• Tidak ada hasil yang ditemukan

Analisis ekspresi gen penyandi metallothionein tipe II pada Melastoma affine L. yang mendapat cekaman pH rendah dan aluminium

N/A
N/A
Protected

Academic year: 2017

Membagikan "Analisis ekspresi gen penyandi metallothionein tipe II pada Melastoma affine L. yang mendapat cekaman pH rendah dan aluminium"

Copied!
100
0
0

Teks penuh

(1)

Niken Trisnaningrum P 055050081

PROGRAM STUDI BIOTEKNOLOGI SEKOLAH PASCA SARJANA INSTITUT PERTANIAN BOGOR

(2)

Dengan ini saya menyatakan bahwa tesis yang berjudul Analisis Ekspresi Gen Penyandi Metallothionein Tipe II pada Melastoma affine L. yang Mendapat Cekaman pH Rendah dan Aluminium adalah karya saya bersama dengan komisi pembimbing dan belum diajukan dalam bentuk apapun kepada perguruan tinggi manapun. Sumber informasi yang berasal atau dikutip dari karya yang diterbitkan maupun tidak diterbitkan dari penulis lain telah disebutkan dalam teks dan dicantumkan dalam Daftar Pustaka di bagian akhir tesis ini.

Bogor, Juni 2009

(3)

NIKEN TRISNANINGRUM. Expression of the gene encoding metallothionein type II in Melastoma affine L. under low pH and aluminum stress. Supervised by SUHARSONO and MUHAMAD YUNUS

Aluminum is toxic to plants, affects plant development and reduces crop production. Indonesia has 47.500.000 ha of acid soil with very low pH and high content of aluminum. The application of tolerant crop varieties is the best approach to overcome this problem and the availability of genes controlling tolerance to this abiotic stress is essential to develop new tolerant varieties. Melastoma affine is the indigenous plant in tropical rain forest, very tolerant to acid condition and aluminum. Therefore this plant could be used for source of genes for acid and aluminum tolerance. Metallothionein is one of genes responsible for aluminum tolerance. MaMt2 gene encoding metallothionein from M. affine was isolated. The expression of this gene in M. affine under low pH and aluminum stresses was investigated using Real Time PCR in this research. MaMt2 primers were designed based on the sequence of MaMt2. β-actin was used as internal control, and the primers for β-actin were designed based on cDNA of the region between exon 1 and exon 2 of this gene. Total RNA was successfully isolated from roots and young leaves separately. Total cDNA was synthesized from total RNA by reverse transcription. This cDNA was used as template for Real Time PCR to analyse the expression of MaMt2. The expressions of MaMt2 in leaves and roots were not affected by low pH. At high concentration (3.2 mM) aluminum induced the expression of MaMt2 in the roots but not in leaves.

.

(4)

Tipe II pada Melastoma affine L. yang Mendapat Cekaman pH Rendah dan Aluminium. Dibimbing oleh SUHARSONO dan MUHAMAD YUNUS

Indonesia yang mempunyai tanah ultisol sebanyak 47,5 juta ha yang memiliki karakteristik pH rendah dan kandungan Al yang tinggi. Salah satu cara untuk mengatasi kandungan Al yang sangat tinggi tersebut adalah dengan melakukan perakitan tanaman yang memiliki ketahanan terhadap keracunan Al. Melastoma affine merupakan tanaman yang toleran terhadap pH rendah dan cekaman Al yang sangat tinggi, sehingga tanaman ini dapat digunakan sebagai sumber gen toleransi terhadap pH rendah dan Al. Salah satu gen yang diduga berperan dalam ketahanan M. affine terhadap pH rendah dan Al adalah gen penyandi metallothionein (MaMt2).

Penelitian ini bertujuan untuk menganalisis ekspresi gen penyandi MT2 pada Melastoma affine L. yang mendapat cekaman pH rendah dan Al. Untuk itu, M. affine diperbanyak dengan stek pucuk dan diberi cekaman pH rendah dan cekaman Al secara terpisah pada kultur cair selama satu minggu. Penelitian ini dilakukan dengan dua ulangan. Cekaman pH rendah diberikan pada dua tingkat pH yaitu 6 dan 4. Cekaman Al dilakukan pada pH 4 dengan 3 tingkat konsentrasi Al yaitu 0, 0,8, dan 3,2 mM. Satu minggu setelah perlakuan, RNA total diisolasi dari daun dan akar secara terpisah, lalu digunakan untuk sintesis cDNA total. Analisis ekspresi MaMt2 dilakukan dengan menggunakan cDNA total dengan Real Time PCR dan pengamatan semikuantitatif pada gel agarose. Analisis ekspresi MaMt2 dilakukan dengan membandingkan ekspresi gen MaMt2 yang telah dinormalisasi dengan gen β aktin antara kontrol (pH 6 dan 0 mM Al) dengan perlakuan yang dilakukan dengan metode comparative Ct (∆∆Ct). Analisis dengan menggunakan Real Time PCR dilakukan sebanyak dua ulangan, selanjutnya analisis statistik dilakukan dengan program SPSS 13 untuk membandingan ekspresi perlakuan. Hasil Real Time PCR di cek dengan menggunakan gel agarose untuk mendapatkan hasil ekspresi MaMt2 semikuantitatif.

(5)

Nama Mahasiswa : Niken Trisnaningrum

NRP : P055050081

Disetujui

Komisi Pembimbing

Dr. Ir. Suharsono, DEA Ketua

Ir. Muhamad Yunus, MSi, PhD Anggota

Diketahui

Ketua Program Studi Bioteknologi

Dr. Ir. Muhammad Jusuf

Dekan Sekolah Pascasarjana

Prof. Dr. Ir. Khairil A. Notodiputro, MS

(6)

Puji syukur penulis panjatkan kepada Allah SWT yang telah melimpahkan karunia-Nya, sehingga penulis dapat menyelesaikan tesis yang berjudul : Analisis Ekspresi Gen Penyandi Metallothionein Tipe II pada Melastoma affine L. yang Mendapat Cekaman pH Rendah dan Aluminium. Penelitian ini dilaksanakan di Laboratorium BIORIN, PAU, IPB dan Laboratorium Terpadu, BB Biogen.

Ucapan terimakasih penulis sampaikan kepada :

1. Dr. Suharsono dan Dr. Muhamad Yunus selaku Komisi Pembimbing, atas bimbingan, saran dan masukan selama penelitian dan penulisan tesis ini. 2. Proyek Penelitian Kerjasama Kemitraan Penelitian Pertanian dengan

Perguruan Tinggi (KKP3T) yang telah membiayai penelitian ini melalui SPK No. 748/LB.620/I.1/3/2008 atas nama Dr. Suharsono.

3. Bapak Adi selaku teknisi rumah kaca, Bapak Mulya selaku staf Laboratorium Biologi Molekuler dan Bioteknologi IPB, dan Ibu Pepy selaku staf Laboratorium BIORIN atas bantuan yang diberikan selama pelaksanaan penelitian.

4. Ayah dan Ibu atas dukungan finansial dan spiritual.

5. Teman-teman Laboratorium Biorin atas masukan dan diskusi yang sering diberikan.

Penulis menyadari bahwa tesis ini masih ada kekurangan. Namun demikian penulis berharap semoga penelitian ini dapat berguna bagi pihak-pihak yang memerlukannya.

Bogor, Juni 2009

(7)

Penulis dilahirkan di Bondowoso pada tanggal 31 Agustus 1981 dari pasangan Bapak Sutrisno dan Ibu Sri Mastutik. Penulis merupakan anak kedua dari tiga bersaudara.

(8)

DAFTAR TABEL ... viii

DAFTAR GAMBAR ... ix

DAFTAR LAMPIRAN... x

I. PENDAHULUAN... 1

1.1Latar Belakang ... 1

1.2Tujuan Penelitian... 3

1.3Hipotesis Penelitian ... 3

II. TINJAUAN PUSTAKA ... 4

2.1Mekanisme Toleransi Terhadap Aluminium (Al) ... 4

2.2Metallothionein... 6

2.3Melastoma affine L ... 7

2.4Real Time Polimerase Chain Reaction (Real Time PCR) ... 8

III. BAHAN DAN METODE ... 16

3.1Waktu dan Tempat... 16

3.2Bahan Penelitian ... 16

3.3Metode ... 16

3.3.1Perlakuan cekaman pada kultur air ... 17

3.3.2Isolasi RNA total dari Melastoma affine L ... 17

3.3.3Pembentukan cDNA total... 18

3.3.4Analisis ekspresi gen dengan menggunakan Real Time PCR ... 19

IV. HASIL DAN PEMBAHASAN... 21

4.1Isolasi RNA Total ... 21

4.2Sintesis cDNA Total ... 21

4.3Ekspresi Gen Metallothionein ... 22

4.3.1Pengaruh pH rendah terhadap ekspresi gen metallothionein ... 22

4.3.2Pengaruh aluminium terhadap ekspresi gen metallothionein ... 24

V. SIMPULAN DAN SARAN ... 26

5.1Simpulan ... 26

5.2Saran ... 26

(9)

Halaman 1. Nilai relative quantification (RQ) dari transkripsi MaMT2

pada daun dan akar M. affine L.yang mendapat cekaman pH rendah.. 24

2. Nilai relative quantification (RQ) dari transkripsi MaMT2

(10)

Halaman

1. Tiga fase utama pada proses PCR: (1) fase eksponensial dimana terjadi penggandaan jumlah DNA cetakan yang sebenarnya, (2) fase linier dimana proses penggandaan cetakan mulai menurun, (3) fase plateu dimana tidak terjadi lagi

proses penggandaan cetakan dan DNA mulai terdegradasi. Deteksi untuk Real Time PCR terjadi pada fase eksponensial, sedangkan deteksi pada PCR biasa terjadi pada fase plateu yang digambarkan dalam bentuk kurva linier (A) dan kurva log (B)

(Applied Biosystem 2007)... 10

2. Proses deteksi pada Real Time PCR dengan menggunakan SYBR Green. SYBRGreen akan terdeteksi bila terikat pada utas ganda DNA saat fase perpanjangan DNA (extention)

(Dorak 2006)... 11

3. Proses deteksi pada Real Time PCR dengan menggunakan

TaqMan. Deteksi akan terjadi bila TaqMan probe yang menempel diantara primer forward dan primer reverse rusak selama fase

perpanjangan DNA (extention) (Dorak 2006) ... 11

4. Kurva amplifikasi pada Real Time PCR. Threshold adalah daerah deteksi yang digunakan dalam analisis. Cycle Threshold (Ct) adalah siklus pada saat fluorescencereporter berpotongan dengan threshold. Rn adalah jumlah fluorescencereporter yang terdeteksi selama proses PCR. Cycle adalah banyaknya siklus yang digunakan dalam proses PCR (Applied Biosystem 2007)... 12

5. RNA total M. affine L. hasil isolasi dari akar (1) dan daun (2) ... 21

6. Hasil amplifikasi β-actin. Lajur 1,2, dan 3 = hasil amplifikasi dengan menggunakan cDNA sebagai cetakan. Lajur 4 = 1 kb ladder. Lajur 5 = hasil amplifikasi dengan menggunakan DNA genom

sebagai cetakan... 22

7. Ekspresi MaMt2 semikuantitatif pada daun dan akar dari M. affine L. yang mendapat cekaman pH rendah... 23

(11)

Niken Trisnaningrum P 055050081

PROGRAM STUDI BIOTEKNOLOGI SEKOLAH PASCA SARJANA INSTITUT PERTANIAN BOGOR

(12)

Dengan ini saya menyatakan bahwa tesis yang berjudul Analisis Ekspresi Gen Penyandi Metallothionein Tipe II pada Melastoma affine L. yang Mendapat Cekaman pH Rendah dan Aluminium adalah karya saya bersama dengan komisi pembimbing dan belum diajukan dalam bentuk apapun kepada perguruan tinggi manapun. Sumber informasi yang berasal atau dikutip dari karya yang diterbitkan maupun tidak diterbitkan dari penulis lain telah disebutkan dalam teks dan dicantumkan dalam Daftar Pustaka di bagian akhir tesis ini.

Bogor, Juni 2009

(13)

NIKEN TRISNANINGRUM. Expression of the gene encoding metallothionein type II in Melastoma affine L. under low pH and aluminum stress. Supervised by SUHARSONO and MUHAMAD YUNUS

Aluminum is toxic to plants, affects plant development and reduces crop production. Indonesia has 47.500.000 ha of acid soil with very low pH and high content of aluminum. The application of tolerant crop varieties is the best approach to overcome this problem and the availability of genes controlling tolerance to this abiotic stress is essential to develop new tolerant varieties. Melastoma affine is the indigenous plant in tropical rain forest, very tolerant to acid condition and aluminum. Therefore this plant could be used for source of genes for acid and aluminum tolerance. Metallothionein is one of genes responsible for aluminum tolerance. MaMt2 gene encoding metallothionein from M. affine was isolated. The expression of this gene in M. affine under low pH and aluminum stresses was investigated using Real Time PCR in this research. MaMt2 primers were designed based on the sequence of MaMt2. β-actin was used as internal control, and the primers for β-actin were designed based on cDNA of the region between exon 1 and exon 2 of this gene. Total RNA was successfully isolated from roots and young leaves separately. Total cDNA was synthesized from total RNA by reverse transcription. This cDNA was used as template for Real Time PCR to analyse the expression of MaMt2. The expressions of MaMt2 in leaves and roots were not affected by low pH. At high concentration (3.2 mM) aluminum induced the expression of MaMt2 in the roots but not in leaves.

.

(14)

Tipe II pada Melastoma affine L. yang Mendapat Cekaman pH Rendah dan Aluminium. Dibimbing oleh SUHARSONO dan MUHAMAD YUNUS

Indonesia yang mempunyai tanah ultisol sebanyak 47,5 juta ha yang memiliki karakteristik pH rendah dan kandungan Al yang tinggi. Salah satu cara untuk mengatasi kandungan Al yang sangat tinggi tersebut adalah dengan melakukan perakitan tanaman yang memiliki ketahanan terhadap keracunan Al. Melastoma affine merupakan tanaman yang toleran terhadap pH rendah dan cekaman Al yang sangat tinggi, sehingga tanaman ini dapat digunakan sebagai sumber gen toleransi terhadap pH rendah dan Al. Salah satu gen yang diduga berperan dalam ketahanan M. affine terhadap pH rendah dan Al adalah gen penyandi metallothionein (MaMt2).

Penelitian ini bertujuan untuk menganalisis ekspresi gen penyandi MT2 pada Melastoma affine L. yang mendapat cekaman pH rendah dan Al. Untuk itu, M. affine diperbanyak dengan stek pucuk dan diberi cekaman pH rendah dan cekaman Al secara terpisah pada kultur cair selama satu minggu. Penelitian ini dilakukan dengan dua ulangan. Cekaman pH rendah diberikan pada dua tingkat pH yaitu 6 dan 4. Cekaman Al dilakukan pada pH 4 dengan 3 tingkat konsentrasi Al yaitu 0, 0,8, dan 3,2 mM. Satu minggu setelah perlakuan, RNA total diisolasi dari daun dan akar secara terpisah, lalu digunakan untuk sintesis cDNA total. Analisis ekspresi MaMt2 dilakukan dengan menggunakan cDNA total dengan Real Time PCR dan pengamatan semikuantitatif pada gel agarose. Analisis ekspresi MaMt2 dilakukan dengan membandingkan ekspresi gen MaMt2 yang telah dinormalisasi dengan gen β aktin antara kontrol (pH 6 dan 0 mM Al) dengan perlakuan yang dilakukan dengan metode comparative Ct (∆∆Ct). Analisis dengan menggunakan Real Time PCR dilakukan sebanyak dua ulangan, selanjutnya analisis statistik dilakukan dengan program SPSS 13 untuk membandingan ekspresi perlakuan. Hasil Real Time PCR di cek dengan menggunakan gel agarose untuk mendapatkan hasil ekspresi MaMt2 semikuantitatif.

(15)

Nama Mahasiswa : Niken Trisnaningrum

NRP : P055050081

Disetujui

Komisi Pembimbing

Dr. Ir. Suharsono, DEA Ketua

Ir. Muhamad Yunus, MSi, PhD Anggota

Diketahui

Ketua Program Studi Bioteknologi

Dr. Ir. Muhammad Jusuf

Dekan Sekolah Pascasarjana

Prof. Dr. Ir. Khairil A. Notodiputro, MS

(16)

Puji syukur penulis panjatkan kepada Allah SWT yang telah melimpahkan karunia-Nya, sehingga penulis dapat menyelesaikan tesis yang berjudul : Analisis Ekspresi Gen Penyandi Metallothionein Tipe II pada Melastoma affine L. yang Mendapat Cekaman pH Rendah dan Aluminium. Penelitian ini dilaksanakan di Laboratorium BIORIN, PAU, IPB dan Laboratorium Terpadu, BB Biogen.

Ucapan terimakasih penulis sampaikan kepada :

1. Dr. Suharsono dan Dr. Muhamad Yunus selaku Komisi Pembimbing, atas bimbingan, saran dan masukan selama penelitian dan penulisan tesis ini. 2. Proyek Penelitian Kerjasama Kemitraan Penelitian Pertanian dengan

Perguruan Tinggi (KKP3T) yang telah membiayai penelitian ini melalui SPK No. 748/LB.620/I.1/3/2008 atas nama Dr. Suharsono.

3. Bapak Adi selaku teknisi rumah kaca, Bapak Mulya selaku staf Laboratorium Biologi Molekuler dan Bioteknologi IPB, dan Ibu Pepy selaku staf Laboratorium BIORIN atas bantuan yang diberikan selama pelaksanaan penelitian.

4. Ayah dan Ibu atas dukungan finansial dan spiritual.

5. Teman-teman Laboratorium Biorin atas masukan dan diskusi yang sering diberikan.

Penulis menyadari bahwa tesis ini masih ada kekurangan. Namun demikian penulis berharap semoga penelitian ini dapat berguna bagi pihak-pihak yang memerlukannya.

Bogor, Juni 2009

(17)

Penulis dilahirkan di Bondowoso pada tanggal 31 Agustus 1981 dari pasangan Bapak Sutrisno dan Ibu Sri Mastutik. Penulis merupakan anak kedua dari tiga bersaudara.

(18)

DAFTAR TABEL ... viii

DAFTAR GAMBAR ... ix

DAFTAR LAMPIRAN... x

I. PENDAHULUAN... 1

1.1Latar Belakang ... 1

1.2Tujuan Penelitian... 3

1.3Hipotesis Penelitian ... 3

II. TINJAUAN PUSTAKA ... 4

2.1Mekanisme Toleransi Terhadap Aluminium (Al) ... 4

2.2Metallothionein... 6

2.3Melastoma affine L ... 7

2.4Real Time Polimerase Chain Reaction (Real Time PCR) ... 8

III. BAHAN DAN METODE ... 16

3.1Waktu dan Tempat... 16

3.2Bahan Penelitian ... 16

3.3Metode ... 16

3.3.1Perlakuan cekaman pada kultur air ... 17

3.3.2Isolasi RNA total dari Melastoma affine L ... 17

3.3.3Pembentukan cDNA total... 18

3.3.4Analisis ekspresi gen dengan menggunakan Real Time PCR ... 19

IV. HASIL DAN PEMBAHASAN... 21

4.1Isolasi RNA Total ... 21

4.2Sintesis cDNA Total ... 21

4.3Ekspresi Gen Metallothionein ... 22

4.3.1Pengaruh pH rendah terhadap ekspresi gen metallothionein ... 22

4.3.2Pengaruh aluminium terhadap ekspresi gen metallothionein ... 24

V. SIMPULAN DAN SARAN ... 26

5.1Simpulan ... 26

5.2Saran ... 26

(19)

Halaman 1. Nilai relative quantification (RQ) dari transkripsi MaMT2

pada daun dan akar M. affine L.yang mendapat cekaman pH rendah.. 24

2. Nilai relative quantification (RQ) dari transkripsi MaMT2

(20)

Halaman

1. Tiga fase utama pada proses PCR: (1) fase eksponensial dimana terjadi penggandaan jumlah DNA cetakan yang sebenarnya, (2) fase linier dimana proses penggandaan cetakan mulai menurun, (3) fase plateu dimana tidak terjadi lagi

proses penggandaan cetakan dan DNA mulai terdegradasi. Deteksi untuk Real Time PCR terjadi pada fase eksponensial, sedangkan deteksi pada PCR biasa terjadi pada fase plateu yang digambarkan dalam bentuk kurva linier (A) dan kurva log (B)

(Applied Biosystem 2007)... 10

2. Proses deteksi pada Real Time PCR dengan menggunakan SYBR Green. SYBRGreen akan terdeteksi bila terikat pada utas ganda DNA saat fase perpanjangan DNA (extention)

(Dorak 2006)... 11

3. Proses deteksi pada Real Time PCR dengan menggunakan

TaqMan. Deteksi akan terjadi bila TaqMan probe yang menempel diantara primer forward dan primer reverse rusak selama fase

perpanjangan DNA (extention) (Dorak 2006) ... 11

4. Kurva amplifikasi pada Real Time PCR. Threshold adalah daerah deteksi yang digunakan dalam analisis. Cycle Threshold (Ct) adalah siklus pada saat fluorescencereporter berpotongan dengan threshold. Rn adalah jumlah fluorescencereporter yang terdeteksi selama proses PCR. Cycle adalah banyaknya siklus yang digunakan dalam proses PCR (Applied Biosystem 2007)... 12

5. RNA total M. affine L. hasil isolasi dari akar (1) dan daun (2) ... 21

6. Hasil amplifikasi β-actin. Lajur 1,2, dan 3 = hasil amplifikasi dengan menggunakan cDNA sebagai cetakan. Lajur 4 = 1 kb ladder. Lajur 5 = hasil amplifikasi dengan menggunakan DNA genom

sebagai cetakan... 22

7. Ekspresi MaMt2 semikuantitatif pada daun dan akar dari M. affine L. yang mendapat cekaman pH rendah... 23

(21)

Halaman 1. Tabel ANOVA dari pengaruh pH terhadap ekspresi

MaMt2 di daun dan akar M. affine L. ... 32

2. Nilai ekspresi gen MaMt2 terhadap β-actin dari M. affine L.yang mendapat cekaman pH rendah pada daun dan akar ... 33

3. Tabel uji Tukey dari pengaruh konsentrasi aluminium terhadap

(22)

I. PENDAHULUAN

1.1 Latar Belakang

Salah satu usaha untuk meningkatkan produksi pertanian di Indonesia adalah dengan cara ekstensifikasi pertanian, diantaranya dengan pemanfaatan tanah ultisol yang merupakan salah satu jenis tanah di Indonesia yang mempunyai sebaran luas yaitu mencapai 47,5 juta ha (Subagyo et al. 2004), terutama yang berasal dari bahan dasar sedimen seperti pada tipe hapludults (Pusat Penelitian Tanah dan Agroklimat 2000). Tipe tersebut memiliki pH tanah yang sangat rendah berkisar pada pH 4 dan memiliki kandungan aluminium tinggi (Prasetyo & Suriadikarta 2006). Bentuk Al3+ banyak ditemui pada tanah dengan pH berkisar 4 dimana konsentrasi Al dalam larutan air tanah dapat melebihi 100 µM (Okada & Wissuwa 2004). Keberadaan Al dalam tanah, terutama dalam bentuk Al3+ akan sangat berbahaya dan merupakan racun bagi tanaman, karena akan mengganggu perpanjangan akar dan menghalangi daya tukar kation lain misalnya Ca2+, Mg2+, dan K+.

(23)

Menurut Hall (2002), terdapat beberapa mekanisme seluler untuk toleransi terhadap logam yang berbahaya, dan salah satunya dengan memproduksi metallothionein. Metallothionein (MT) merupakan protein yang banyak mengandung sistein dan berfungsi sebagai peptida pengikat logam (metal binding peptides). Cobbett dan Goldbrough (2002) membagi MT menjadi empat macam berdasarkan pada susunan residu sistein (cys) yang dimiliki, yaitu MT tipe 1, MT tipe 2, MT tipe 3 dan MT tipe 4. MT tipe 1 (MT1) tersusun atas enam motif Cys-Xaa-Cys (Xaa menunjukkan asam amino selain cystein) yang terdistribusi pada dua wilayah secara seimbang. MT tipe 2 memiliki dua wilayah yang kaya Cys, dengan motif susunan cystein berupa Cys-Cys pada asam amino ke tiga dan keempat dari protein ini. Selain itu MT tipe 2 (MT2) memiliki motif Cys-Gly-Gly-Cys pada akhir N-terminal dari wilayah cystein-rich dan pada wilayah C-terminal terdapat 3 motif Cys-Xaa-Cys. MT tipe 3 (MT3) hanya terdiri dari empat residu Cys yang ada pada wilayah N-terminal. Tiga residu pertama membentuk motif Cys-Gly-Asn-Cys-Asp-Cys. Sedangkan residu yang keempat membentuk motif tersendiri yaitu Gln-Cys-Xaa-Lys-Lys-Gly. MT tipe 4 (MT4) berbeda dari kelompok MT tanaman yang lainnya karena memiliki tiga wilayah cystein-rich yang masing-masing memiliki 5 sampai 6 residu cystein yang biasanya membentuk motif Cys-Xaa-Cys.

Menurut Duncan et al. (2006), motif dan susunan residu cys yang dimiliki oleh MT diduga berkaitan dengan kemampuan MT mengikat logam dan kestabilan protein. Pada hewan, logam akan terikat pada residu cys dalam formasi logam-cys-(thiolate) dengan cara pertukaran ion logam misalnya ion Zn tergantikan dengan ion Cu, Cd, atau Hg (Duncan et al. 2006) dan bisa juga terjadi pengikatan logam yang berbeda pada saat bersamaan seperti yang terjadi pada alga coklat (Fucus vesiculosus) yang mampu mengikat Cu dan Cd sekaligus (Zimeri et al. 2005). Hasil penelitian Zimeri et al (2005), menunjukkan bahwa pada arabidopsis, pemberian Cd akan meningkatkan stabilitas MT1. Namun mekanisme pertukaran ion logam dan pengikatan ion logam tersebut masih belum diketahui secara pasti.

(24)

kadmium (Cd), dan aluminium (Al) (Robinson et al. 1993; Hall 2001; Snowden & Gardner, 1993; Snowden et al, 1995). Pada tanaman Silene vulgaris (Hoof et al. 2001) dan arabidopsis (Murphy & Taiz, 1995), ekspresi MT2 terinduksi oleh Cu dan keberadaan gen penyandi MT2 membuat mutan kapang yang sensitif terhadap Cu mampu tumbuh dengan penambahan Cu pada medianya (Hoof et al, 2001). Selain terinduksi oleh logam, ekspresi gen MT terinduksi oleh cekaman oksidatif pada jaringan gabus (Mir et al, 2004), terekspresi saat fase senesen pada daun (Buchanan-Wallaston, 1994), dan saat pematangan buah (Davies & Robinson, 2000).

Beberapa gen yang ekspresinya diinduksi oleh Al telah berhasil diisolasi dan dikarakterisasi dari gandum, diantaranya adalah gen penyandi MT (Snowden & Gardner, 1993; Snowden et al, 1995). Suharsono et al (2009) telah mengisolasi cDNA gen penyandi MT2 dari Melastoma affine L (MaMt2). MaMt2 diduga berperan dalam toleransi M. affine terhadap cekaman Al. Untuk mengetahui peranan MaMt2 terhadap Al, maka analisis ekspresi MaMt2 di M. affine L. yang mendapat cekaman Al sangat penting dilakukan.

1.2 Tujuan Penelitian

Tujuan dari penelitian ini adalah untuk menganalisis ekspresi gen penyandi MT2 dari Melastoma affine L. yang mendapat cekaman pH rendah dan Al.

1.3 Hipotesis Penelitian

- Ekspresi gen penyandi MT2 pada daun dan akar Melastoma affine L. akan meningkat bila mendapat cekaman pH rendah.

(25)

II. TINJAUAN PUSTAKA

2.1 Mekanisme Toleransi Terhadap Aluminium (Al)

Pada prinsipnya ada dua mekanisme toleransi tanaman terhadap cekaman Al. Menurut Taylor (1991), mekanisme pertama adalah mekanisme eksklusi dengan cara mencegah Al masuk kedalam simplas dan mencapai daerah metabolik yang peka. Mekanisme kedua adalah mekanisme internal dengan imobilisasi, kompartementasi dan detoksifikasi saat Al masuk kedalam simplas.

Mekanisme eksklusi dapat berupa: (1) immobilisasi Al pada dinding sel: dinding sel tanaman memiliki sifat yang berbeda dalam menghalangi pergerakan Al. Sebagian besar Al yang diserap akar masuk melalui apoplas dengan menggantikan kedudukan Ca2+ dalam sel tanaman. Immobilisasi Al pada dinding sel akan mengurangi pergerakan Al ke dalam simplas; (2) Permeabilitas selektif membran plasma terhadap Al: membran plasma bertindak sebagai penghalang terhadap masuknya Al ke sitosol; (3) Meningkatkan pH di sekitar perakaran: tanaman yang toleran terhadap Al cenderung menaikkan pH lebih cepat dibandingkan tanaman yang peka sehingga dapat membentuk Al menjadi bentuk yang tidak beracun; (4) Eksudasi senyawa-senyawa pengkelat: Al dapat dikeluarkan dari simplas jika ligan pengkelat dibebaskan ke rizosfir dan ligan tersebut membentuk kompleks yang stabil dengan Al, sehingga mengurangi aktifitas ion Al bebas pada daerah akar-tanah serta mengurangi absorpsi melalui membran plasma. Contoh ligan pengkelat adalah asam organik seperti asam oksalat, asam sitrat, asam suksinat, dan asam malat; dan (5) Eksudasi fosfat: fosfat yang secara aktif dikeluarkan dari akar tanaman dapat membentuk kompleks tak larut dengan Al, sehingga mengurangi pengaruh Al pada permukaan menbran dan/atau penyerapan melalui membran plasma.

(26)

dengan nama fitokelatin; dan (4) Induksi sintesis protein tertentu: pada tanaman gandum kultivar PT741 (toleran Al) Basu et al. (1994) menemukan protein sebesar 51 kD yang diisolasi dari membran mikrosomal pada akar. Protein ini disintesis pada ujung akar karena terinduksi cekaman Al 100 M sedangkan pada kultivar Neepawa (peka terhadap Al) tidak terbentuk protein tersebut.

Beberapa spesies tanaman memiliki kemampuan untuk mengakumulasi Al di dalam tunas daun dan akar. Tanaman yang memiliki kemampuan ini antara lain teh (Carr et al. 2003; Ruan & Wong 2004), melastoma (Watanabe & Osaki 2002), dan buckwheat (Ma et al. 1998 ; Zheng et al. 1998). Tanaman disebut sebagai akumulator logam bila mampu mengakumulasi logam sedikitnya 0,1 % pada jaringan (Barcel & Poschnenrider 2003).

Mekanisme tanaman dalam mengakumulasi Al masih belum diketahui secara pasti. Namun beberapa penelitian menunjukkan bahwa Al yang masuk ke dalam tanaman terjerap oleh asam organik yang dihasilkan oleh tanaman. Pada teh diduga bahwa Al terikat pada senyawa chatecin (Vitorello et al. 2005), sedangkan pada melastoma Al terikat pada oksalat dan malat dalam daun (Watanabe & Osaki 2002).

Ekspresi beberapa gen pada gandum terinduksi oleh Al, dan salah satu diantaranya adalah gen penyandi metallothionein (Snowden et al. 1995). Metallothionein merupakan protein yang diproduksi oleh tanaman untuk mengikat logam (Cobbett & Goldsbrough 2002). Gen penyandi metallothionein juga berhasil diisolasi dan dikarakterisasi dari Melastoma affine L. yang merupakan salah satu tanaman akumulator Al (Suharsono et al. 2009).

(27)

terhadap ion logam lain yang berpengaruh terhadap metabolisme tanaman secara normal, sehingga MT2 dibutuhkan untuk menjaga homeostasis ion logam tersebut. Ion logam esensial yang dibutuhkan oleh tanaman dan berikatan dengan MT2 adalah Cu dan Zn (Snowden & Gardner 1993).

2.2 Metallothionein

Tanaman memiliki mekanisme untuk mengendalikan dan merespon masuknya ion logam yang berbahaya ke dalam selnya. Salah satu mekanisme internal yang dimiliki oleh tanaman yaitu dengan mengikat ion logam tersebut pada protein atau senyawa organik tertentu dan mengakumulasikannya pada bagian tanaman tertentu misalnya daun. Tanaman tingkat tinggi memiliki dua kelompok besar peptida pengikat logam, yaitu metallothionein (MT) dan phytochelatin (PC) (Cobbett & Goldsbrough 2002).

MT merupakan polipeptida yang memiliki banyak ikatan sistein (cys) yang disandikan oleh gen, memiliki berat molekul yang rendah, dan merupakan protein pengikat logam. Sebagai konsekuensi dari banyaknya kandungan asam amino Cys maka protein ini mengandung kelompok ’thiol’ (sulfidril, -SH) dalam jumlah yang besar. Kelompok ’thiol’ mengikat logam-logam berat dengan sangat kuat dan efisien, termasuk zink, merkuri, tembaga, dan kadmium. Residu sulfidril dari Cys mampu mengikat logam dimana satu ion logam diikat oleh tiga residu –SH atau satu ion logam dengan 2 residu –SH. Koordinasi pengikatan dari setiap ion logam melalui residu –SH yang ada pada Cys, membentuk struktur tetrahedral tetrathiolate (Schultze et al. 1988; Robbins et al. 1991). Pada hewan, logam akan terikat pada residu cys dalam formasi logam-cys-(thiolate) dengan cara pertukaran ion logam misalnya ion Zn tergantikan dengan ion Cu, Cd, atau Hg (Duncan et al. 2006). Menurut Zangger et al. (2001), MT mengikat logam dengan sangat kuat namun pertukaran ikatan logam dapat berlangsung dengan mudah karena ikatan MT terhadap logam memiliki stabilitas termodinamik yang tinggi dan stabilitas kinetik yang rendah.

(28)

2000). Seringkali beberapa tipe MT ditemui pada tanaman yang sama dan memiliki kesamaan kinerja seperti yang ditemui pada Arabidopsis, dimana Hernandez et al. (1998) menemukan bahwa terdapat overlapping antara MT1 dan MT2 dalam pola ekspresinya. Pada arabidopsis, MT ditemukan terekspresi walaupun tidak ada cekaman Cu. Saat tidak ada cekaman, MT1 terekspresi pada jaringan trikoma dan vaskular daun, akar, bunga, dan benih. Sedangkan saat dikenai cekaman Cu, MT1 diekspresikan pada jaringan mesofil daun dan tunas. MT2 ditemukan pada trikoma Arabidopsis, baik yang dikenai cekaman maupun yang tidak dikenai cekaman Cu.

Kemampuan MT untuk melakukan kompartemensasi Cd pada vakuola ditunjukkan oleh hasil penelitian Vogeli-Lange (1990). Pada vakuola daun tembakau (Nicotiana rustica), Cd terikat pada protein yang memiliki gugus (γ-Glu-Cys)3Gly dan (γ-Glu-Cys)4Gly, yang kemudian dikenali sebagai MT tipe 3.

Selain berfungsi untuk detoksifikasi logam berat, berbagai fungsi seluler MT adalah untuk pengaturan homeostasis logam esensial, perlindungan terhadap radiasi dan kerusakan oksidatif, dan kontrol seluler dalam poliferasi dan apoptosis (Klaassen 1998).

2.3 Melastoma affine L.

M. affine L. merupakan salah satu spesies dari famili Melastomataceae yang mampu mengakumulasi Al (Jansen et al. 2002), setelah Rubiaceae (Jansen et al. 2003). Menurut Li et al (2000), M. affine L. dapat hidup pada tanah dengan pH dibawah 4 dan mampu mengakumulasi Al sebanyak 9099 – 12810 mg/kg daun dan 3499 – 3633 mg/kg akar. Tanaman diklasifikasikan sebagai akumulator bila mengakumulasi Al sedikitnya 1000 mg/kg daun (Jansen et al. 2002).

(29)

menghindari pengaruh ion Al. Pada melastoma, gen-gen ini diduga tidak hanya berperan dalam mendetoksifikasi Al, tetapi juga menginduksi hormon pertumbuhan.

Watanabe dan Osaki (2003) menyatakan bahwa Al mampu menembus jaringan endodermis dan masuk ke dalam pembuluh xilem dan ditimbun di dalam daun. Penelitian Mutiasari (2008) menunjukkan adanya akumulasi Al sebesar 8,81 mg/gr daun tua tanaman M. affine L. yang diberi cekaman 3,2 mM Al pada pH 4 selama 2 bulan. Akumulasi Al tersebut dapat ditemui pada jaringan mesofil daun (Mutiasari 2008). Penelitian lain yang dilakukan oleh Watanabe dan Osaki (2002) menyatakan bahwa akumulasi Al terjadi terutama pada bagian vakuola daun. Selain itu juga terjadi akumulasi pada jaringan periderm sampai xilem pada akar dan pada jaringan korteks, xilem sekunder dan empulur batang (Mutiasari 2008). Didalam jaringan melastoma, Al ditemukan dalam bentuk Al monomerik, Al-oksalat, Al-(oksalat)2, dan Al-(oksalat)3 (Watanabe et al. 1998). Karena kemampuan Melastoma untuk mengakumulasi Al dalam jumlah yang tinggi, maka melastoma dapat dijadikan sebagai tanaman model bagi ketahanan Al terutama bagi tanaman dikotil.

2.4 Real Time Polimerase Chain Reaction (Real Time PCR)

(30)

Untuk mengetahui kuantitas ekspresi dari suatu gen, biasanya digunakan northern blotting atau PCR biasa yang menggunakan produk akhir sebagai dasar perhitungan. Penggunaan northern blotting untuk mengetahui ekspresi gen memerlukan jumlah RNA yang cukup banyak (Hunt 2006). Selain itu, pengukuran kuantitas ekspresi suatu gen dengan menggunakan hasil akhir dari proses PCR mempunyai kelemahan yaitu presisi yang kurang, tidak sensitif, resolusi rendah, tidak otomatis, diskriminasi hanya dari ukuran saja, hasil tidak diekspresikan secara kuantitatif (Applied Biosystem 2007).

(31)

Gambar 1. Tiga fase utama pada proses PCR: (1) fase eksponensial dimana terjadi penggandaan jumlah DNA cetakan yang sebenarnya, (2) fase linier dimana proses penggandaan cetakan mulai menurun, (3) fase plateu dimana tidak terjadi lagi proses penggandaan cetakan dan DNA mulai terdegradasi. Deteksi untuk Real Time PCR terjadi pada fase eksponensial, sedangkan deteksi pada PCR biasa terjadi pada fase plateu yang digambarkan dalam bentuk kurva linier (A) dan kurva log (B) (Applied Biosystem 2007)

Real Time PCR adalah metode kuantifikasi PCR yang memungkinkan untuk mengamati pertambahan amplikon selama proses amplifikasi. Pada Real Time PCR, perhitungan amplikon dilakukan pada saat fase eksponensial (Gambar 1). Sistem Real Time PCR menggunakan dasar pada deteksi dan kuantifikasi fluorescence reporter. Signal akan meningkat sesuai dengan jumlah produk PCR pada setiap siklus (Dorak 2006). Ada dua macam fluorescence reporter yang biasanya digunakan dalam Real Time PCR, yaitu SYBR Green (Gambar 2) dan TaqMan (Gambar 3). SYBR Green merupakan senyawa kimia yang akan mendeteksi semua utas ganda DNA, biasa digunakan untuk perhitungan kuantitas DNA dengan tujuan yang tidak spesifik. Sedangkan TaqMan lebih spesifik daripada SYBR Green karena menggunakan TaqMan probe, yaitu probe yang komplemen dengan utas DNA spesifik yang berada diantara primer forward dan primer reverse dan didesain sedemikian rupa sehingga bila probe tersebut rusak akibat proses perpanjangan DNA pada proses PCR maka akan melepaskan energi yang dapat ditangkap oleh mesin Real Time PCR dengan dasar teknologi FRET (Fluorescent Resonance Energy Transfer). Teknologi FRET didasari oleh transfer Rn

SIKLUS eksponensial

Linier

Plateu

eksponensial Linier

[image:31.612.101.512.49.280.2]
(32)

energi dari pelacak berenergi tinggi (reporter dye) yang diletakkan didekat pelacak berenergi rendah (quencer dye), transfer energi tersebut akan terjadi bila pelacak berenergi tinggi rusak (Applied Biosystem 2007).

Gambar 2. Proses deteksi pada Real Time PCR dengan menggunakan SYBR Green. SYBR Green akan terdeteksi bila terikat pada utas ganda DNA saat fase perpanjangan DNA (extention) (Dorak 2006)

[image:32.612.167.434.146.325.2] [image:32.612.188.451.387.607.2]
(33)

Fluorescence reporter akan meningkat sampai pada jumlah yang bisa terdeteksi oleh Real Time PCR dan digambarkan dalam bentuk kurva amplifikasi (Gambar 4). Kurva amplifikasi mengandung beberapa informasi penting: (1) threshold yaitu daerah deteksi yang terjadi pada saat jumlah fluorescence reporter bisa dideteksi oleh mesin Real Time PCR, agar hasil perhitungan lebih akurat threshold berada pada fase eksponensial; (2) Cycle Threshold (Ct) yaitu siklus pada proses PCR saat jumlah fluorescence reporter berpotongan dengan garis threshold yang ditetapkan untuk perhitungan pada Real Time PCR; (3) Rn yaitu jumlah fluorescence reporter yang terdeteksi; dan (4) Cycle yaitu jumlah siklus yang digunakan dalam proses PCR (Applied Biosystem 2007).

Gambar 4. Kurva amplifikasi pada Real Time PCR. Threshold adalah daerah deteksi yang digunakan dalam analisis. Cycle Threshold (Ct) adalah siklus pada saat fluorescence reporter berpotongan dengan threshold. Rn adalah jumlah fluorescence reporter yang terdeteksi selama proses PCR. Cycle adalah banyaknya siklus yang digunakan dalam proses PCR (Applied Biosystem 2007)

[image:33.612.192.444.298.435.2]
(34)

Relative quantitation banyak digunakan untuk mengetahui tingkat ekspresi suatu gen pada suatu perlakuan dibandingkan dengan ekspresi gen yang sama pada perlakuan yang lain. Untuk mengetahui ekspresi suatu gen maka dibutuhkan gen referensi sebagai pembanding internal (endogenous control) jumlah DNA agar tidak terjadi kesalahan interpretasi akibat jumlah sel yang berbeda. Gen referensi adalah gen yang tidak dipengaruhi oleh lingkungan. Gen referensi yang paling banyak digunakan adalah β-aktin dan Glyceraldehyde-3-phosphat-dehydrogenase (GAPDH) (Bustin 2000).

Ada dua metode yang bisa digunakan untuk mengetahui tingkat ekspresi gen dengan menggunakan relative quantitation, yaitu metode kurva standar relatif (relative standard curve method) dan metode comparative Ct (comparative Ct method/∆∆Ct). Metode kurva standar relatif menggunakan kurva standar relatif yang akan digunakan untuk menghitung kuantitas sampel. Kurva standar yang digunakan dapat dibuat dari DNA apapun yang sudah diketahui kuantitasnya dengan pengenceran berseri. Oleh karena itu metode ini membutuhkan tingkat akurasi yang tinggi dalam pemipetan sampel DNA yang akan digunakan untuk kurva standar dan tidak membutuhkan validasi PCR sebelumnya. Namun metode ini membutuhkan lebih banyak bahan reaksi kimia dan membutuhkan banyak tempat reaksi PCR. Selanjutnya kuantitas gen target dan gen referensi dapat diketahui dengan memasukkan nilai Ct gen target dan gen referensi ke dalam kurva standar (log ng DNA dibanding nilai Ct). Ekspresi gen target pada suatu perlakuan dilakukan dengan menormalisasi kuantitas gen target dengan gen referensi dan membandingkan hasil normalisasi gen target pada perlakuan dengan hasil normalisasi gen target pada perlakuan kontrol (kalibrator) (Applied Biosystem 2004).

Gen target yang dinormalisasi (perlakuan/kalibrator)

referensi gen ng et t gen ng arg =

(35)

Metode ∆∆Ct banyak digunakan untuk menghitung ekspresi gen dari sampel yang banyak. Karena tidak perlu menggunakan kurva standar, metode ini lebih menghemat bahan reaksi PCR dan tidak membutuhkan akuransi dalam pemipetan. Dalam metode ∆∆Ct, dibutuhkan validitas efisiensi reaksi PCR yang biasa dilakukan dengan merancang primer yang menghasilkan amplikon berukuran lebih kecil daripada 150 pb, dimana pada ukuran amplikon tersebut maka efisiensi PCR yang terjadi adalah 100%.

Metode ∆∆Ct menggunakan rumus aritmatika 2-∆∆CT untuk mengetahui ekspresi gen target yang telah dinormalisasi gen referensi, dan relatif terhadap kalibrator (Relative Quantification/RQ). Rumus aritmatika tersebut diperoleh dari rumus eksponensial amplifikasi proses PCR yaitu:

Xn = X0 x (1 + EX) Ct

= K dimana K= konstanta (1)

Dimana : Xn = jumlah DNA pada siklus ke n X0 = jumlah DNA mula-mula EX = efisiensi PCR

Ct = adalah siklus yang diinginkan atau Cycle threshold

Bila gen target disimbolkan dengan X dan gen referensi disimbolkan dengan R, maka rumus tersebut diatas dapat digunakan untuk mencari KX maupun KR. Sehingga ekspresi gen X dinormalisasikan dengan gen referensi R, adalah

R X CTR R CTX X T T K K E x R E x X R X = + + = ) 1 ( 0 ) 1 ( 0 (2)

Nilai efisiensi gen X (EX) dan gen R (ER) sama, sehingga

K E

x R

X + CTX−CTR = ) 1 ( 0 0 (3)

Nilai ekspresi suatu gen yang sesungguhnya adalah jumlah DNA awal yang digunakan sebagai cetakan, sehingga rumus (4) dapat diturunkan menjadi

XN = K x (1+E)-CT (4)

Dimana : XN = 0

0 R X

∆CT = CTX-CTR

(36)

CT CTK CTP NK NP E E x K E x K X

X ∆∆

∆ − ∆ − + = + +

= (1 )

) 1 ( ) 1 ( (5)

Dimana : -∆∆CT = -(∆CTP - ∆CTK)

Bila amplikon yang dihasilkan berukuran kurang dari 150 pb, maka nilai effisiensi PCR adalah 100% yang nilainya sama dengan 1, sehingga jumlah gen X pada suatu perlakuan yang telah dinormalisasi dengan gen referensi, dibandingkan dengan kalibrator adalah

2-∆∆CT (6)

(37)

III. BAHAN DAN METODE

3.1 Waktu dan Tempat

Penelitian ini dilaksanakan pada bulan Juni 2007 – Desember 2008 di Laboratorium Biologi Molekuler dan Seluler Tanaman, Laboratorium BIORIN Pusat Penelitian Sumberdaya Hayati dan Bioteknologi Institut Pertanian Bogor, dan Laboratorium Terpadu, Balai Besar Penelitian dan Pengembangan Bioteknologi dan Sumberdaya Genetik Pertanian, Badan Penelitian dan Pengembangan Pertanian. Perlakuan cekaman pH dan Al dilakukan di rumah kaca Institut Pertanian Bogor.

3.2 Bahan Penelitian

M. affine L. digunakan sebagai bahan tanaman. Primer forward (MF) 5’TCGAGAAAAATGTCTTGCTGTG3’ dan primer reverse (MR1) 5’GTCTCGCCGGAGAATCCCAAG3’ yang didesain dari MaMt2 (Suharsono et al. 2009) menghasilkan produk sebesar 113 pb digunakan untuk analisis ekspresi MT2. Primer forward (ActF) 5’ATGGCAGATGCCGAGGATAT3’ dan primer reverse (ActR2) 5’TCGAGGTCGGCCAACAATAC3’ yang didesain dari gen β actin kedelai (Shah et al. 1982) dan menghasilkan produk sebesar 123 pb, digunakan sebagai pembaku dalam analisis ekspresi. Primer forward (ActF) 5’ATGGCAGATGCCGAGGATAT3’ dan primer reverse (ActR) 5’CAGTTGTGCGACCACTTGCA3’ yang didesain dari gen β actin kedelai (Shah et al. 1982), digunakan untuk mengetahui kontaminasi DNA genom pada cDNA.

3.3 Metode

(38)

3.3.1 Perlakuan cekaman pada kultur air

Bahan tanam yang digunakan berasal dari stek pucuk tanaman M. affine L. yang diambil dari Jasinga, Kabupaten Bogor, Jawa Barat. Pengadaan stek pucuk dilakukan dengan memotong 4 - 6 ruas dari pucuk tanaman. Pucuk ditanam pada tanah Jasinga dan ditutup dengan plastik selama seminggu untuk mengurangi penguapan. Setelah itu, tutup plastik dibuka dan dibiarkan selama sebulan sampai tumbuh akar. Selanjutnya pucuk yang mempunyai akar kurang lebih 1 cm ditanam pada tempat yang berisi larutan nutrisi standar pH 6 dengan komposisi NH4NO3 2,14 mM; NaH2PO4 3,2 µM; K2SO4 : KCl (1:1) 0,77 mM; CaCl 1,2 mM; MgSO4 0,82 mM; FeSO4 35,8 µM; MnSO4 9,1 µM; H3BO3 46,3 µM; ZnSO4 3,1 µM; CuSO4 0,16 µM; (NH4)6Mo7O24 0,05 µM (Watanabe et al. 1998) dan diberi aerasi, selama seminggu. Setelah satu minggu, tanaman siap untuk diberi perlakuan cekaman pH dan Al.

Percobaan dilakukan dengan dua macam perlakuan dan dua ulangan. Perlakuan yang diberikan adalah pH dan konsentrasi Al. Perlakuan pH menggunakan 2 tingkat, yaitu pH 6 (kontrol) dan 4. Sedangkan perlakuan konsentrasi Al yang diberikan adalah 0 mM (kontrol), 0,8 mM dan 3,2 mM yang dilakukan pada pH 4. Sampel berupa daun dan akar diambil 1 minggu setelah perlakuan untuk isolasi RNA total agar didapatkan ekspresi gen yang sesungguhnya.

3.3.2 Isolasi RNA total dari Melastoma affine L.

(39)

volume LiCl 10 M dan diinkubasi pada suhu -32oC selama 2,5 jam. Campuran disentrifugasi pada kecepatan 42000xg pada suhu 4oC selama 10 menit. Cairan dibuang dan endapan RNA total disuspensikan dalam 500 µl TE 1X (Tris HCl pH 7,4 10 mM dan EDTA 1 mM) kemudian dipindahkan ke tabung 1,5 ml. Suspensi RNA total diekstraksi dengan penambahan 1X volume fenol pH 9, divortex dan disentrifugasi pada kecepatan 8000xg (Jouan BR4i) pada suhu 20oC selama 10 menit. Cairan bagian atas yang mengandung RNA total diambil, dimasukkan dalam tabung 1,5 ml, dan diekstraksi kembali dengan 1X volume fenol : kloroform : isoamil alkohol (25:24:1), divortex dan disentrifugasi pada kecepatan 8000xg (Jouan BR4i) pada suhu 20oC selama 10 menit. Cairan bagian atas diambil, dimasukkan dalam tabung 1,5 ml, ditambah ¼X volume LiCl 10 M dan kemudian diinkubasi pada suhu -32oC selama 2,5 jam. Cairan disentrifugasi pada kecepatan 8000xg pada suhu 4oC selama 15 menit. Cairan dibuang dan endapan RNA total dibilas dengan penambahan 500 µl ethanol 70 % dan disentrifugasi pada kecepatan 5000xg pada suhu 4oC selama 10 menit. Endapan RNA total dikeringkan dengan pengering vakum dan disuspensikan dengan 20 µl DEPC H2O. Keutuhan RNA total diuji dengan melakukan elektroforesis RNA total di gel agarose 1 % dalam buffer MOPS 1X (MOPS 4,2 g/l; Na asetat 0,41 g/l; Na2EDTA 0,37 g/l). Visualisasi RNA total dilakukan di atas UV transluminator GelDoc (Labquip) setelah diwarnai dengan EtBr (0,5 g/ml) selama 30 menit dan dibilas dengan air.

3.3.3 Pembentukan cDNA total

Untuk mendapatkan RNA yang bebas dari DNA genom, suspensi RNA total diberi Dnase sebelum sintesis cDNA dengan mencampur 5 µg RNA total, buffer Dnase I 1X, Dnase I bebas RNase (Fermentas) 0,2 U, dan DEPC H2O sampai volume total mencapai 10µl. Larutan diinkubasi pada suhu ruang selama 5 menit. Setelah itu ditambahkan EDTA 2,5 mM dan diinkubasi kembali pada suhu 65oC selama 10 menit.

(40)

DEPC-H2O dengan volume reaksi 20 µl. Proses sintesis cDNA dilakukan dengan alat PCR (MJ Research TM 100) dengan menginkubasi campuran pada suhu 30oC selama 10 menit, kemudian inkubasi pada suhu 42oC selama 50 menit, inkubasi pada suhu 95oC selama 5 menit dan 20oC selama 5 menit.

Keberhasilan dan kemurnian sintesis cDNA total dan kemurnian cDNA total dari DNA genom diverifikasi dengan menggunakan PCR menggunakan primer forward ActF dan primer reverse ActR yang spesifik untuk ekson1 – ekson2 dari aktin. Reaksi PCR yang digunakan adalah 1 µl cDNA total, Taq buffer 1X, dNTP mix 4 mM, ActF 20 pmol dan ActR 20 pmol, enzim Taq DNA polimerase (RBC) 0,5 U, DMSO 4% dan dH2O sampai volume akhir 10 µl. PCR dilakukan dengan kondisi pra-PCR pada 94oC, 5 menit; denaturasi pada 94oC, 30 detik; penempelan primer pada 55oC, 30 detik; pemanjangan pada 72oC, 1,5 menit; pasca PCR pada 72oC, 7 menit; dan pendinginan 20 oC, 5 menit. PCR dilakukan sebanyak 30 siklus. Amplifikasi gen β actin ekson1-ekson2 dengan menggunakan DNA genom melastoma sebagai cetakan digunakan sebagai kontrol terjadinya kontaminasi terhadap sintesis cDNA. Keberhasilan sintesis cDNA diketahui dari terbentuknya pita berukuran 450 pb. Bila terjadi kontaminasi DNA genom pada cDNA, maka akan didapatkan 2 pita yang masing-masing berukuran 450 pb (dari cDNA) dan 550 pb (dari DNA genom).

3.3.4 Analisis ekspresi gen dengan menggunakan Real Time PCR

(41)

mancapai 55oC. Saat suhu annealing mencapai 55oC, proses PCR dilakukan sebanyak 30 siklus.

(42)

IV. HASIL DAN PEMBAHASAN

4.1 Isolasi RNA Total

[image:42.612.271.371.404.494.2]

RNA total telah berhasil diisolasi dari daun dan akar M. affine L. Keutuhan RNA total ditunjukkan dengan adanya 2 pita, yaitu rRNA 28S dan 18S (Gambar 5) karena rRNA merupakan jenis RNA yang paling banyak ditemui di dalam sel dan rRNA 28S dan 18S merupakan dua jenis RNA yang memiliki ukuran paling besar, dan pada saat dimigrasikan kedua jenis rRNA ini tampak paling jelas sehingga bisa digunakan untuk menentukan integritas RNA total yang didapatkan. Bila terjadi degradasi pada RNA total, maka intensitas kedua pita rRNA tersebut tidak sama (Bowtell & Sambrook 2003). Sehingga, keberadaan kedua pita rRNA ini menunjukkan bahwa RNA total yang diisolasi mempunyai keutuhan yang tinggi sehingga sangat baik digunakan sebagai cetakan untuk sintesis cDNA total. Selain kedua pita tersebut, RNA total dari daun mengandung beberapa pita RNA yang kemungkinan adalah rRNA yang terdapat pada mitokondria dan kloroplas yang berukuran 23S, 16S, dan 5S.

Gambar 5. RNA total M. affine L. hasil isolasi dari akar (1) dan daun (2)

RNA total mengandung mRNA sehingga RNA total yang utuh juga mengandung mRNA yang utuh. Oleh sebab itu, keutuhan RNA total sangat penting untuk sintesis cDNA total.

4.2 Sintesis cDNA Total

Dari RNA total yang diisolasi, telah berhasil disintesis cDNA total melalui transkripsi balik dengan menggunakan RNA total sebagai cetakan. Dengan primer oligo-dT, hanya mRNA yang dapat disintesis menjadi cDNA karena mempunyai poliA pada ujung 3’ sedangkan rRNA dan tRNA tidak mempunyai poliA. PCR

1. 2.

(43)
[image:43.612.225.407.302.428.2]

dengan menggunakan primer ActF dan ActR yang dirancang dari ekson 1 dan ekson 2 gen aktin menghasilkan DNA yang berukuran sekitar 450 pb (Gambar 6) yang menunjukkan bahwa daerah yang diamplifikasi adalah cDNA bukan DNA genom dari gen actin. Gen aktin memiliki ukuran sekitar 550 pb karena mengandung intron yang akan dibuang pada saat pembentukan mRNA. Teramplifikasinya cDNA aktin dengan ukuran 450 pb menunjukkan bahwa sintesis cDNA total melalui proses transkripsi balik telah berlangsung dengan baik. Hal ini juga menunjukkan bahwa RNA total yang telah diisolasi mempunyai kualitas yang sangat bagus, karena selain dapat digunakan untuk mensintesis cDNA juga terbebas dari kontaminasi DNA. Oleh sebab itu, cDNA total ini dapat digunakan sebagai bahan untuk analisis ekspresi gen.

Gambar 6. Hasil amplifikasi β-actin. Lajur 1,2, dan 3 = hasil amplifikasi dengan menggunakan cDNA sebagai cetakan. Lajur 4 = 1 kb ladder. Lajur 5 = hasil amplifikasi dengan menggunakan DNA genom sebagai cetakan.

4.3 Ekspresi Gen Metallothionein

4.3.1 Pengaruh pH rendah terhadap ekspresi gen metallothionein

Untuk mengetahui tingkat ekspresi MaMt2 pada pH rendah, perlakuan pH 6 digunakan sebagai pembanding dan pH 4 sebagai perlakuan. Analisis ekspresi gen dilakukan pada daun dan akar M. affine L. Hasil ANOVA (Lampiran 1) terhadap ekspresi gen MaMt2 dari M. affine L. menunjukkan bahwa ekspresi MaMt2 pada akar dan pada daun antara M. affine L. yang mendapat cekaman pH 6 dan pH 4 tidak berbeda nyata (Tabel 1), walaupun terdapat perbedaan ekspresi yang relatif besar antara perlakuan pH 6 dan pH 4. Hal ini mungkin disebabkan oleh perbedaan ekspresi yang tinggi dalam ulangan pada perlakuan yang sama (Lampiran 2). Pengamatan pada gel agarose (Gambar 7) tidak menunjukkan

450 pb

1 2 3 4 5

(44)

adanya perbedaan ekspresi gen MaMt2 yang terlihat dari perpendaran pita MaMt2 yang sama antara perlakuan pH 6 dan pH 4 baik pada akar ataupun pada daun.

[image:44.612.162.495.367.581.2]

Pada perlakuan pH rendah, tidak ada logam yang diberikan secara berlebihan pada media tumbuh. Metallothionein merupakan protein yang berfungsi untuk mendetoksifikasi logam dan untuk menjaga homeostasis logam didalam sel (Cobbett and Goldbrough, 2002). Bila logam berupa ion bebas yang disebabkan pengaruh pH rendah masih berada dibawah konsentrasi yang dapat menyebabkan keracunan, maka ion ini tidak mempengaruhi ekspresi MaMt2. Ion logam (Cu, Mg, Mn, Fe, Zn) yang terdapat pada medium Watanabe et al. (1998) merupakan logam esensial yang dibutuhkan tanaman untuk tumbuh dengan baik, untuk membentuk struktur protein dan katalisis enzim yang terlibat dalam metabolisme dan pertumbuhan tanaman (Haydon et al. 2007).

Tabel 1. Nilai relative quantification (RQ) dari transkripsi MaMt2 pada daun dan akar M. affine L. yang mendapat cekaman pH rendah

RQ Perlakuan

daun akar

pH 6 1 1

pH 4 0,3 2.6

[image:44.612.176.413.437.579.2]

Keterangan : pH tidak berpengaruh terhadap tingkat ekspresi MaMT2 (P>0,05)

Gambar 7. Ekspresi MaMt2 semikuantitatif pada daun dan akar dari M. affine L. yang mendapat cekaman pH rendah

MaMt2

Β actin

pH6 pH4 pH6 pH4

(45)

4.3.2 Pengaruh aluminium terhadap ekspresi gen metallothionein

Pengaruh aluminium pada ekspresi gen metallothionein dapat diketahui dengan cara melihat tingkat ekspresi MaMt2 pada perlakuan pemberian Al 0,8 mM dan 3,2 mM setelah dibandingkan dengan perlakuan Al 0 mM sebagai kontrol. Analisis ekspresi dilakukan pada daun dan akar M. affine L.

[image:45.612.124.515.456.522.2]

Uji Tukey (Lampiran 3) menunjukkan bahwa tidak ada perbedaan nyata antar perlakuan Al 0 mM, Al 0,8 mM, dan Al 3,2 mM terhadap ekspresi gen MaMt2 di daun (Tabel 2). Sedangkan pada akar, perlakuan Al 0,8 mM tidak berbeda nyata terhadap ekspresi MaMt2 bila dibandingkan dengan Al 0 mM. Namun, perlakuan Al 3,2 mM menginduksi ekspresi gen MaMt2 di M. affine L. Ekspresi MaMt2 di akar dari tanaman M. affine L. yang mendapatkan cekaman Al 3,2 mM meningkat 2 kali lipat dibandingkan dengan perlakuan Al 0 mM dan 0,8 mM. Pengecekan pada gel agarose menunjukkan perpendaran pita MaMt2 yang sama pada perlakuan Al 0 mM dan Al 0,8 mM baik pada daun maupun pada akar, sedangkan perpendaran pita MaMt2 pada perlakuan Al 3,2 mM pada akar meningkat intensitasnya (Gambar 8).

Tabel 2. Nilai relative quantification (RQ) dari transkripsi MaMt2 pada daun dan akar M. affine L. yang mendapat perlakuan Al pada medium dengan pH 4

RQ Perlakuan Al

daun akar

0 mM 1 1

0.8 mM 1.1 1

3.2 mM 0.5 2.1*

Keterangan : * mengindikasikan beda nyata secara statistik (P<0,05)

Gambar 8. Ekspresi MaMt2 semikuantitatif pada daun dan akar dari M. affine L. yang mendapat cekaman Al

MaMT2

β actin

0 mM 3,2 mM 0 mM 0,8 mM 3,2 mM

1. Daun 2. Akar

[image:45.612.168.470.559.668.2]
(46)

Cekaman Al tidak meningkatkan ekspresi MaMt2 di daun, tetapi meningkatkan ekspresi MaMt2 di akar. Hal ini dapat terjadi karena akar merupakan organ pada tumbuhan yang berinteraksi langsung dengan Al pada media tumbuh. Menurut Hernandes (1998) ekspresi MT dipengaruhi oleh spesies tanaman, jenis jaringan dan tipe MT, sehingga ekspresi jenis MT yang sama pada spesies yang berbeda akan berbeda, begitu juga bila berada pada jaringan yang berbeda.

Pada akar, ekspresi MaMt2 meningkat pada kondisi cekaman Al yang tinggi (3,2 mM) selama 7 hari. Sedangkan pada cekaman Al 0,8 mM, tidak terjadi perubahan tingkat ekspresi dibandingkan dengan tanpa cekaman Al. Hal ini dapat terjadi karena M. affine L. merupakan tanaman yang sangat toleran terhadap Al, sehingga pada konsentrasi Al 0,8 mM, diduga belum menginduksi ekspresi MaMt2, bila dibandingkan dengan tanpa cekaman Al.

(47)

V. SIMPULAN DAN SARAN

5.1 Simpulan

Cekaman pH 4 tidak menyebabkan kenaikan ekspresi MaMt2 baik pada akar maupun pada daun. Sedangkan cekaman aluminium pada konsentrasi 3,2 mM menyebabkan kenaikan ekspresi MaMt2 pada akar tetapi tidak pada daun dari M. affine L.

5.2 Saran

(48)

DAFTAR PUSTAKA

Applied Biosystem. 2004. Guide to Performing Relative Quantitation of Gene Expression Using Real-Time Quantitative PCR. Applied Biosystem

Applied Biosystem. 2007. Real Time PCR VS Traditional PCR. Applied Biosystem

Barcelo J, Poschenrieder C. 2003. Phytoremediation : principles and perspectives. Science 2 (3) : 332-344

Bowtell D, Sambrook J. 2003. DNA Microarrays: A Molecular Cloning Manual. Cold Spring Harbor Laboratory Press. New York

Buchanan-Wollaston V. 1994. Isolation of cDNA clones for genes that are expressed during leaf senescence in Brassica napus. Identification of a gene encoding a senescence-specific metallothionein-like protein. Plant Physiol 105: 839-846

Bustin SA. 2000. Absolute quantification of mRNA using real time reverse transcription polymerase chain reaction assays. Review. J Mole Endocrin 25: 169-193

Bustin SA, Benes V, Nolan T, Pfaffl MW. 2005. Quantitative real time RT-PCR – a perspective. Review. J Mole Endocrin 34: 597–601

Carr HP, Lombi E, Kupper H, Mcgrath SP, Wong MH. 2003. Accumulation and distribution of aluminum and other elements in tea (Camellia sinensis) leaves. Agronomie 23: 705-710

Cobbett C, Goldbrough P. 2002. Phytochelatin and metallothionein: roles in heavy metal detoxification and homeostatis. Annu Rev Biol 53: 159-182

Davies C, Robinson SP. 2000. Differential screening indicates a dramatic change in mRNA profiles during grape berry ripening. Cloning and characterization of cDNAs encoding putative cell wall and stress response proteins. Plant Physiol 122: 803-812

Dorak MT. 2006. Real Time PCR. Advance method series. www.dorak.info/genetics/realtime.html [29Apr 2007]

(49)

Frank BC. 2007. Two step real time RT-PCR protocol. http://pga.tigr.org/sop/RT-PCR.pdf [3 Mei 2007]

Hall Jl. 2001. Cellular mechanisms for heavy metal detoxification and tolerance. J Exp Bot 53 (366): 1-11

Haydon MJ, Cobbett CS. 2007. Transporters of ligands for essential metal ions in plants. Research review. NewPhytologist 174:499 – 506

Hernandez AG, Murphy A, Taiz L. 1998. Metallothioneins 1 and 2 have distinct but overlapping expression patterns in Arabidopsis. Plant Physiol 118: 387–397

Hunt M. 2006. Real Time PCR. The Board of Trustees of the University of South Carolina

Jansen S, Watanabe T, Smets E. 2002. Aluminum accumulation in leaves of 127 species in Melastomataceae with comment on the order Myrtales. Annals Bot 90: 53-64

Jansen S, Watanabe T, Dessein S, Smets E, Robbrecht E. 2003. A comparative study of metal level in leaves of some Al-accumulating rubiaceae. Annals Bot 91 : 657-663

Klaassen CD. 1998. Metallothionein IV. Birkhauser Verlag. Basel. Switzerland

Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real time quantitative PCR and the 2 – CT method. Methods 25 : 402-408

Li J, Xie Z, Ye Z, Wong MH. 2000. Aluminum uptake and accumulation by aluminum excluder and accumulators as influenced by pH in plants and pH change in rhizophere soil. www.chinawater.net[29 Apr 2007]

Ma JF, Hiradate S, Matsumoto H. 1998. High aluminium resistant in buckwheat. II. Oxalic acid detoxifies aluminium internally. Plant Physiol 117: 753-759

Mir G et al. 2004. A plant type 2 metallothionein (MT) from cork tissue responds to oksidative stress. J Exp Bot 55 (408): 2483–2493

Moyle R et al. 2005. Developing pineapple fruit has a small transcriptome dominated by metallothionein. J Exp Bot 55 (409): 101-112

(50)

Mutiasari A. 2008. Akumulasi aluminium pada Melastoma affine dan Melastoma malabathricum [Thesis]. Bogor: Program Pascasarjana, Institut Pertanian Bogor

Murphy A, Taiz L. 1995. Comparison of metallothionein gene expression and non protein thiol in ten arabidopsis ecotypes. Corelation with cooper tolerance. Plant Physiol 109: 945-954

Okada K, Wisuwa M. 2004. Soil acidity and related problems in upland rice in the tropics. Di dalam: Toriyama K, Heong KL, Hardy B, editor. Rice is life: scientific perspectives for the 21st century. Proceeding of the World Rice Research Conference; Tsukuba, 5-7 Nov 2004. Japan: IRRI Publications. Pp: 454-456

Prasetyo BH, Suriadikarta DA. 2006. Karakteristik, potensi, dan teknologi pengelolaan tanah ultisol untuk pengembangan pertanian lahan kering di Indonesia. J Litbang Pertanian 25 (2): 39-46

PE Biosystem. 2007. Sequence Detection System Quantitative Assay Design and Optimizing. PE Biosystem

Pusat Penelitian Tanah dan Agroklimat. 2000. Atlas Sumberdaya Tanah Eksplorasi Indonesia Skala 1: 1.000.000. Pusat Penelitian Tanah dan Agroklimat. Bogor

Reid KE, Olsson N, Schlosser J, Peng F, Lund ST. 2006. An optimized grapevine RNA isolation procedure and statistical determination of reference genes for real time RT PCR during berry development. Methodology article. BMC Plant Biol 6 (27): 1-11

Ruan J, Wong MH. 2004. Aluminum absorption by intact roots of the Al accumulating plant Camellia sinensis L. Agronomie 24 : 137-142

Robbins AH et al. 1991. Refined crystal structure of Cd, Zn metallothinein at 20A resolution. J Mol Biol 221 (4): 1269-1293

Robinson NJ, Tommey AM, Kuske C, Jackson PJ. 1993. Plant metallothioneins. Biochem J 295: 1-10

Schultze P et al. 1988. Conformation of [Cd7]-metallothionein-2 from rat liver in aqueous solution determined by nuclear magnetic resonance spectroscopy. J Mol Biol 203 (1): 251-268

Shah DM, Hightower RC, Meagher RB. 1982. Complete nucleotide sequence of a soybean actin gene. Proc Natl Acad Sci USA 79: 1022-1026

(51)

Snowden KC, Richard KD, Gardner RC. 1995. Aluminum induced genes induction by toxic metal, low cadmium, wounding and pattern of expression in root tips. Plant Physiol 107: 341-348

Subagyo H, Suharta N, Siswanto AB. 2004. Tanah-tanah pertanian Indonesia. Di dalam Sumberdaya Lahan Indonesia dan Pengelolaannya. 21-66

Suharsono, Trisnaningrum N, Sulistyaningsih LD, Widyastuti U. 2009. Isolation and cloning of cDNA of gene encoding for metallothionein type 2 from Melastoma affine. Biotropia (in press).

Taylor GJ. 1991. Current views of the aluminum stress response: the physiological basis of tolerance. Curr. Top. Plant Biochem and Physiol. 10 : 57-93

van Hoof NALM et al. 2001. Enhanced copper tolerance in Silene vulgaris (Moench) garcke populations from copper mines is associated with increased transcript levels of a 2b-type metallothionein gene. Plant Physiol 126: 1519–1526

Vitorello VA, Capaldi FR, Stefanuto VA. 2005. Recent advance in aluminum toxicity and resistance in higher plant. Braz J Plant Physiol 17 (1): 129-143

Vogeli-Lange R, Wagner GJ. 1990. Subcellular localization of cadmium and cadmium-binding peptides in tobacco leaves implication of a transport fungtion for cadmium-binding peptides. Plant Physiol 92: 1086-1093

Watanabe T, Osaki M, Yoshihara T, Tadano T 1998. Distribution and chemical speciation of aluminum in the Al accumulator plant, Melastoma malabathricum L. Plant Soil 201: 165-173

Watanabe T, Osaki M. 2001. Influence of aluminum and phosphorus on growth and xylem sap composition in Melastoma malabathricum L. Plant Soil 237 : 63-70

Watanabe T, Osaki M. 2002. Role of organic acid in aluminum accumulation and plant growth in Melastoma malabathricum. Tree Physiol 22: 785-792

Watanabe T, Jansen S, Osaki M. 2003. A physiological study of Melastoma malabathricum, an aluminum accumulating woody plant. http:www.keele.ac.uk/depths/ch/groups/aluminium/watanabe.po.pdf [3 Mei 2007]

(52)

Zheng SJ, Ma JF, Matsumoto H. 1998. High aluminum resistance in buckwheat I. Al-induced specific secretion of oxalic acid from root tips. Plant Physiol 117: 745–751

(53)

Lampiran 1. Tabel ANOVA dari pengaruh pH terhadap ekspresi MaMt2 di daun dan akar M. affine L.

ANOVA RQ pada daun

Sumber keragaman

Jumlah kuadrat

Derajat bebas

Kuadrat

tengah F Sig.

perlakuan 0,437 1 0,437 10,490 0,084

ulangan 0,083 2 0,042

Total 0,520 3

ANOVA RQ pada akar

Sumber keragaman

Jumlah kuadrat

Derajat bebas

Kuadrat

tengah F Sig.

perlakuan 2,665 1 2,665 2,631 0,246

ulangan 2,026 2 1,013

(54)

Lampiran 2. Nilai ekspresi gen MaMt2 terhadap β-actin dari M. affine L.yang mendapat cekaman pH rendah pada daun dan akar

Daun Akar

pH 6 pH 4 pH 6 pH 4

Ulangan 1 1 0,54 1 3,64

Ulangan 2 1 0,13 1 1,63

Rata-rata 1 0,335 1 2,635

(55)

Lampiran 3. Tabel uji Tukey dari pengaruh konsentrasi aluminium terhadap ekspresi MaMt2 pada daun dan akar M. affine L.

Variable uji: RQ Daun (I) perlakuan

(J) perlakuan

Beda rataan

perlakuan (I-J) Sig. Tukey HSD 0 0,8 -0,064146 0,989

3,2 0,460794 0,623

0,8 0 0,064146 0,989

3,2 0,524940 0,555

3,2 0 -0,460794 0,623

0,8 -0,524940 0,555

Variable uji: RQ Akar (I) perlakuan

(J) perlakuan

Beda rataan

perlakuan (I-J) Sig. Tukey HSD 0 0,8 -0,006035 1,000

3,2 -1,079400(*) 0,039

0,8 0 0,006035 1,000

(56)

Niken Trisnaningrum P 055050081

PROGRAM STUDI BIOTEKNOLOGI SEKOLAH PASCA SARJANA INSTITUT PERTANIAN BOGOR

(57)

Dengan ini saya menyatakan bahwa tesis yang berjudul Analisis Ekspresi Gen Penyandi Metallothionein Tipe II pada Melastoma affine L. yang Mendapat Cekaman pH Rendah dan Aluminium adalah karya saya bersama dengan komisi pembimbing dan belum diajukan dalam bentuk apapun kepada perguruan tinggi manapun. Sumber informasi yang berasal atau dikutip dari karya yang diterbitkan maupun tidak diterbitkan dari penulis lain telah disebutkan dalam teks dan dicantumkan dalam Daftar Pustaka di bagian akhir tesis ini.

Bogor, Juni 2009

(58)

NIKEN TRISNANINGRUM. Expression of the gene encoding metallothionein type II in Melastoma affine L. under low pH and aluminum stress. Supervised by SUHARSONO and MUHAMAD YUNUS

Aluminum is toxic to plants, affects plant development and reduces crop production. Indonesia has 47.500.000 ha of acid soil with very low pH and high content of aluminum. The application of tolerant crop varieties is the best approach to overcome this problem and the availability of genes controlling tolerance to this abiotic stress is essential to develop new tolerant varieties. Melastoma affine is the indigenous plant in tropical rain forest, very tolerant to acid condition and aluminum. Therefore this plant could be used for source of genes for acid and aluminum tolerance. Metallothionein is one of genes responsible for aluminum tolerance. MaMt2 gene encoding metallothionein from M. affine was isolated. The expression of this gene in M. affine under low pH and aluminum stresses was investigated using Real Time PCR in this research. MaMt2 primers were designed based on the sequence of MaMt2. β-actin was used as internal control, and the primers for β-actin were designed based on cDNA of the region between exon 1 and exon 2 of this gene. Total RNA was successfully isolated from roots and young leaves separately. Total cDNA was synthesized from total RNA by reverse transcription. This cDNA was used as template for Real Time PCR to analyse the expression of MaMt2. The expressions of MaMt2 in leaves and roots were not affected by low pH. At high concentration (3.2 mM) aluminum induced the expression of MaMt2 in the roots but not in leaves.

Gambar

Gambar 1.  Tiga fase utama pada proses PCR: (1) fase eksponensial dimana terjadi penggandaan jumlah DNA cetakan yang sebenarnya, (2) fase linier dimana proses penggandaan cetakan mulai menurun, (3) fase plateu dimana tidak terjadi lagi proses penggandaan c
Gambar 2. Proses deteksi pada Real Time PCR dengan menggunakan SYBR Green. SYBR Green akan terdeteksi bila terikat pada utas ganda DNA saat fase perpanjangan DNA (extention) (Dorak 2006)
Gambar 4.  Kurva amplifikasi pada  Real Time PCR. Threshold adalah daerah deteksi yang digunakan dalam analisis
Gambar 5. RNA total M. affine L. hasil isolasi dari akar (1) dan daun (2)
+7

Referensi

Dokumen terkait

model Pengelolaan Kawasan Wisata Eerbasis Masyankat sebagai Upaya Penguatan Ekonomi Lokal dan Pelestarian Sumber Daya Alam di Kabupaten Karanganyar yang disebut

Nilai tersebut menunjukkan bahwa ada hubungan yang sangat signifikan antara masa kerja dengan nilai ambang dengar telinga kiri tenaga kerja yang terpapar bising pada bagian

higiene dengan kejadian Pruritus vulvae saat menstruasi pada pelajar putri. SMA Negeri

Peserta lelang yang dinyatakan sebagai Pemenang atau kuasanya dapat mengambil objek lelang secara langsung ke Penjual pada saat pelaksanaan lelang, atau ke KPKNL Yogyakarta

Pada stasiun pengamatan GT 02, tanah dicirikan dengan warna coklat kemerahan, kekuatan lunak (kohesif), plastisitas sangat plastis, struktur/perlapisan homogen

yan ang g ak akan an se seiim mba bang ng de deng ngan an ar arus us k kas as m mas asuk uk y yan ang g dihasilkan dari in!estasi&#34; rus kas yang mengambil

Lebih buruk lagi penolakan terhadap pasien tidak mampu, terjadi pada rumah sakit milik pemerintah. Dasar penolakan berkisar pada profit oriented dan beban biaya

Program matrikulasi adalah kegiatan yang wajib diikuti oleh mahasiswa sebelum mengikuti perkuliahan semester I yang bertujuan untuk menyamakan