Relative DvFNS gene expression levels
Figure 3. Comparison of relative DvFNS gene expression between eight relatively low sensitive `Nessho` strains (CRL1, CRL2, CRL3, CRL4, CRL5, CRL6, CRL7 and CRL8) and
a relatively high sensitive strain CRH1.
Dahlia variabilis cultivar `Nessho` frequently exhibits flower fading from autumn to spring.
Some plant lines are sensitive to low winter/spring temperatures while other lines produce solid red flower color even under low temperature conditions (Okada et al., 2020). The color change relates to the expression DvFNS (Okada et al., 2018). In this experiment four plants of each strain (CRL1, CRL2, CRL3CRL4, CRL5, CRL6, CRL7, CRL8 and a CRH) were used for analysis of the level of expression of DvFNS gene expression after acclimation and after inductive conditions treatments. The levels of relative DvFNS gene expression after acclimation conditions were relatively low, between 0.01 to 0.03 for all plant strains. This is an indication that if the conditions are not favorable then DvFNS expression is low despite if the plant is highly sensitive or low sensitive to flower fading. After inductive treatment conditions, all the
0.0000 0.0200 0.0400 0.0600 0.0800 0.1000 0.1200
CRL1 CRL2 CRL3 CRL4 CRL5 CRL6 CRL7 CRL8 CRH1
Relative DvFNSgene expression levels
`Nessho` strains
Relative DvFNS expression After acclimation treatment Relative DvFNS expression After inductive treatment
Eight strains of CRL plants and one strain of CRH plants (approximately 20cm height with more than three internodes as in Fig.2a) were pinched on the second internode to allow for new lateral shoots development (Fig. 2b). After pinching, the plants were put in the growth chamber set at acclimation conditions of 25℃ /20℃ day and night temperatures and 14 hours of day length to homogenize the gene express levels in all plants. Initial sampling was done 14 days after the onset of acclimation conditions treatment. The conditions of the growth chamber were then set at inductive conditions of 20℃/9℃ day and night temperatures and 10 hours of day length, mimicking winter conditions to induce DvFNS gene expression. Second sampling was done 14 days after the onset of inductive conditions treatment. All samples were used to obtain RNAs.
Figure 2. Plant materials used in the experiment; (a)`Nessho` plant with more than three internodes, (b) plant pinched above the 2nd internode, (c) young un-expanded leaf used for
total RNA extraction.
2.4. Total RNA extraction and real-time qPCR
Young un-expanded leaves (Fig. 2c) of newly emerging shoots were collected, frozen in liquid nitrogen and stored at -80℃ until when in use. Total RNA was extracted from approximately 100mg leaf samples using a modified CTAB- lithium chloride protocol. The integrity of the extracted RNA was checked using 1% agarose gel electrophoresis and the concentration determined using a Biodrop µLite+ spectrophotometer. The RNAs were reverse transcribed to obtain cDNAs which were further used as templates for real-time qPCR. Relative expression level of DvFNS were determined by real-time qPCR performed using Thermal Cycler Dice Real Time System (TaKaRa Bio Inc., Kyoto, Japan). The qPCR reaction components are as shown on table 1. DvFNS forward and reverse primers were used. Each reaction was performed using 1μL aliquot of 10μL cDNA solution derived from 0.5μg RNA. The qPCR thermal profile was as follows; initial polymerase activation at 95℃ for 1 minute; then 40 cycles at 95℃ for 15 seconds, 60℃ for 1 minute followed by a dissociation step. Single-target product amplification was checked using dissociation curves. D. variabilis actin gene (DvActin) was used as an internal standard. To standardize the data, the ratio between the relative expression level of the target gene DvFNS and the control gene (DvActin) was calculated for each sample. DvFNS and DvActin primers used were as follows DvFNS forward (5`-
GTGTGTTTCCCTTTGCTTCGTAAAA -3`, and reverse (5`-
GCGAAGGGAAACACACTAGATTCGT -3`) and DvActin forward (5`-
TGCTTATGTTGGTGATGAAG -3` and reverse (5`- CCCTGTTAGCCTTAGGATTT -3`).
The experiments were replicated three times.
Table 1. Realtime qPCR reaction components
a b c
nine strains used in this experiment showed change in expression levels of DvFNS gene (Fig.
3). All except CRL3 and CRL4 showed an elevated expression level after inductive treatment.
The elevation in expression level is an indication that the inductive conditions had an influence on the expression of DvFNS. In this experiment, the relatively low sensitive strains; CRL1, CRL2, CRL5, CRL6, CRL7 and CRL8 showed a change of slightly above one-fold and CRL3 and CRL4 slightly less than one-fold in relative DvFNS gene expression. However, the relatively high sensitive strain CRH1 had a 2.5-fold change in DvFNS gene expression.
All the gene expression levels for CRL strains before and after inductive treatment were not significant different. The two-fold increase in DvFNS expression levels in the CRH1 strain after inductive treatment (Fig. 3) means that the inductive treatment was effective in inducing gene expression in relatively high sensitive plants. In dahlia `Kokucho` and its purple mutant experiment reported by Deguchi et al., (2013), suppression of DvFNS resulted to more synthesis and accumulation of anthocyanins hence darker colored flowers. Higher DvFNS expression leads to subsequent higher accumulation of flavones hence production of purple flowers. In this experiment, inductive conditions mimic winter conditions and they induce DvFNS gene expression in young leaves of CRH strain plants. High expression on DvFNS results in competition for substrates for downstream anthocyanin biosynthesis related genes hence lower anthocyanin synthesis and accumulation in dahlia `Nessho` ray florets (Okada et al., 2018).
This corresponds with results in a study of Thill et al., (2012) comparing flavones in red and rare black dahlia cultivars. They reported that relative expression of flavonoid pathway structural genes was largely comparable or sometimes lower in black cultivars than of in the red cultivars. This meant that the increase in anthocyanin accumulation in the majority of black cultivars was not as a result of induced anthocyanin pathway but a promoted flux of flavanones intermediates into anthocyanin due to reduced flavone formation. This change in pigment accumulation affects the color intensity in various cultivars. In the present study, we demonstrated that this relationship between flower color and DvFNS expression may be used for selection of the plantlets with stable flower color.
Environmental conditions such as temperature and light influence the accumulation of flavonoids especially anthocyanin. This is mainly because of the effects of the environmental factors on anthocyanin biosynthetic related genes (Guo et al., 2008 and Li et al., 2019). The expression of the genes for anthocyanin biosynthesis is affected by ambient temperature and the effects vary from species to species. In many flower species, pigmentation is suppressed by high temperature, and this is enhanced by low light intensity (Ichimura et al., 2021). In petunia, the gene expression for CHS is increased by exposure to low temperatures (Shvarts et al., 1997).
In roses, exposure to high temperature reduces the expression of DFR and CHS whereas in lilies it reduces the expression of LhDFR, LhF3H, and LhCHS genes. The effect of temperature on the expression of the various genes in the anthocyanin biosynthetic pathway affects pigment accumulation and consequently the flower color. In this experiment, the inductive conditions increased the relative expression of DvFNS genes in the leaves of relatively high sensitive strain of `Nessho`. This indicates that the effect of environmental factors on DvFNS expression can be applied for the selection of plants with favorable agronomic characteristics, and stable flower color expression in this study.
The inductive effects of these conditions on DvFNS gene expression in young unexpanded leaves of `Nessho` may correlate with the color fading of the ray florets. This is shown by high relative DvFNS expression levels in young unexpanded leaves of plants that were classified as relatively high sensitive based on their flower color in winter.
4. Conclusions
The difference in DvFNS expression levels between the relatively high sensitive and relatively low sensitive plants after inductive condition treatment is an indication that the level of expression of this gene can be used as a selection tool for non-fading strains. This selection
method takes approximately one month. The selection of stable red colored strains in natural greenhouse conditions would take over a year. This is because selection must be done when the natural conditions for DvFNS gene induction are favorable in winter and spring. Using the current method selection will be faster and more efficient.
Conflict of interest declaration: The authors declare that there is no conflict of interest regarding what is reported in this manuscript.
References
Deguchi, A., Ohno, S., Hosokawa, M., Tatsuzawa, F., & Doi, M. (2013). Endogenous post- transcriptional gene silencing of flavone synthase resulting in high accumulation of anthocyanins in black dahlia cultivars. Planta 237(5), 1325-1335.
Gatt, M., Ding, H., Hammett, K., & Murray, B. (1998). Polyploidy and evolution in wild and cultivated Dahlia species. Annals of Botany 81, 647-656.
Guo, J., Han, W., & Wang, M. (2008). Ultraviolet and environmental stresses involved in the induction and regulation of anthocyanin biosynthesis: A review. African Journal of Biotechnology 7(25), 4966-4972.
Halbwirth, H., Muster, G., & Stich, K. (2008). Unraveling the biochemical base of dahlia flower coloration. Natural Product Communications 3(8), 1259-1266.
Ichimura, K., Niki, T., Matoh, M., & Nakayama, M. (2021). High temperature under low light conditions suppresses anthocyanin biosynthesis in snapdragon petals associated with decreased sugar levels. Scientia Horticulturae 290, 110510.
Li, B., Fan, R., Guo, S., Wang, P., Zhu, X., Fan, Y., Chen, Y., He, K., Kumar, A., Shi, J., Wang, Y., Li, L., Hu, Z., & Song, C. P. (2019). The Arabidopsis MYB transcription factor, MYB111 modulates salt responses by regulating flavonoid biosynthesis. Environmental and Experimental Botany 166, 103807.
McClaren, M. (2009). Dahlia: history and species. In: McClaren, B. (Ed.), Encyclopedia of dahlias (161-166). Portland, USA: Timber Press,
Okada, H., Karawasa, Y. & Kitamura, Y. (2018). The relationship between color fading of ray florets and expression levels of DvFNS in leaves of Dahlia variabilis cv. `Nessho`.
Horticulture Research 17(1), 425.
Okada, H., Tauchi, Y., Karasawa, Y., Kikumura, T., & Kitamura, Y. (2020). a dahlia cultivar
‘nessho’ comprises plants with various low temperature sensitivity for color fading occurrence in ray florets. Shokubutsu Kankyo Kogaku 32(1), 29-36.
Shvarts, M., Borochov, A., &Weiss, D. (1997). Low temperature enhances petunia flower pigmentation and induces chalcone synthase gene expression. Physiologia Plantarum 99(1), 67-72.
Tanaka, Y., Sasaki, N., & Ohmiya, A. (2008). Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. The Plant Journal 54(4), 733-749.
Thill, J., Miosic, S., Ahmed, R., Schlangen, K., Muster, G., Stich, K., & Halbwirth, H. (2012).
'Le Rouge et le Noir': A decline in flavone formation correlates with the rare color of black dahlia (Dahlia variabilis hort.) flowers. BMC Plant Biology 12(1), 1-14.
Yamaguchi, M. A., Oshida, N., Nakayama, M., Koshioka, M., Yamaguchi, Y., & Ino, I. (1999).
Anthocyanidin 3-glucoside malonyltransferase from Dahlia variabilis.
Phytochemistry 52(1), 15-18.
TRANSMISSION AND CLINICAL-PATHOLOGICAL CHARACTERISTICS OF AFRICAN SWINE FEVER VIRUS IN VIETNAM (2019-2020): MINI-REVIEW FROM
RESEARCH TO THE FIELD Lai C. Danh and Do T. Duy*
Faculty of Animal Science and Veterinary Medicine, Nong Lam University, Ho Chi Minh City, Vietnam
*Email: [email protected] Abstract
African swine fever (ASF) has caused heavy losses to the Vietnamese pig industry since 2019, which threatens the sustainability of pig production and the environment. The objective of this study was to review clinical, pathological and epidemiological characteristics which were recorded and reported from several studies in Vietnam, thereby helping to provide the value information and comprehensive view of ASF. ASFV has spread quickly in national, local and farm scales and infected all age groups of pigs, but the morbidity rate of sows and boars tend to be higher than that of piglets. Several risk factors increase ASF infection at farms such as proximity to residential areas, markets, slaughterhouses, major roads, use of leftovers or untreated drinking water, introducing pigs of unknown origin, improper handling of sick pigs and other animal vectors. The common typical clinical signs of ASFV-infected pigs were characterized as fever, loss of appetite and redness of the body. Severe hemorrhage and infarction in multiple organs have been reported in many ASF cases in Vietnam, in which dark- red hemorrhagic splenomegaly were the most common lesions. In short, the characteristic clinical symptoms and lesions of ASF were reviewed. The spread of ASFV in Vietnam was very quickly on a national, local and farm scale in the first year of ASFV introduction, which originates from very typical epidemiological characteristics of Vietnam. Therefore, changing awareness towards safe and sustainable pig production is an effective measure to prevent ASFV and other dangerous pathogens.
Keywords: African swine fever, pathology, transmission, pigs, Vietnam 1. Introduction
African swine fever (ASF) is an acute infectious disease, which is caused by African swine fever virus (ASFV), genus Asfivirus, family Asfarividae (Dixon et al., 2013). ASFV has 24 different genotypes, of which genotypes I and II are found common in many territories around the world. Swine species (Suidae) such as domestic pigs and wild boar are susceptible to ASFV.
Several species of Ornithodoros ticks are natural reservoirs of ASFV and can transmit the virus to pigs by sucking blood (Costard et al., 2009). ASFV is unlikely to cause disease in humans or other animals. ASFV is a possible stable virus that can survive under extreme conditions (Das et al., 2021). The virus is resistant to many physical and chemical agents in the environment (Das et al., 2021) and to many disinfectants, especially when covered with organic matter (Bellini et al., 2016).
The disease was first described in Kenya in 1921 (Montgomery, 1921) and has subsequently been recognized in many regions of the world. In 2018, the first outbreak of ASF was reported in China with lesions characterized by severe necrotic splenomegaly (Ge et al., 2018). From 2018 up to now, the ASF outbreaks occurred mainly in Asia Pacific countries (FAO, 2022). In early 2019, ASF was officially confirmed to enter the Vietnamese pig herds in two provinces of Thai Binh and Hung Yen (Le et al., 2019). In just 7 months, ASF has spread to all provinces and cities in the country, and caused great damage to the livestock industry, strongly affecting Vietnam's pork production (Woonwong et al., 2020). According to data released by the
Department of Livestock Production in 2022, the total number of pig heads in Vietnam has decreased from 28.1 million (2018) to 19.6 million in 2019.
This study aimed to provide an overall picture of the clinical symptoms, lesions and risk factors of ASF in the complex epidemiological context of Vietnam. In the review methodology, we searched the following databases, such as Google Scholar and Pubmed using the search terms
‘African swine fever AND Vietnam OR pathology OR transmission’. Besides, we used the references from Vietnamese journals including Journal of veterinary science and technology, Vietnam Journal of Agricultural Sciences, and Can Tho University Journal of Science. We also updated the new disease situation from website of The Food and Agriculture Organization (FAO) (https://www.fao.org/).