min, and 72

8

C for 1 min, followed

by an incubation at 72

8

C for 5 min. The PCR products

were separated by electrophoresis on 2% agarose gels.

Fig. 1. RNase protection assays of RH-I / SkM2 and cytoplasmic actin. Lane designations: M, markers; P, probe; Y, yeast; Hrt, adult rat heart; Ad, adult; P0, postnatal day 0; Wb, whole brain. (A) RH-I / SkM2 RPA. Fifty

3. Results

mg of total RNA from P0 and adult rat brain were compared. Fivemg of total RNA from adult rat heart was used as a positive control. Fivemg of total RNA from yeast was used as a negative control. The predicted size

3.1. The RH-I /SkM2 rat cardiac sodium channel mRNA

of the protected fragment was 358 nt. (B) Cytoplasmic actin RPA. Five

is expressed in P

0 and adult rat brain

mg of each of the RNAs were compared. The predicted size of the

protected fragment was 126 nt. In both (A) and (B), the asterisk (*) marks

(4)

3.2. Expression of the RH-I /SkM2 rat cardiac sodium

tions with the sense probe did not reveal any detectable

channel mRNA is localized to limbic regions of the P

0

expression in brain, as expected (Figs. 2C, 2F, 3C, 4D).

rat brain

In the forebrain of the P0 rat brain, intense RH-I / SkM2

gene expression was localized to the developing septal

In situ hybridization was performed to examine the

region and the vertical and horizontal limbs of the diagonal

anatomic localization of RH-I / SkM2 cardiac sodium chan-

band of Broca (Fig. 2B). Within this section, signal

nel mRNA in the P0 rat brain (Figs. 2–4). Both sense and

continued ventrally in a diffuse, intense pattern into the

antisense RNA probes were used. In situ hybridizations

developing olfactory tubercule and the piriform cortex

with the antisense probe revealed that the expression of

(Fig. 2B). Strong, localized gene expression of RH-I /

mRNA for the RH-I / SkM2 cardiac sodium channel gene

SkM2 was observed in the region of the developing medial

was localized to three major regions in the P0 rat brain, all

basal amygdala (Fig. 2E). Furthermore, expression of

RH-of which are part RH-of the limbic system. In situ hybridiza-

I / SkM2 was also observed in the developing neocortex at

(5)

Fig. 3. In situ hybridization of the RH-I / SkM2 rat cardiac sodium channel in the diencephalon of P0 rats. (A–C) In situ hybridization of RH-I / SkM2 in developing hypothalamic and thalamic nuclei. (A) Drawing of the regions shown in (B) and (C). (B) Darkfield photomicrograph of a coronal section demonstrating RH-I / SkM2 expression in the VMH, DM, PH regions and the medial habenular-pretectal complex. Bar shown is 745mm. Arrowhead indicates the 3rd ventricle of the brain. The drawing (A) depicts an anterodorsal to ventrocaudal view, while the sections in the darkfield photomicrographs (B, C) are oriented ventrocaudal to posterodorsal. (C) Darkfield photomicrograph of the adjacent serial section to that seen in (B) hybridized with the sense RH-I / SkM2 probe. Abbreviations: Cx, cortex; Th, thalamus; VMH and V, ventral medial hypothalamic area; DM and D, dorsal medial hypothalamic area; PH and P, posterior hypothalamic area; asterisk (*), medial habenular–pretectal complex; 3V, 3rd ventricle; LV, lateral ventricle.

low, but detectable levels (data not shown). In this case,

performed with and without reverse transcriptase to ensure

the signal appeared to be localized over clusters of

that the 410 bp hH1 / SCN5A product did not arise from

immature neurons.

residual genomic DNA contamination of the RNA

sam-In the diencephalon of the P0 rat brain, relatively

ples. In reactions performed with the enzyme, expression

moderate levels of RH-I / SkM2 expression were localized

of the hH1 / SCN5A human cardiac sodium channel mRNA

to developing hypothalamic and thalamic nuclei (Fig. 3).

was detected in both human fetal and adult brain RNA, as

These included three hypothalamic groups corresponding

well as in the positive control sample of adult human heart

most closely to the ventral medial, dorsal medial and

RNA. Cloning and sequencing of the PCR products

posterior hypothalamic nuclei, as well as the medial

confirmed that they were hH1 / SCN5A (data not shown).

habenular–pretectal complex (Fig. 3B). Signal was located

No expression of hH1 / SCN5A mRNA was detected in

mostly over neurons (data not shown).

samples lacking reverse transcriptase or in the negative

1

In the brainstem, intense RH-I / SkM2 signal was local-

control sample of HeLa poly (A)

RNA.

ized to the ventrolateral medulla in a well-circumscribed

area that most closely approximated the lateral

paragigan-tocellular nuclei (Fig. 4B). Expression was observed in

cells with morphology typical of small, immature neurons

4. Discussion

(Fig. 4C) as observed in counterstained sections (data not

shown).

Expression of the rat TTX-R sodium channel gene

RH-I / SkM2 and its human ortholog, hH1 / SCN5A, is

3.3. The hH1 /SCN5A human cardiac sodium channel

generally considered to be specific for cardiac and skeletal

(6)

Fig. 4. In situ hybridization of the RH-I / SkM2 rat cardiac sodium channel in the medulla of P0 rats. (A–D) In situ hybridization of RH-I / SkM2 in the developing lateral paragigantocellular nucleus. (A) Drawing of the region in the medulla shown in panels (B) to (D). (B) Dark-field photomicrograph of a coronal section demonstrating RH-I / SkM2 expression in both LPGi nuclei (long arrows). Bar shown is 370mm. The arrowhead in (B) marks the brain midline. (C) Darkfield photomicrograph of a coronal section demonstrating RH-I / SkM2 expression in a single LPGi nucleus. Bar shown is 75mm. (D) Darkfield photomicrograph of the adjacent serial section to that seen in (C) hybridized with the sense RH-I / SkM2 probe. Abbreviations: LPGi, lateral paragigantocellular nucleus; Gi, gigantocellular nucleus; DPGi, dorsal paragigantocellular nucleus; Sp5, spinal trigeminal nucleus; 4V, 4th ventricle.

addition, we observed that hH1 / SCN5A mRNA was

the areas of RH-I / SkM2 expression, which were primarily

expressed in human fetal and adult brain.

in limbic structures. RH-I / SkM2 hybridization was

ob-RNase protection assays using an RH-I / SkM2-specific

served in the forebrain, the diencephalon, and the medulla.

probe demonstrated that the rat TTX-R cardiac sodium

In the forebrain, a high level of expression was detected in

channel is expressed in newborn and adult rat brain tissue.

developing limbic system regions, including the septal

In situ hybridization studies using P0 rat brain delineated

region, the diagonal band of Broca, and the medial basal

amygdala. Lower levels of expression were observed in the

developing olfactory tubercule, the piriform cortex, and the

neocortical region. Similar patterns have recently been

reported in adult rat forebrain regions [30]. The expression

we observed in the piriform cortex corresponds with the

1

heart-like Na

current recorded from acutely dissociated

neurons of the superficial adult rat medial entorhinal cortex

[58] and the neocortical expression we observed

corre-sponds to previous reports in the literature of both

neocortical expression of RH-I / SkM2 mRNA and of a

TTX-R current recorded from neocortical neurons [14].

RH-I / SkM2 mRNA expression was also observed by in

situ hybridization in diencephalic regions. As is typical,

boundaries in the diencephalon of P0 animals were

dif-Fig. 5. RT-PCR of hH1 / SCN5A. Lane designations: M, markers; Hrt,

ficult to establish, but three reasonably well circumscribed

adult human heart; HeLa, human cervical epithelial carcinoma cell line;

hypothalamic areas and one (epi)thalamic area were

pres-Fb, fetal human brain; Ab, adult human brain. (1) and (2) indicate the

ent. The hypothalamic expression we observed correlates

presence or absence, respectively, of reverse transcriptase in the reaction

with a previous electrophysiological study wherein a

TTX-mix. The predicted size of the hH1 / SCN5A amplified fragment was 410

(7)

neuro-voltage-gated sodium channel expressed by sensory neurons, Nature

epithelial cell line derived from the mouse hypothalamus

379 (1996) 257–262.

[62]. Interestingly, intense RH-I / SkM2 signal was also

[3] A.N. Akopian, V. Souslova, L. Sivilotti, J.N. Wood, Structure and

observed in a well circumscribed area in the ventrolateral

distribution of a broadly expressed atypical sodium channel, FEBS

medulla. Due to the immaturity of the animals, boundaries

Lett. 400 (1997) 183–187.

[4] V.G. Auld, A.L. Goldin, D.S. Krafte, J. Marshall, J.M. Dunn, W.A.

of nuclei in the brainstem of P0 animals were also difficult

1 Catterall, H.A. Lester, N. Davidson, R.J. Dunn, A rat brain Na

to establish; thus it is possible that the area also includes

channel a subunit with novel gating properties, Neuron 1 (1988)

the rostroventrolateral reticular nucleus that projects direct-

449–461.

ly to the intermediolateral cell column in the spinal cord

[5] S. Beckh, Differential expression of sodium channel mRNAs in rat peripheral nervous system and innervated tissues, FEBS Lett. 262

[40]. The ventrolateral medulla is part of the reticular

(1990) 317–322.

formation that regulates autonomic nervous system

func-[6] S.M. Belcher, C.A. Zerillo, R. Levenson, J.M. Ritchie, J.R. Howe,

tion, and it is known that certain hypothalamic and

Cloning of a sodium channel alpha subunit from rabbit Schwann

autonomic centers in the brainstem are involved with

cells, Proc. Natl. Acad. Sci. USA 92 (1995) 11034–11038.

cardiovascular regulation [40].

[7] J.A. Black, S. Yokoyama, S.G. Waxman, Y. Oh, K.B. Zur, H.

Sontheimer, H. Higashida, B.R. Ransom, Sodium channel mRNAs

While we have demonstrated that mRNA for the TTX-R

in cultured spinal cord astrocytes: in situ hybridization in identified

cardiac sodium channel is expressed in rat and human

cell types, Mol. Brain Res. 23 (1994) 235–245.

brain, whether this mRNA is translated is unclear. For

[8] J.A. Black, R.E. Westenbroek, W.A. Catterall, S.G. Waxman, Type II

example, it has been reported that the GABA A receptor

brain sodium channel expression in non-neuronal cells: embryonic

rat osteoblasts, Mol. Brain Res. 34 (1995) 89–98.

mRNA and the NMDA R1 mRNA are present in some

[9] J.A. Black, S. Dib-Hajj, K. McNabola, S. Jeste, M.A. Rizzo, J.D.

neurons, but are not translated [9]. However, it is likely

Kocsis, S.G. Waxman, Spinal sensory neurons express multiple

that at least in the piriform cortex the RH-I / SkM2 mRNA

sodium channel alpha-subunit mRNAs, Mol. Brain Res. 43 (1996)

we detected is translated, since a heart-like sodium current

117–131.

[10] J.A. Black, S.G. Waxman, Sodium channel expression: a dynamic

has been previously recorded in medial entorhinal cortex

process in neurons and non-neuronal cells, Dev. Neurosci. 18 (1996)

neurons from adult rats [58].

139–152.

Mutations in the human cardiac sodium channel gene

[11] W.A. Catterall, Cellular and molecular biology of voltage-gated

are known to lead to two cardiac abnormalities: congenital

sodium channels, Physiol. Rev. 72 (1992) S15–48.

Long QT3 (LQT3) syndrome and idiopathic ventricular

[12] Q. Chen, G.E. Kirsch, D. Zhang, R. Brugada, J. Brugada, P. Brugada, D. Potenza, A. Moya, M. Borggrefe, G. Breithardt, R.

fibrillation with right bundle branch block and ST segment

Ortiz-Lopez, Z. Wang, C. Antzelevitch, R.E. O’Brien, E.

Schulze-elevation [1,12]. Electrophysiological analysis shows that

Bahr, M.T. Keating, J.A. Towbin, Q. Wang, Genetic basis and

these mutations affect inactivation of the channels and lead

molecular mechanism for idiopathic ventricular fibrillation, Nature 1

to small, but significant increases in Na

influx. These

392 (1998) 293–296.

conditions can lead to arrhythmias and sudden cardiac

[13] T.R. Cummins, S.D. Dib-Hajj, J.A. Black, A.N. Akopian, J.N. Wood, S.G. Waxman, A novel persistent tetrodotoxin-resistant

death. Sudden unexpected death also occurs in epilepsy.

sodium current in SNS-null and wild-type small primary sensory

The causes are unknown, but may include cardiac

arrhyth-neurons, J. Neurosci. 19 (24) (1999) RC43.

mias generated by epileptic seizures arising from stimula-

[14] R.A. Deisz, A tetrodotoxin-insensitive sodium current initiates burst

tion of the autonomic nervous system [15]. While it

firing of neocortical neurons, Neuroscience 70 (1996) 341–351.

remains to be investigated, it is possible that the expression

[15] O. Devinsky, B.H. Price, S.I. Cohen, Cardiac manifestations of complex partial seizures, Am. J. Med. 80 (1986) 195–202.

of a mutant cardiac sodium channel gene in the limbic

[16] P.S. Dietrich, J.G. McGivern, S.G. Delgado, B.D. Koch, R.M. Eglen,

system has some impact on cardiac instability and / or

J.C. Hunter, L. Sangameswaran, Functional analysis of a

voltage-seizure activity.

gated sodium channel and its splice variant from rat dorsal root

ganglia, J. Neurochem. 70 (6) (1998) 2262–2272.

[17] L.M. Donahue, K. Schaller, N. Sueoka, Segregation of Na(1 )-channel gene expression during neuronal-glial branching of a rat

Acknowledgements

PNS-derived stem cell line, RT4-AC, Dev. Biol. 147 (1991) 415– 424.

This study was supported by grants from the Muscular

[18] L.M. Donahue, The tetrodotoxin-insensitive sodium current in rat

Dystrophy Association and the National Institutes of

dorsal root ganglia is unlikely to involve the expression of the tetrodotoxin-resistant sodium channel, SkM2, Neurochem. Res. 20

Health (HD29400) to L.M.D. We wish to thank Drs. Kurt

(1995) 713–717.

Droms and John Orem for critical reading of the

manu-[19] L.M. Donahue, P.W. Coates, A.J. Reinhart, Characterization of

script and valuable discussions and Ms. Anne Carpenter

developmental stage and neuronal potential of the rat PNS-derived

for technical assistance.

stem cell line, RT4-AC, Dev. Brain Res. 94 (1996) 67–80.

[20] A. Felipe, T.J. Knittle, K.L. Doyle, M.M. Tamkun, Primary structure and differential expression during development and pregnancy of a novel voltage-gated sodium channel in the mouse, J. Biol. Chem.

References

269 (1994) 30125–30131.

(8)

1

[22] H.A. Fozzard, D.A. Hanck, Structure and function of voltage- voltage-sensitive Na channel mRNAs in astrocytes, Mol. Brain dependent sodium channels: comparison of brain II and cardiac Res. 23 (1994) 57–65.

isoforms, Physiol. Rev. 76 (1996) 887–926. [40] G. Paxinos (Ed.), The Rat Nervous System, Forebrain and Midbrain; [23] J. Garcia-Anoveros, B. Derfler, J. Neville-Golden, B.T. Hyman, D.P. Hindbrain and Spinal Cord, Vols. I and II, Academic Press, San

Corey, BnaC1 and BmaC2 constitute a new family of human Diego, 1985.

neuronal sodium channels related to degenerins and epithelial [41] G. Paxinos, I. Tork, L.H. Tecott, K.L. Valentino (Eds.), Atlas of the sodium channels, Proc. Natl. Acad. Sci. USA 94 (1997) 1459–1464. Developing Rat Brain, Academic Press, San Diego, 1991. [24] S. Gautron, G. Dos Santos, D. Pinto-Henrique, A. Koulakoff, F. [42] N.W. Plummer, M.W. McBurney, M.H. Meisler, Alternative splicing

Gros, Y. Berwald-Netter, The glial voltage-gated sodium channel: of the sodium channel SCN8A predicts a truncated two-domain cell- and tissue-specific mRNA expression, Proc. Natl. Acad. Sci. protein in fetal brain and non-neuronal cells, J. Biol. Chem. 272

USA 89 (1992) 7272–7276. (1997) 24008–24015.

[25] M.E. Gellens, A.L. George Jr., L.Q. Chen, M. Chahine, R. Horn, [43] M. Raggenbass, M. Goumaz, E. Sermasi, E. Tribollet, J.J. Dreifuss, R.L. Barchi, R.G. Kallen, Primary structure and functional expres- Vasopressin generates a persistent voltage-dependent sodium current sion of the human cardiac tetrodotoxin-insensitive voltage-depen- in a mammalian motorneuron, J. Neurosci. 11 (1991) 1609–1616. dent sodium channel, Proc. Natl. Acad. Sci. USA 89 (1992) 554– [44] S.E. Ravnik, D.J. Wolgemuth, The developmentally restricted pattern

558. of expression in the male germ line of a murine Cyclin A, Cyclin

[26] A.L. George Jr., T.J. Knittle, M.M. Tamkun, Molecular cloning of A2, suggests roles in both mitotic and meiotic cell cycles, Dev. Biol. an atypical voltage-gated sodium channel expressed in human heart 173 (1996) 69–78.

and uterus: evidence for a distinct gene family, Proc. Natl. Acad.

[45] R.B. Rogart, L.L. Cribbs, L.K. Muglia, D.D. Kephart, M.W. Kaiser,

Sci. USA 89 (1992) 4893–4897. 1

Molecular cloning of a putative tetrodotoxin-resistant rat heart Na [27] A. Goldin, T. Snutch, H. Lubbert, A. Dowsett, A. Marshall, V. Auld,

channel isoform, Proc. Natl. Acad. Sci. USA 86 (1989) 8170–8174. W. Downey, L. Fritz, H. Lester, R. Dunn, W. Catterall, N. Davidson,

[46] L. Sangameswaran, S.G. Delgado, L.M. Fish, B.D. Koch, L.B. Messenger RNA coding for only theasubunit of the rat brain Na

Jakeman, G.R. Stewart, P. Sze, J.C. Hunter, R.M. Eglen, R.C. channel is sufficient for expression of functional channels in

Herman, Structure and function of a novel voltage-gated, tetrodotox-Xenopus oocytes, Proc. Natl. Acad. Sci. USA 83 (1986) 7503–

in-resistant sodium channel specific to sensory neurons, J. Biol. 7507.

Chem. 271 (1996) 5953–5956. [28] D.V. Gordienko, H. Tsukahara, Tetrodotoxin-blockable

de-1 [47] K.L. Schaller, D.M. Krzemien, N.M. McKenna, J.H. Caldwell,

polarization-activated Na currents in a cultured endothelial cell line

Alternatively spliced sodium channel transcripts in brain and derived from rat interlobar artery and human umbilical vein, Pflug.

muscle, J. Neurosci. 12 (1992) 1370–1381. Arch. Eur. J. Physiol. 428 (1994) 91–93.

[48] K.L. Schaller, D.M. Krzemien, P.J. Yarowsky, B.K. Krueger, J.H. [29] X.Q. Gu, S. Dib-Hajj, M.A. Rizzo, S.G. Waxman, TTX-sensitive

1 Caldwell, A novel, abundant sodium channel expressed in neurons

and -resistant Na currents, and mRNA for the TTX-resistant rH1

and glia, J. Neurosci. 15 (1995) 3231–3242. channel, are expressed in B104 neuroblastoma cells, J.

Neuro-[49] M.N. Sills, Y.C. Xu, E. Baracchini, R.H. Goodman, S.S. Cooperman, physiol. 77 (1997) 236–246.

1

G. Mandel, K.R. Chien, Expression of diverse Na channel mes-[30] H.A. Hartmann, L.V. Colom, M.L. Sutherland, J.F. Noebels,

Selec-senger RNAs in rat myocardium. Evidence for a cardiac-specific tive localization of cardiac SCN5A sodium channels in limbic

1

Na channel, J. Clin. Invest. 84 (1989) 331–336. regions of rat brain, Nature Neurosci. 2 (1999) 593–595.

[50] M.R. Smith, R.D. Smith, N.W. Plummer, M.H. Meisler, A.L. Goldin, [31] M. Hay, K.A. Lindsley, Membrane properties of area postrema

Functional analysis of the mouse Scn8a sodium channel, J. Neuro-neurons, Brain Res. 705 (1995) 199–208.

sci. 18 (16) (1998) 6093–6102. [32] S. Ji, W. Sun, A.L. George Jr., R. Horn, R.L. Barchi,

Voltage-1 [51] H. Sontheimer, J.A. Black, S.G. Waxman, Voltage-gated Na dependent regulation of modal gating in the rat SkM1 sodium

channel expressed in Xenopus oocytes, J. Gen. Physiol. 104 (1994) channels in glia: properties and possible functions, Trends Neurosci.

625–643. 19 (1996) 325–331.

[33] R.G. Kallen, Z.H. Sheng, J. Yang, L.Q. Chen, R.B. Rogart, R.L. [52] C.E. Stafstrom, P.C. Schwindt, W.E. Crill, Negative slope conduct-Barchi, Primary structure and expression of a sodium channel ance due to a persistent subthreshold sodium current in cat neocorti-characteristic of denervated and immature rat skeletal muscle, cal neurons in vitro, Brain Res. 236 (1982) 221–226.

Neuron 4 (1990) 233–242. [53] H. Suzuki, S. Beckh, H. Kubo, N. Yahagi, H. Ishida, T. Kayano, M. [34] R.G. Kallen, S.A. Cohen, R.L. Barchi, Structure, function and Noda, S. Numa, Functional expression of cloned cDNA encoding

expression of voltage-dependent sodium channels, Mol. Neurobiol. sodium channel III, FEBS Lett. 228 (1988) 195–200.

7 (1993) 383–428. [54] J.J. Toledo-Aral, B.L. Moss, Z.J. He, A.G. Koszowski, T.

[35] N. Kizer, X.L. Guo, K. Hruska, Reconstitution of stretch-activated Whisenand, S.R. Levinson, J.J. Wolf, I. Silos-Santiago, S. Halegoua, cation channels by expression of the alpha-subunit of the epithelial G. Mandel, Identification of PN1, a predominant voltage-dependent sodium channel cloned from osteoblasts, Proc. Natl. Acad. Sci. USA sodium channel expressed principally in peripheral neurons, Proc.

94 (1997) 1013–1018. Natl. Acad. Sci. USA 94 (1997) 1527–1532.

[36] N. Klugbauer, L. Lacinova, V. Flockerzi, F. Hofmann, Structure and [55] Q. Wang, Z. Li, J. Shen, M.T. Keating, Genomic organization of the functional expression of a new member of the tetrodotoxin-sensitive human SCN5A gene encoding the cardiac sodium channel, Gen-voltage-activated sodium channel family from human neuroendoc- omics 34 (1996) 9–16.

rine cells, EMBO J. 14 (1995) 1084–1090. [56] S.G. Waxman, J.A. Black, Expression of mRNA for a sodium [37] V.H. Lee, A.B. Lee, E.B. Phillips, J.K. Roberts, H.M. Weitlauf, channel in subfamily 2 in spinal sensory neurons, Neurochem. Res.

Spatio-temporal pattern of expression of Galectin-3 in the murine 21 (1996) 395–401.

utero-placental complex: evidence for differential regulation, Biol. [57] R.E. Weiss, N. Sidell, Sodium currents during differentiation in a Reprod. 58 (1998) 1277–1282. human neuroblastoma cell line, J. Gen. Physiol. 97 (1991) 521–539.

1

[38] M. Noda, T. Ikeda, H. Suzuki, H. Takeshima, T. Takahashi, M. [58] J.A. White, A. Alonso, A.R. Kay, A heart-like Na current in the Kuno, S. Numa, Expression of functional sodium channels from medial entorhinal cortex, Neuron 11 (1993) 1037–1047.

(9)

rat cerebral cortex, Proc. Natl. Acad. Sci. USA 88 (1991) 9453– sodium channels expressed in a peripheral neurotumor-derived cell

9457. line, RT4-B8, Am. J. Physiol. 270 (1996) C1522–1531.

Gambar

Fig. 1. RNase protection assays of RH-I/SkM2 and cytoplasmic actin.Lane designations: M, markers; P, probe; Y, yeast; Hrt, adult rat heart; Ad,total RNA from adult rat heart was used as a positive control
Fig. 2. In situ hybridization of the RH-I/SkM2 rat cardiac sodium channel in the cerebral hemisphere of P0 rats
Fig. 3. In situ hybridization of the RH-I/SkM2 rat cardiac sodium channel in the diencephalon of P0 rats
Fig. 5. RT-PCR of hH1/SCN5A. Lane designations: M, markers; Hrt,adult human heart; HeLa, human cervical epithelial carcinoma cell line;Fb, fetal human brain; Ab, adult human brain

Referensi

Dokumen terkait

Tiada kata lain yang diucapkan pada awal kata pengantar ini, selain ucapan puji dan syukur kepada Tuhan Yang Maha Esa atas kasih dan rahmat-Nya, sehingga penulis dapat

The overall research questions guiding this investigation were “How do graduate students perceive the relative ease of use of, accuracy of the measure of, and gen- eral preference

dapat menunjukkan asli dokumen kualifikasi tersebut, maka penawaran dinyatakan. tidak lulus

Digital Repository Universitas Jember Digital Repository Universitas Jember... Digital Repository Universitas Jember Digital Repository

[r]

wartawan-wartawan yang belum tahu /tentang medan suatu daerah yang akan dijadikan sumber berita / dan. tentunya mencari angle – angle yang lain / serta menciptakan suatu berita

Hari/ Tanggal : Selasa, 28 Nopember 2017 J a m : 09.00 Wita s/ d 15.00 Wita Tempat : Ruang ULP Kota Parepare. Alamat

Implementasi Model Inquiry Lab untuk meningkatkan Prestasi Belajar dan Kegiatan OSEAN Siswa SMP1. Universitas Pendidikan Indonesia | repository.upi.edu |