Top PDF DETEKSI BAKTERI PATOGEN YANG BERASOSIASI DENGAN Kappaphycus alvarezii (Doty) BERGEJALA PENYAKIT ICE-ICE

DETEKSI BAKTERI PATOGEN YANG BERASOSIASI DENGAN Kappaphycus alvarezii (Doty) BERGEJALA PENYAKIT ICE-ICE

DETEKSI BAKTERI PATOGEN YANG BERASOSIASI DENGAN Kappaphycus alvarezii (Doty) BERGEJALA PENYAKIT ICE-ICE

Largo et al., (1999) menjelaskan mekanisme infeksi bakteri pada K. alvarezii sehingga dapat menimbulkan gejala ice-ice. Bakteri menempel pada makro alga yang stress, selanjutnya berkembang biak pada dinding sel dengan memanfaatkan polisakarida (karagenan) sebagai medianya atau sumber karbonnya. Setelah dua sampai tiga hari kemudian bakteri masuk ke dalam jaringan sampai pada lapisan medulla dengan cara menghidrolisa enzim karaginase (Lin dalam Yulianto & Mira, 2009), akibatnya warna thallus menjadi pucat/putih, jaringan lembek serta thallus mudah terputus. Selain itu, Musa & Wei (2008) dalam Arisandi et al., (2011) menyatakan bahwa infeksi bakteri dapat berpengaruh terhadap jaringan dan sel makro alga, sebab menurut Hamoda (1995) dalam Arisandi et al., (2011) beberapa bakteri memiliki kemampuan menghasilkan enzim ekstraseluler yang dapat diekskresikan ke luar selnya, sehingga mampu mendegradasi senyawa organik yang terdapat pada lingkungan tempat tumbuhnya, seperti dinding sel thallus makro alga. Lakitan (2011) menyatakan bahwa, dinding sel tanaman mempunyai fungsi utama sebagai pelindung dan rangka sel, sehingga apabila dinding sel mengalami kerusakan atau terdegradasi maka dapat mengakibatkan terjadinya perubahan bentuk sel.
Baca lebih lanjut

7 Baca lebih lajut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S-rRNA untuk deteksi penyakit ice-ice pada budidaya rumput laut (Kappaphycus alvarezii)

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S-rRNA untuk deteksi penyakit ice-ice pada budidaya rumput laut (Kappaphycus alvarezii)

Penyakit ice-ice menyerang sentra budidaya di beberapa negara produsen rumput laut seperti di Filipina, Malaysia dan Tanzania, yang berakibat penurunan produksi rumput laut hingga 70-100%. Gejala penyakit ice-ice umumnya ditandai dengan pemutihan di pangkal thallus, tengah dan ujung thallus muda, yang dahului perubahan warna thallus menjadi putih bening atau transparan. Pengelolaan budidaya rumput laut yang sehat dan bebas penyakit ice-ice merupakan komponen penting dalam peningkatan produksi rumput laut, sehingga diperlukan teknik deteksi penyakit ice-ice secara cepat dan akurat. Selama ini identifikasi dan deteksi bakteri patogen dilakukan berdasarkan pengamatan gejala klinis, riwayat kejadian penyakit di lokasi budidaya, karakteristik morfologi, fisiologi dan biokimia bakteri. Metode tersebut memiliki peran yang cukup penting sebagai studi awal, namun kurang dapat menentukan hubungan filogenetis bakteri dan ekspresinya sangat dipengaruhi oleh faktor lingkungan. Seiring dengan perkembangan teknologi dalam bidang kesehatan ikan, berbagai teknik identifikasi dan deteksi telah dikembangkan, namun kajian tentang penyakit ice-ice pada budidaya rumput laut belum mendapat perhatian yang serius sehingga kuantitas dan kualitas produksi rumput laut fluktuatif. Metode deteksi yang banyak dikembangkan saat ini adalah metode deteksi secara molekuler melalui analisis DNA genom yang berbasis teknik PCR. Pemanfaatan gen 16S-rRNA telah digunakan sebagai parameter sistematik sebagai penanda untuk identifikasi spesies bakteri. Oleh karena itu, beberapa tahap penelitian telah dilakukan, mengenai isolasi, identifikasi bakteri patogen yang menyebabkan penyakit ice-ice, mekanisme patogenisitas bakteri patogen penyebab penyakit ice-ice dan pemanfaatan sekuen gen 16S-rRNA untuk mendisain primer spesifik PCR dalam deteksi cepat dan akurat.
Baca lebih lanjut

279 Baca lebih lajut

Jenis, Kelimpahan dan Patogenisitas Bakteri pada Thallus Rumput Laut Kappaphycus alvarezii Yang Terserang Ice- Ice Di Perairan Pulau Pari, Kepulauan Seribu, Jakarta

Jenis, Kelimpahan dan Patogenisitas Bakteri pada Thallus Rumput Laut Kappaphycus alvarezii Yang Terserang Ice- Ice Di Perairan Pulau Pari, Kepulauan Seribu, Jakarta

Pada umumnya, studi penyakit ice-ice hanya mengarah pada faktor lingkungan (Trono, 1974 dalam DKP, 2004 a ). Namun berdasarkan penelitian yang dilakukan oleh Largo et al. (1995) bakteri berperan dalam pengembangan penyakit ice-ice pada budidaya rumput laut K. alvarezii. Penelitian ini diharapkan dapat menambah informasi mengenai jenis bakteri patogen pada rumput laut K. alvarezii yang terserang ice-ice sehingga bermanfaat untuk mengendalikan infeksi bakteri patogen yang akan merugikan pembudidaya rumput laut.
Baca lebih lanjut

10 Baca lebih lajut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Ice-ice disease on seaweed aquaculture Kappaphycus alvarezii has a significant effect on decreasing production of seaweed. Decreasing rate of biomass and caragenan content have positive correlation with ice-ice infected thallus weight based on cohabitation test between healthy and infected thallus. Destruction of seaweed tissues occurred in accordance with incubation time of ice-ice disease. Several bacteria had been successfully isolated from infected seaweed thallus and identified using API 20 E and API NE 20 identification test. Isolate of Vibrio alginoliticus PNGK 1 had the higest pathogenicity compared to other species such as Pseudomonas cepacia, Flavobacterium meningosepticum, Pseudomonas diminuta and Plesiomonas shigelloides. V. alginoliticus was significantly display ice-ice symptoms on day 1 after challenge test with dose of 10 6 CFU/mL. Molecular characterization on V. alginoliticus showed that PNGK 1 isolate similar with V. alginoliticus strain CIFRI V-TSB1. DNA sequencing data of V. alginoliticus PNGK 1 was used as the base of specific primer design for rapid detection of bacteria on seaweed thallus. Results of specific primer design through Primer 3 Program for V. alginoliticus PNGK 1 were primer aSEFM-F ((5- CAGCCACACTGGAACTGAGA -3) and aSEFM-R (5- TTAGCCGGTGCTTCTTCTGT -3). Amplication of V. alginoliticus PNGK 1 DNA resulted in one amplicon 201 bp. Development of rapid detection method on the present of pathogenic bacteria (V. alginoliticus PNGK 1) on seaweed thallus was conducted with several steps optimation test on PCR temperature resulted that at annealing 60 o C the DNA of V. alginoliticus PNGK 1 could be detected. Using specifity test and sensitivity with that specific primer it was found a band of 201 bp. This detection method for pathogenic bacteria could be applied for early detectionof asymptoutic ice-ice sea weed.
Baca lebih lanjut

152 Baca lebih lajut

Studi Peran Interaksi Bakteri Patogen Dan Lingkungan Terhadap Penyakit Ice-Ice Pada Rumput Laut Kappaphycus Alvarezii.

Studi Peran Interaksi Bakteri Patogen Dan Lingkungan Terhadap Penyakit Ice-Ice Pada Rumput Laut Kappaphycus Alvarezii.

Penyebab timbulnya suatu penyakit tidak hanya akibat perubahan lingkungan, melainkan juga adanya peran bakteri yang saling berinteraksi dengan lingkungan. Interaksi faktor lingkungan (suhu dan salinitas) dan bakteri diduga dapat memperparah penyakit pada inang termasuk rumput laut. Tujuan penelitian ini adalah untuk mengevaluasi efek interaksi suhu dan salinitas dengan bakteri patogen terhadap timbulnya penyakit ice-ice pada rumput laut. K. alvarezii ditimbang masing-masing sebanyak 50-51 g, dikultur di dalam akuarium (ukuran 30 cm x 30 cm x 30 cm) dengan suhu air 25 C dan 28 C serta penginfeksian bakteri S. maltophilia dengan konsentrasi 10 0 -10 6 cfu/ml ke media pemeliharaan (salinitas 30 g/L). Perlakuan salinitas 28 g/L, 30 g/L, dan 35 g/L dengan penginfeksian bakteri yang sama (konsentrasi bakteri 10 6 cfu/ml) dan suhu pemeliharaan 28 o C. Hasil penelitian menunjukkan bahwa rumput laut yang diinfeksi bakteri S. maltophilia dan diinkubasi pada suhu 28 C menunjukkan penurunan bobot lebih besar, dan jumlah cabang talus yang mengalami bleaching lebih banyak dibandingkan dengan perlakuan suhu 25 C. Pada kedua suhu menunjukkan signifikan terhadap jumlah bleaching pada semua bagian talus, sedangkan perlakuan konsentrasi yang berbeda hanya menunjukkan signifikan terhadap jumlah bleaching di talus sekunder, dan tidak signifikan terhadap jumlah bleaching di talus primer dan tersier. Selanjutnya, untuk interaksi konsentrasi bakteri dan suhu tidak menunjukkan signifikan baik terhadap penurunan bobot basah dan jumlah bleaching pada setiap bagian talus rumput laut K. alvarezii. Lama waktu transmisi penyakit (waktu selama perlakuan) berpengaruh terhadap struktur morfologi K. alvarezii yang menunjukkan kondisi parah di hari keempat. Salinitas 28, 30, dan 35 g/L menunjukkan penurunan bobot yang sama pada talus. Jumlah bleaching yang tinggi pada talus sekunder dan tersier ditunjukkan pada salinitas 28 dan 35 g/L. Kondisi jaringan talus pada awal dan akhir pengamatan dapat dibedakan dengan jumlah protoplasma sel menurun dan jarak antar sel yang sangat renggang. Hasil penelitian menyimpulkan bahwa suhu dan salinitas berperan terhadap munculnya penyakit ice-ice. Hasil riset ini belum mengungkapkan secara detail interaksi antar faktor biotik dan abiotik dalam menyebabkan penyakit ice-ice sehingga kedepannya perlu dilakukan analisis lebih lanjut untuk menginvestigasi efek interaksi kedua faktor tersebut.
Baca lebih lanjut

83 Baca lebih lajut

KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP)

KARAKTERISTIK GENETIK Kappaphycus alvarezii SEHAT DAN TERINFEKSI PENYAKIT ICE-ICE DENGAN METODE Amplified Fragment Length Polymorphism (AFLP)

Kappaphycus alvarezii merupakan alga merah penghasil karaginan yang memiliki nilai ekonomi tinggi. Penggunaannya sebagai bahan dasar untuk industri makanan seperti agar-agar, ice cream, stabilizer, bahan kosmetik, dan farmasi (Guerrero, 2001). Namun demikian alga merah K. alvarezii tersebut mudah terserang penyakit, salah satunya adalah penyakit ice-ice. Penyakit ini menyerang alga saat mengalami cekaman lingkungan, seperti perubahan suhu yang drastis, salinitas rendah, dan intensitas cahaya (Largo et al., 1999). Infeksi ice-ice ditandai oleh warna batang (thalli) alga yang memutih atau me- mudar, berlendir dan diselimuti oleh kotoran seperti tepung putih, kulit luar atau epidermis terkelupas sehingga terlihat jaringan dalam/ medulla thalli (Yulianto, 2001). Dilaporkan bahwa Vibrio sp. adalah bakteri yang memiliki aktivitas patogen sehingga menyebabkan bagian permukaan dari cabang Kappaphycus/ Eucheuma memutih dan mengeras seperti es (Largo et al., 1995).
Baca lebih lanjut

10 Baca lebih lajut

BAB II TINJAUAN PUSTAKA 2.1 Minyak Atsiri - POTENSI AKTIVITAS ANTIBAKTERI CAMPURAN MINYAK ATSIRI CENGKEH ( Syzygium aromaticum) DAN KITOSAN UNTUK PENGAWETAN DAGING AYAM ASEPTIS - repository perpustakaan

BAB II TINJAUAN PUSTAKA 2.1 Minyak Atsiri - POTENSI AKTIVITAS ANTIBAKTERI CAMPURAN MINYAK ATSIRI CENGKEH ( Syzygium aromaticum) DAN KITOSAN UNTUK PENGAWETAN DAGING AYAM ASEPTIS - repository perpustakaan

Pasteurisasi adalah pengolahan panas yang dirancang untuk menonaktifkan sebagai mikroorganisme vegetatif yang terdapat dalam bahan pangan. Sedangkan menurut Kumalaningsih (1995), pasteurisasi adalah perlakuan panas pada suhu sterilisasi dan biasanya dilakukan pada suhu di bawah titik didih air dan disertai dengan cara pengawetan. Prinsip pasteurisasi adalah pemanasan produk dalam waktu yang singkat sampai mencapai kombinasi suhu dan waktu tertentu yang cukup untuk membunuh semua mikroorganisme patogen, tetapi hanya menyebabkan kerusakan sekecil mungkin terhadap produk akibat panas (Woodroof, 1979). Biasanya pasteurisasi dipadukan dengan teknik penyimpanan pada suhu rendah yang bertujuan untuk mencegah pertumbuhan mikroorganisme termofilik yang suhu pertumbuhan minimumnya cukup tinggi (Rini 2008).
Baca lebih lanjut

15 Baca lebih lajut

Etiologi penyakit moler pada Bawang Merah.

Etiologi penyakit moler pada Bawang Merah.

Etiologi penyakit moler merupakan upaya untuk mengetahui penyebab penyakit moler pada bawang merah. Upaya ini didasarkan pada langkah-langkah dalam Postulat Koch. Namun demikian sebelum pelaksanaan Postulat Koch dilakukan pengamatan pendahuluan tentang penyakit moler di lapangan di daerah sentra produksi. Pengamatan pendahuluan berupa survei lahan, pengambilan sampel bahan tanaman sakit, dan wawancara dengan petani yang dilakukan di Kecamatan Sukomoro, Kabupaten Nganjuk, Jawa Timur. Pelaksanaan selanjutnya dilakukan di Laboratorium Nematologi dan Fitopatologi, Jurusan Hama Penyakit Tumbuhan, Fakultas Pertanian Universitas Gadjah Mada pada bulan Desember 2000 sampai dengan September 2001.
Baca lebih lanjut

57 Baca lebih lajut

Analisis Perbandingan Perceived Quality Ice Cream Stormy Plate Dengan Ice Cream Lainnya.

Analisis Perbandingan Perceived Quality Ice Cream Stormy Plate Dengan Ice Cream Lainnya.

Stormy Plate adalah salah satu perusahaan yang bergerak di bidang franchise ice cream. Stormy Plate menawarkan produk ice cream dengan konsep “ALL ABOUT ICE CREAM”. Pada pertengahan tahun 2004, Stormy Plate membuka lokasi pertamanya di Bandung dengan pendirinya Vivo Wibisono. Ide mendirikan Stormy Plate berasal dari modifikasi terbaik dari banyak jenis franchise yang ada. Stormy Plate bergerak dalam bidang industri ice cream home made. Alamat kantor pusat Stormy Plate di Jl. Pasir Kaliki Dalam no.109/65 Bandung. Perusahaan Stormy Plate didukung penuh oleh ahli-ahli yang telah teruji kualitasnya. Melakukan inovasi-inovasi secara terus-menerus untuk menemukan resep-resep rahasia yang bercita rasa dan berkelas. Stormy Plate menjadi salah satu bidang usaha yang cukup berpotensi dan menjanjikan. Misi dari Stormy Plate adalah menyediakan makanan dengan cita rasa dan kelas cafe dengan harga yang sangat terjangkau anak kost. Motto Stormy Plate adalah “LESS THAN GOCENG, MAN” dan “GOCENG IS MY LIFE” . Jargon Stormy Plate adalah “THE MOST WANTED AND CHEAPEST ICE CREAM IN TOWN”. Visi Stormy Plate adalah dengan melihat besarnya angka pengangguran dan masyarakat miskin dewasa ini, maka Stormy Plate hadir guna membuka lapangan kerja baru bagi orang-orang yang kurang memiliki kesempatan.
Baca lebih lanjut

55 Baca lebih lajut

ICE BREAKING REFLEKTIF DAN

ICE BREAKING REFLEKTIF DAN

You will experience a painful sharpening from time to time, by going through various problems, but you'll need it to become a stronger person.. You will experience a painful..[r]

14 Baca lebih lajut

Deteksi bakteri patogen dan fermentatif dari pangan menggunakan real-time polymerase chain reaction

Deteksi bakteri patogen dan fermentatif dari pangan menggunakan real-time polymerase chain reaction

Penelitian ini bertujuan mengembangkan metode deteksi bakteri patogen Cronobacter sakazakii, Staphylococcus aureus dan bakteri fermentatif Lactobacillus plantarum menggunakan real-time PCR (rt-PCR). Amplifikasi sekuens parsial gen 16S rRNA dengan menggunakan PCR konvensional dan primer spesifik 16 SUNI-L/Saka-2b menghasilkan amplikon sebesar 1000 bp. Protokol rt-PCR dapat digunakan untuk mendeteksi tiga isolat Cronobacter sakazakii mulai siklus ke-4 sampai ke-30. Protokol ini menunjukkan spesifitas yang baik dengan kemampuan membedakan antara C. sakazakii dan C. muytjensii dengan suhu puncak pelelehan (Tm) sebesar 85,0 85,5 o C. Analisis L.plantarum menggunakan rt-PCR dengan primer 1541R/9F dan L.plantarum sa28k sebagai kultur standar, berhasil mengamplifikasi isolat L.plantarum sa28k dan beberapa isolat Lactobacillus sp. dengan kondisi sesuai PCR konvensional. Protokol yang digunakan dapat mendeteksi spesies L.plantarum sa28k dan mengidentifikasi beberapa isolat Lactobacillus sp. ditandai dengan suhu pelelehan yang hampir sama yaitu 85,5 o C. Isolasi DNA S. aureus juga berhasil dilakukan dengan metode yang dikembangkan yang ditunjukkan dengan pita DNA pada hasil elektroforesis isolat DNA. Amplifikasi dengan primer 63F dan 1387R menghasilkan produk PCR berukuran 1350 bp, sedangkan amplifikasi dengan primer 16sF dan 16sR3 menghasilkan produk PCR berukuran 240 bp. Suhu pelelehan (Tm) gen penyandi 16S rRNA S.aureus yang diamplifikasi baik dengan primer 63F/1387R maupun 16sF/16sR3 menggunakan rtPCR berkisar antara 83–84,5 °C. Protokol rt-PCR yang dikembangkan mempunyai spesifisitas yang baik dan dapat digunakan untuk mendeteksi bakteri uji.
Baca lebih lanjut

2 Baca lebih lajut

Usaha dan Bisnis Ekonomi Manajemen

Usaha dan Bisnis Ekonomi Manajemen

Disini saya membahas sedikit tentang salah satu food truck yaitu ice cream truck sebagai usaha yang menguntungkan secara ekonomi dan manajemen. Seperti kita ketahui bahwa ice cream sekarang bukan hanya diminati oleh anak kecil tetapi juga orang dewasa, varian rasa ice cream pun bermacam macam sehingga dapat di kreasikan seunik mungkin.

7 Baca lebih lajut

ICE BREAKING REFLEKTIF AKU

ICE BREAKING REFLEKTIF AKU

• Anak-anak yatim, Parmin, mbok Darmi, Anak-anak yatim, Parmin, mbok Darmi, pengemis tua, murid-murid pengajian, pengemis tua, murid-murid pengajian, jamaah masjid dan banyak lagi j[r]

13 Baca lebih lajut

DAYA HAMBAT EKSTRAK RUMPUT LAUT (Kappaphycus alvarezii) TERHADAP BAKTERI PLAK SUPRAGINGIVA (EKSPERIMENTAL LABORATORIS)

DAYA HAMBAT EKSTRAK RUMPUT LAUT (Kappaphycus alvarezii) TERHADAP BAKTERI PLAK SUPRAGINGIVA (EKSPERIMENTAL LABORATORIS)

Euchema berubah nama menjadi Kapphaphycus alvarezii karena karaginan yang dihasilkan termasuk fraksi kappa karagenan (Doty, 2001). Oleh karena itu, secara taksonomi disebut Kappaphycus alvarezii (Doty, 2001). Rumput laut Kapphaphycus alvarezii memiliki ciri-ciri fisik seperti thallus silindris, permukaan licin, cartilogineus (lunak seperti tulang rawan), warna hijau, hijau kuning, abu-abu dan merah. Penampakan thallus bervariasi mulai dari bentuk sederhana sampai kompleks. Duri-duri pada thallus runcing memanjang agak jarang-jarang dan tidak bersusun melingkari thallus, permukaan licin, cartilogeneus. Percabangan ke berbagai arah dengan batang-batang utama keluar saling berdekatan ke daerah asal atau pangkal (Doty, 2001).
Baca lebih lanjut

60 Baca lebih lajut

ANALISIS LAJU PERTUMBUHAN RUMPUT LAUT KAPPAPHYCUS ALVAREZII YANG DITANAM PADA BERBAGAI KEDALAMAN

ANALISIS LAJU PERTUMBUHAN RUMPUT LAUT KAPPAPHYCUS ALVAREZII YANG DITANAM PADA BERBAGAI KEDALAMAN

yang ideal bagi pertumbuhan rumput laut K alvarezii. Sedang kadar nitrat yang didapatkan selama penelitian berkisar 0,01-2,6 ppm tergolong rendah namun masih dalam batas kelayakan hidup rumput laut, sesuai yang dikemukakan Andarias (1997) bahwa kadar nitrat untuk rumput laut berkisar 0,9-3,5 ppm. Kadar posfat yang didapatkan pada saat penelitian juga tergolong rendah (0,16-0.62 ppm) namun masih mampu menunjang kelangsungan hidup K. alvarezii, sesuai pendapat Kapraun (1998), bahwa kadar posfat yang baik untuk pertumbuhan rumput laut adalah 0,1-3,5 ppm. Parameter kualitas air selama penelitian selengkapnya dapat dilihat pada Lampiran 12.
Baca lebih lanjut

8 Baca lebih lajut

Efikasi Dry Ice terhadap Sitophilus oryzae dan Tribolium castaneum pada Beras Kemasan Plastik di Dataran Tinggi Efficacy of Dry Ice to Sitophilus oryzae and Tribolium castaneum in The Rice of Plastic Packaging at High Land

Efikasi Dry Ice terhadap Sitophilus oryzae dan Tribolium castaneum pada Beras Kemasan Plastik di Dataran Tinggi Efficacy of Dry Ice to Sitophilus oryzae and Tribolium castaneum in The Rice of Plastic Packaging at High Land

Sitophilus oryzae and Tribolium castaneum are pest that can always attack rice in long periode storage. Rice in the plastic packaging that spread in market has not did fumigation, so the pest can attack faster than rice in sack packaging. This research was aimed to understand the effectiveness of dry ice to attack S. oryzae and T. castaneum with effect of dry ice to rice in plastic packaging at high land. This research used completely randomized design (CRD) with two factors. The first factor was dose of dry ice and second factor was wrapper of dry ice. The data was analyzed in variance analysis then continue with Duncan Mean Range Test (DMRT). The result showed that dose of dry ice 10 g/rice 5 kg can effect for 90,83 % mortality of S. oryzae and T. castaneum but it have not made effect for imago and larvae population. Also, dry ice was not make effect for rice weight and rice quality (color of rice, scent of rice and taste of rice).
Baca lebih lanjut

5 Baca lebih lajut

Index of /papers/Food_Beverage The Ice Cream Maker

Index of /papers/Food_Beverage The Ice Cream Maker

Keywords: ice cream maker, ice cream makers, ice cream Article Body: There is no doubt that ice cream is one of the nicest things you can have, in the summer it is possible to eat the[r]

1 Baca lebih lajut

ICE CREAM PARE ENAK DI LIDAH SERTA BERNILAI GIZI TINGGI.

ICE CREAM PARE ENAK DI LIDAH SERTA BERNILAI GIZI TINGGI.

Pare atau paria merupakan salah satu jenis sayuran yang tidak memiliki banyak penggemar. Hanya sedikit orang yang menyukai buah pare. Karena rasanya yang memang pahit. Dari rasa yang pahit itu ,maka tergugahlah untuk mengolah buah pare menjadi suatu makanan yang dapat diterima masyarakat dan juga digemari oleh semua kalangan yaitu dengan mengubahnya menjadi Ice Cream Pare. Agar dalam pikiran masyarakat pare bukanlah sesuatu yang mengerikan karena rasanya yang tidak enak. Sebagai mahasiswa sangat tidak mungkin jika harus terjun langsung sebagai pelaku usaha tersebut, tetapi hanya akan menampung pare yang sudah menjadi Ice Cream, dengan pengolahan Ice Creamnya atas pengarahan dari kami, sehingga kami hanya akan melakukan pengepakan dan pemberian label serta nama produk pada kemasan tersebut.
Baca lebih lanjut

12 Baca lebih lajut

Choosing The Best Ice Cream Maker

Choosing The Best Ice Cream Maker

Keywords: ice-cream, ice cream Article Body: You can make delicious ice cream at home, as good as any premium store brand, if you choose a good ice cream maker and follow a few tips..[r]

1 Baca lebih lajut

EFEKTIVITAS PENERAPAN METODE ICE BREAKIN (1)

EFEKTIVITAS PENERAPAN METODE ICE BREAKIN (1)

Setiawan dalam buku kecilnya Ice Breakers (2009) menyebut ice breaking sebagai “energizer” atau “refocus”, sebagai teknik yang digunakan dalam suatu forum untuk memecahkan kebekuan dan kejenuhan yang terjadi dalam forum tersebut. Alasan penggunaannya, audien/siswa perlu dilibatkan dalam forum sehingga muncul sense of belonging dan kebersamaan, adanya kejenuhan bila suasana belajar dalam waktu yang relatif lama, keterbatasan konsentrasi tiap orang dalam menerima informasi, dan beragamnya kondisi (modalitas belajar) para siswa sebelum proses pembelajaran.
Baca lebih lanjut

6 Baca lebih lajut

Show all 10000 documents...