dry ice

Top PDF dry ice:

Efikasi Dry Ice terhadap Sitophilus oryzae dan Tribolium castaneum pada Beras Kemasan Plastik di Dataran Tinggi Efficacy of Dry Ice to Sitophilus oryzae and Tribolium castaneum in The Rice of Plastic Packaging at High Land

Efikasi Dry Ice terhadap Sitophilus oryzae dan Tribolium castaneum pada Beras Kemasan Plastik di Dataran Tinggi Efficacy of Dry Ice to Sitophilus oryzae and Tribolium castaneum in The Rice of Plastic Packaging at High Land

Sitophilus oryzae and Tribolium castaneum are pest that can always attack rice in long periode storage. Rice in the plastic packaging that spread in market has not did fumigation, so the pest can attack faster than rice in sack packaging. This research was aimed to understand the effectiveness of dry ice to attack S. oryzae and T. castaneum with effect of dry ice to rice in plastic packaging at high land. This research used completely randomized design (CRD) with two factors. The first factor was dose of dry ice and second factor was wrapper of dry ice. The data was analyzed in variance analysis then continue with Duncan Mean Range Test (DMRT). The result showed that dose of dry ice 10 g/rice 5 kg can effect for 90,83 % mortality of S. oryzae and T. castaneum but it have not made effect for imago and larvae population. Also, dry ice was not make effect for rice weight and rice quality (color of rice, scent of rice and taste of rice).
Baca lebih lanjut

5 Baca lebih lajut

Quality of Post Thawing Straw Mushroom (Volvariella volvaceae) by using Dry ice Freezing

Quality of Post Thawing Straw Mushroom (Volvariella volvaceae) by using Dry ice Freezing

Straw mushroom is highly demand due to its nutrients content. However, it has high respiration rate which causes product decays during a limited its shelflife. On room temperature, mushroom will stay undamaged up to 24 hours. The objective of this research was to evaluate straw mushroom post-thawing quality by using dry-ice freezing. This research was divided into 2 steps, the first step was to determine dry ice and straw mushroom ratio, freezing time and rates, and the second was to compare the quality of fresh straw mushrooms with thawed mushrooms which is frozen by using freezer and dry ice. The parameters that evaluated were temperature of centre mushroom, frozen weight, and thawed mushroom, color, hardness, protein content, pH, sensory analysis, histology, and economic analysis. The first step showed that the ratio 1:2 of straw mushroom and dry ice was more efficient than the other ratios with rates of 0.27˚C/min for 3.5 hours and needed 421 gram of dry ice. The second step of the research showed that although freezing caused deterioration of color, hardness, pH, and histological of straw mushroom, but could preserve the protein. Freezing straw mushroom by using freezer was classified as a slow freezing and by using dry ice was classified as a commercial freezing, which each freezing rate were 0.05˚C/min and 0.27˚C/min respectively , and freezing straw mushroom by using dry ice was more preference than using freezer by sensory evaluation. The cost of freezing straw mushroom by using freezer was Rp. 27.535,-/kg and with dry ice was Rp. 38.600,-/kg, therefore freezing straw mushroom with dry ice should be used to accelerate freezing. Dry ice can be used as intermediary technology for freezing straw mushroom and where freezer not available.
Baca lebih lanjut

76 Baca lebih lajut

Dry Ice Blasting  What s That

Dry Ice Blasting What s That

Keywords: dry ice blasting,industrial cleaning Article Body: Dry ice blasting is: - the use of solid CO2 carbon dioxide pellets accelerated by compressed air to clean or strip indust[r]

1 Baca lebih lajut

Dry Ice Blasting For Wisconsin

Dry Ice Blasting For Wisconsin

High pressure water blasting leaves behind a secondary waste stream which in many cases increases the volume of hazardous waste that is subject to costly disposal fees and transportation[r]

1 Baca lebih lajut

Index of /papers/Food_Beverage How Is Dry Ice Made

Index of /papers/Food_Beverage How Is Dry Ice Made

Keywords: Article Body: Anyone old enough to remember "ice boxes", will remember the daily deliveries of huge blocks of ice that kept their meat and food cool inside the icebox, a fore[r]

1 Baca lebih lajut

Staff Site Universitas Negeri Yogyakarta

Staff Site Universitas Negeri Yogyakarta

Dengan memasukkan dry ice ke dalam botol mampu menaikkan tekanan di dalam botol tersebut. Sebagaimana yang telah diketahui bahwa bahan dasar pembuat dry ice adalah semacam gas yang dipadatkan, maka dalam suhu kamar dry ice akan menyublim dan menghasilkan gas. Nah, gas inilah yang digunakan untuk mendorong telur keluar dari dalam botol.

12 Baca lebih lajut

gunadarma 22102417 ssm filkom

gunadarma 22102417 ssm filkom

PENDINGIN PROSESSOR DENGAN MENGGUNAKAN DRY ICE RADIANSYAH ERMAN, BRAHMANTYO.H,SKOM,MMSI Penulisan Ilmiah, Fakultas Ilmu Komputer, 2007 Universitas Gunadarma http://www.gunadarma.ac.i[r]

1 Baca lebih lajut

gunadarma 23102489 ssm filkom

gunadarma 23102489 ssm filkom

PENDINGIN PROSESSOR DENGAN MENGGUNAKAN DRY ICE PINTA RAME GINTING, CHANDRA YULIANTO, SSI, SKOM Penulisan Ilmiah, Fakultas Ilmu Komputer, 2007 Universitas Gunadarma http://www.gunadar[r]

1 Baca lebih lajut

Contoh Studi Kelayakan Bisnis Ice Cream

Contoh Studi Kelayakan Bisnis Ice Cream

Ice cream merupakan hidangan yang banyak digemari oleh berbagai kalangan, karena rasanya yang manis, lembut dan membuat mood menjadi baik bagi yang mengkonsumsinya. Ice cream termasuk makanan yang paling disukai oleh masyarakat, terutama oleh anak-anak karena rasanya yang manis pula. Ice cream juga sangat baik untuk pertumbuhan anak-anak karena terbuat dari susu yang kaya akan protein dan energi. Banyak gizi yang dapat kita peroleh dari mengkonsumsi ice cream. Keunggulan ice cream didukung oleh bahan baku utamanya, yaitu susu tanpa lemak dan lemak susu. Susu disebut sebagai makanan yang hampir sempurna karena kandungan zat gizi yang lengkap.
Baca lebih lanjut

17 Baca lebih lajut

EFEKTIVITAS PENERAPAN METODE ICE BREAKIN (1)

EFEKTIVITAS PENERAPAN METODE ICE BREAKIN (1)

Penelitian ini dilaksanakan dengan menggunakan metode kajian pustaka. Ide- ide penulisan diperoleh dari mengkaji beberapa artikel yang berkaitan (relevan) dengan penggunaan ice breaking sebagai salah satu cara untuk meningkatkan konsentrasi siswa. Menurut Pohan dalam Prastowo (2012: 81) kegiatan penyusunan kajian pustaka betujuan mengumpulkan data dan infomasi ilmiah, berupa teori- teori, metode, atau pendekatan yanng pernah berkembang dan telah didokumentasikan dalam bentuk buku, jurnal, naskah, catatan, rekaman sejarah, dokumen-dokumen, dan lain-lain yang terdapat di perpustakaan.
Baca lebih lanjut

6 Baca lebih lajut

STUDI KELAYAKAN BISNIS ICE CREAM

STUDI KELAYAKAN BISNIS ICE CREAM

Perkembangan permintaan akan produk ice cream akan terus meningkat. Mengingat kondisi wilayah Indonesia, daerah Surabaya akan terus meningkat pada musim panas. Sehingga ice cream merupakan salah satu hidangan yang mampu menyegarkan dahaga. Ice cream dapat dinikmati oleh seluruh kalangan sehingga potensi pasar tak terbatas terutama bagi anak-anak. Kami melihat potensi pasar ini pada lokasi yang kami pilih yaitu daerah hayam wuruk dimana terdapat berbagai tempat les, sekolah, dan kampus yang memungkin bagi para pelajar tersebut untuk membeli produk kami di jam-jam istirahat (siang) dan jam pulang (sore/malam). Selain itu banyaknya acara yang menawarkan pembukaan stand dapat dimanfaatkan untuk meningkatkan penjualan dan laba di saat-saat tertentu.
Baca lebih lanjut

17 Baca lebih lajut

DETEKSI BAKTERI PATOGEN YANG BERASOSIASI DENGAN Kappaphycus alvarezii (Doty) BERGEJALA PENYAKIT ICE-ICE

DETEKSI BAKTERI PATOGEN YANG BERASOSIASI DENGAN Kappaphycus alvarezii (Doty) BERGEJALA PENYAKIT ICE-ICE

Hasil uji patogenesitas (postulat Koch) dari 28 isolat bakteri terdapat satu koloni yang mampu menyebabbakn K. alvarezii bergejala ice-ice yaitu K25. Dikatakan mampu menyebabkan gejala ice-ice karena isolat ini telah menginfeksi K. alvarezii pada kedua ulangan sampel uji, sedangkan isolat lainnya hanya menyebabkan infeksi pada satu sampel uji atau bahkan ada isolat yang tidak menyebkan infeksi pada kedua sampel uji. Sampel uji yang telah diinokulasikan isolat K25 pada pengamatan hari ke-1 sudah mulai terjadi sedikit pemutihan pada pangkal thallus, pada pengamatan hari ke-2 dan ke-3 area pemucatan thallus semakin meluas, pada pengamatan ke-4 atau pengamatan terakhir pemucatan hampir melingkupi seluruh permukaan thallus, thallus terlihat lembek, dan air laut dalam botol penanaman menjadi keruh (gambar 1).
Baca lebih lanjut

7 Baca lebih lajut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Pengelolaan budidaya rumput laut yang sehat dan bebas penyakit ice-ice merupakan komponen penting dalam peningkatan produksi rumput laut. Untuk mendukung pengendalian terpadu penyakit ice-ice pada budidaya rumput laut diperlukan informasi variasi genetik bakteri patogen dan penyediaan deteksi secara cepat dan akurat. Kajian yang dilakukan bertujuan untuk mengidentifikasi bakteri patogen berdasarkan hasil analisis sekuen gen 16S-rRNA, mengkonstruksi primer PCR spesifik dari sekuen gen 16S-rRNA dari bakteri yang memiliki tingkat patogenisitas tertinggi. Gen 16S-rRNA bakteri yang memberikan tingkat patogenisitas tertinggi diamplifikasi dengan primer PCR universal domain bakteri forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) dan reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). Hasil sekuensing DNA dibandingkan dengan data base European Bioinformatics Institute (EBI) BLASTN. Perancangan dan analisis kelayakan pasangan primer yang diperoleh dilakukan dengan menggunakan program Primer 3. Dua primer spesifik PCR berhasil dirancang yakni aSEFM-F (5- CAGCCACACTGGAACTGAGA -3) dan aSEFM-R (5- TTAGCCGGTGCTTCTTCTGT -3). Kedua primer ini bereaksi optimum pada suhu 60 o C dengan yang menghasilkan amplikon berukuran 201 bp.
Baca lebih lanjut

152 Baca lebih lajut

FORDA - Jurnal

FORDA - Jurnal

Charcoal additions to soil significantly increased height, diameter, and leaf and stem biomass of and significantly increased height, diameter, number of leaf, root dry weight, stem dry weight, and total biomass of seedlings in comparison to those of a control. Increasing the amount of charcoal higher than 10% level, however, have little effect on growth. Nevertheless, increasing the amount of charcoal higher than 10% or up to 20 % is still effective on growth. This study indicated that charcoal application at the rate of 10 % for and 20 % for would be adequate to improve the availability of soil nutrients, and hence significantly induce a better plant growth response.
Baca lebih lanjut

12 Baca lebih lajut

PERAN ICE BREAKING DALAM PEMBELAJARAN  SD NEGERI 2 TEMPURAN KECAMATAN WANAYASA BANJARNEGARA  Peran Ice Breaking Dalam Pembelajaran SD Negeri 02 Tempuran Kecematan Wanayasa Banjarnegara Tahun ajaran 2015-2016.

PERAN ICE BREAKING DALAM PEMBELAJARAN SD NEGERI 2 TEMPURAN KECAMATAN WANAYASA BANJARNEGARA Peran Ice Breaking Dalam Pembelajaran SD Negeri 02 Tempuran Kecematan Wanayasa Banjarnegara Tahun ajaran 2015-2016.

Dalam penilitian ini, orientasi teoritik yang digunakan adalah pendekatan fenomenologi yang berkecenderungan pada hermeneutic atau dapat juga disebut hermeneutical pheneomenology. Yaitu, menafsirkan dan memahami arti peristiwa dan kaitan-kaitannya terhadap orang-orang biasa dalam situasi-situasi tertentu, dimana penekanannya terdapat pada aspek subjektif prilaku orang (Lexy,J.Moleong 2006: 9). Dalam hal ini peneliti berusaha untuk masuk kedalam dunia konseptual para subjek yang diteliti sedemikian rupa, sehingga paham dan mengerti apa dan bagaimana suatu pengertian yang dikembangkan disekitar peristiwa dalam kehidupan sehari-hari tentang peranan ice breaking yang dilakukan guru didalam pembelajaran di SD Negeri 2 Tempuran kecamatan Wanayasa Banjarnegara.
Baca lebih lanjut

12 Baca lebih lajut

406992401.doc 107.76KB 2015-10-12 00:17:49

406992401.doc 107.76KB 2015-10-12 00:17:49

Banyaknya manfaat dari daun sirsak ini bisa kita buat sebagai peluang usaha yang memiliki prospek lumayan, yakni dengan membuat produk ice cream dari ekstrak daun sirsak. Ice cream merupakan makanan ringan yang semua orang sudah mengetahuinya dan banyak juga yang menyukai ice cream,varian rasanya pun bermacam-macam. Pembuatan ice cream ini tidaklah rumit, karena tidak ada cara-cara khusus dalam proses pembuatannya.

24 Baca lebih lajut

Artikel Seminar UM   Ice Cream 0

Artikel Seminar UM Ice Cream 0

Inulin dapat membentuk mikrokristal apabila didispersikan pada air atau susu. Keberadaan mikrokristal ini tidak dapat dirasakan oleh mulut, tetapi mikrokristal ini membentuk tekstur creamy yang halus dan terasa seperti lemak ketika dikunyah di mulut. Karena karakteristik ini, inulin dapat digunakan sebagai pengganti lemak pada spread, bakery, filling, dairy product (ice cream dan yogurt), frozen dessert dan dressing. Inulin tidak bersifat kariogenik, sehingga tidak menyebabkan karies pada gigi (Kaur, 2002).

8 Baca lebih lajut

HIDROEKSTRAKSI DAUN KETAPANG (Terminalia catappa L.) SEBAGAI PENGENDALI PENYAKIT ICE-ICE PADA BUDIDAYA Kappaphycus alvarezii

HIDROEKSTRAKSI DAUN KETAPANG (Terminalia catappa L.) SEBAGAI PENGENDALI PENYAKIT ICE-ICE PADA BUDIDAYA Kappaphycus alvarezii

Uji in vivo dilakukan di Desa Palasa, Pulau Poteran, Kabupaten Sumenep, Madura, dengan metode budidaya yang digunakan adalah Metode Rakit Apung. Kedalaman perairan pada lokasi penelitian ini adalah 150 cm. Penanaman bibit K. alvarezii dengan metode rakit ini menggunakan rakit apung yang terbuat dari bambu berukuran antara 2,5 x 2,5 m 2 hingga 7 x 7 m 2 , untuk penahanan supaya rakit tidak hanyut terbawa arus, digunakan jangkar sebagai penahan atau diikat pata patok kayu yang ditancapkan di dasar laut. Konsentrasi esktrak daun Ketapang paling efektif hasil uji in vitro dicampur dengan air laut dengan takaran konsentrasi paling efektif hasil uji in vitro. Rumput laut yang sudah terjangkit penyakit ice-ice kira-kira seberat 5 gram kemudian didokumentasikan bintik putih pada rumpun sebagai gejala penyakit ice-ice kemudian diikat dengan tali raffia sebagai penanda. Rumput laut direndam dengan campuran ekstrak daun Ketapang dengan air laut selama 5 menit. Setiap 5 gram rumput laut diikat pada sarana (tali) budidaya dengan jarak satu ikatan dengan lainnya adalah 25 cm, perlakuan dilakukan dengan 3 kali pengulangan. Pengamatan klinis dengan mendokumentasikan thallus pada setiap rumpun untuk dilihat perkembangan thallus setelah dilakukan perendaman. Pengamatan thallus secara klinis dilakukan setiap dua hari sekali selama tujuh hari.
Baca lebih lanjut

89 Baca lebih lajut

Cikarang Dry Port - Indonesia

Cikarang Dry Port - Indonesia

Integrated Port and Logistics Facilities | www.cikarangdryport.com | member of Program : Dry Port to Dry Port Page 18 Benefits •Expand and Explore the market Connecting strategic ind[r]

26 Baca lebih lajut

Pengumuman Pemenang Dry Sterilizer

Pengumuman Pemenang Dry Sterilizer

Berdasarkan berita acara hasil pelelangan pengadaan Dry Sterilizer (Sterilisator Kering) nomor: 293/I/KU.806/E1/2013 tanggal 1 Februari 2013 dari panitia pengadaan Dry Sterilizer (Sterilisator Kering) dan penetapan pemenang pelelangan pengadaan Dry Sterilizer (Sterilisator Kering) melalui LPSE tanggal 4 Februari 2013, dengan ini diumumkan bahwa pelaksanaan Pengadaan Dry Sterilizer (Sterilisator Kering) TA. 2013, telah ditetapkan Pemenang sebagai berikut :

2 Baca lebih lajut

Show all 1464 documents...

Related subjects