Top PDF antarctic sea ice highlights06

antarctic sea ice highlights06

antarctic sea ice highlights06

In situ ocean observations are also critical to under- stand the important role of the southern Ocean in many processes that affect sea ice. Argo loats located in the southern Ocean record data on the temperature and salinity of the water, but coverage is geographically sparse—much of the southern Ocean sea ice zone has only 25 percent of target Argo loat coverage. Precipita- tion measurements for southern sea ice are also available, but these measurements are challenging because most precipitation is either blown off into the ocean or accumu- lates in ridges.
Baca lebih lanjut

4 Baca lebih lajut

isprs archives XLI B8 469 2016

isprs archives XLI B8 469 2016

rapid decline of about 11% per decade of the perennial ice cover in the Arctic. Such decline has been a concern because the perennial ice (or ice that survives the summer melt) in the Arctic has been around and observed in situ for at least 1450 years (Kinnard et al., 2011). The loss of the coverage of the perennial ice has caused a general warming of the region, mainly through ice-albedo feedback, that in turn has led in part to the thawing of the permafrost, melt of glaciers, retreat of snow covered areas, the loss of mass of the Greenland ice sheet, and the greening of the Arctic (Comiso and Hall, 2014; Bhatt et al., 2013; Luthche et al., 2006; Zwally et al., 2002). Since the continuation of the loss of all these various components of the cryosphere could lead to more serious if not irreversible consequences it is critical that more research is done on the variability of the sea ice cover and related variables. It is also important to look at these changes from a global perspective since the trend in the ice cover in the Antarctic is going the opposite ways (Cavalieri et al., 1997). Such asymmetry has been postulated to be caused by various factors including the increase in snow precipitation in the Antarctic, the freshening of water in the region due to increases in the melt of ice shelves (Jacobs, 2006) and the occurrence of the ozone hole that tended to cause a deepening of the lows in the West Antarctic region (Turner et al., 2009). In this study, changes in the sea ice cover, using a sea ice data set that has been enhanced for better consistency and updated for improved statistics, has been evaluated in conjunction with observed changes in surface temperature to gain insight into the phenomenon and improved understanding of the state and future of the sea ice cover.
Baca lebih lanjut

11 Baca lebih lajut

Conference paper

Conference paper

Antarctic sea ice sheets play an important role in modulating the climate system. The present study investigates the dynamics of melt/freeze over Amery and Ross ice shelf located in Eastern and Southern part of continent using OSCAT, the microwave scatterometer data from OCEANSAT2. The study utilizes the sensitivity of backscatter coefficient values of scatterometer data to presence of liquid water in the snow caused due to melt conditions. The analysis carried out for four austral winters from 2010-2013 and five austral summer from 2009-2014 showed spatial and temporal variations in average backscatter coefficient over Amery and Ross shelf areas. A dynamic threshold based on the austral winter mean and standard deviation of HH polarization is considered for pixel by pixel analysis for the shelf area. There is significant spatio-temporal variability in melt extent, duration and melt index as observed in the analysis. Spatially, the melt over Amery shelf moves from South to North along coast and West towards inner shelf area. Maximum mean melt occurs on 9 th January with January1-15 fortnight accounting for 80% of the melt. Extreme low melt conditions were observed during summer 2010-11 and 2011-12 indicating cold summer. Summer 2012-13 and 2013-14 were warm summer. Year 2014 experienced melt only in the month of January with entire shelf under melt conditions. Practically no melt was observed over Ross ice shelf.
Baca lebih lanjut

5 Baca lebih lajut

Directory UMM :Data Elmu:jurnal:A:Atmospheric Research:Vol52.Issue1-2.Aug1999:

Directory UMM :Data Elmu:jurnal:A:Atmospheric Research:Vol52.Issue1-2.Aug1999:

Antarctic data has the best properties but does depend nonlinearly on total cloud amount. This nonlinearity is crucial since cloud distributions are U-shaped while common sources of cloud data tabulate only mean monthly values. Lastly, we therefore use a one-dimensional sea ice model to investigate how methods of averaging cloud amounts affect predicted sea ice thickness in the context of the five long-wave radiation parameterizations. Here, too, Konig-Langlo and Augstein’s ¨ formula performs best, and using daily averaged cloud data yields more realistic results than using monthly averaged cloud data that have been interpolated to daily values. q 1999 Elsevier Science B.V. All rights reserved.
Baca lebih lanjut

37 Baca lebih lajut

Biological Activities of Ethanolic Extracts from Deep-Sea Antarctic Marine Sponges

Biological Activities of Ethanolic Extracts from Deep-Sea Antarctic Marine Sponges

antibacterial activities were also assayed against the following characterized strains of different origins: (1) laboratory strains: E. coli HB101, Bacillus subtilis EXB-V68, Enterobacter EXB-V11, P. aeruginosa EXB-V28 and Staphylococcus epidermidis EXB-V55; (2) commensal isolates from dog skin: S. aureus 10F, Macrococcus 1F, Micrococcus 2F and Acinetobacter 1C; (3) a food isolate: Listeria monocytogenes; and (4) clinical isolates: methicillin-resistant S. aureus (MRSA) S-943, methicillin-resistant Staphylococcus pseudintermedius (MRSP) S-053 and S-043 ESBL-producing E. coli 206 (CTX-M-1 group; ST131), ESBL-E. coli 192 (CTX-M-9; ST131), ESBL-E. coli 30 (CTX-M-2), carbapenemase producing (KPC) Klebsiella pneumoniae, P. aeruginosa 06131 and P. aeruginosa 8591. The strains were obtained from the EX (extremophilic microorganisms) and GM (genetic laboratory microbes) culture collections of the Chair of Molecular Genetics and Microbiology of the Biotechnical Faculty and of the Institute of Microbiology and Parasitology, Veterinary Faculty, University of Ljubljana, Slovenia. The precultured bacteria (laboratory, commensal and clinically relevant strains and strains isolated from Arctic ice) were grown in LB broth (Sigma, USA) and were used for the inoculation of Luria broth agar plates, to a final cell concentration of 5 × 10 8 /mL. Four holes of 1 cm in diameter were made in the agar of each agar plate, which were then filled with 100 μL of an ethanolic extract. Ethanol was tested for its antimicrobial activity (100 μL) as a control. The inhibition zone for each sample was determined after overnight incubation of the plates at 37 °C. The plates containing the bacteria isolated from Arctic ice were incubated at 22 °C. The extracts showing the highest inhibition of bacterial growth were further diluted with ethanol and used to determine the minimal inhibitory concentrations (MICs), which were defined as the lowes t concentrations in μg/mL that inhibited the growth of tested microorganism 1 mm from the rim of the hole. All of the laboratory, commensal and clinical bacterial strains were also assayed with standard antibiotics (tetracycline, kanamycin, rifampicin, ampicillin and chloramphenicol; Supplementary Table S2). The marine bacteria were precultured in liquid medium prepared by dissolving 5 g peptone and 1 g yeast extract in 1 L of aqueous solution of MgCl 2 ·6H 2 O (10 mM) and NaCl (300 mM). Agar plates containing this liquid
Baca lebih lanjut

14 Baca lebih lajut

isprs archives XLI B8 459 2016

isprs archives XLI B8 459 2016

Among the various analysis techniques designed to utilize time series remotely sensed data, temporal mixture analysis (TMA), which is an extension of the spectral mixture analysis (SMA) of multispectral or hyperspectral remote sensing images, is receiving increased attention for use in summarizing and analyzing long-term time series data. TMA provides seasonal characteristics of univariate information such as SIC as well as a unique summary of long-term time series (Piwowar et al., 1998, Chi et al., 2016). In addition to sea ice studies, TMA has been applied to various applications in agriculture and urban studies A recent study conducted by Chi et al. (2016) analyzed long-term Antarctic daily SICs using machine learning-based TMA techniques. The authors examined hypertemporal SIC data without incorporating prior knowledge of seasonal sea ice signatures. Representative temporal endmembers were extracted from 36 years of daily SIC data and were then used to compute corresponding fractional abundances of each temporal endmember component. In this study, we propose a novel approach of forecasting daily SIC for the present year (2014) using TMA results derived from previous years (1979-2013) reported in Chi et al. (2016) and using time series analysis models.
Baca lebih lanjut

4 Baca lebih lajut

isprs archives XLI B8 545 2016

isprs archives XLI B8 545 2016

The majority of Antarctica’s mass loss to the ocean occurs through its ice shelves via iceberg calving and basal melting (Depoorter at al., 2013; Rignot et al., 2013). Regional and global changes in atmospheric and oceanic conditions through ice-ocean and ice-atmosphere interactions may lead to iceberg calving or ice shelf basal melt. Meanwhile, the seaward motion of the ice front may occur at a speed at least a few hundred meters per year (Rignot et al., 2011). Although mass change in ice shelves have little or no direct effect on global sea level as the ice shelves are already floating on the sea, they buttress the grounded ice upstream. Reduction of buttressing from ice shelves leads to acceleration of mass loss from ice sheet. Therefore, to accurately understand and study the impact of Antarctic ice mass balance, ice shelf is the important part that needs to be analysed. The ice-shelf thickness around the Antarctic was observed at the accelerating thinning status (Paolo et al., 2015). However, many researchers assume that the ice shelf has no areal extent change when calculate volume change or mass change of ice shelves, which increases the uncertainty of results (Liu et al., 2015). Coastlines generated from remote sensing data could used to predict and analyse iceberg calving and calculate area change of ice shelves and glaciers. Sequential mapping of ice shelf fronts provides a simple and direct method for measuring the area of Antarctic ice shelves. Analysis based on a long period should be more reliable since the ice front of ice shelf can change by kilometers in just a few weeks (Scambos et al., 2000). There are some commonly used methods to analyse ice-shelf change, such as changes in ice-shelf area, average front motion rate, motion rate along main flow lines (Kim, 2004; Ferrigno et al., 2006; Liu et al., 2015). Zwally et al. (2002) summarized mean annual barrier motion estimates obtained from slant-range analysis of ERS-1 and ERS-2 data from 1978 to 1988. Their barrier motion is estimated as the ratio between ice-shelf area change and the
Baca lebih lanjut

3 Baca lebih lajut

Usaha dan Bisnis Ekonomi Manajemen

Usaha dan Bisnis Ekonomi Manajemen

Disini saya membahas sedikit tentang salah satu food truck yaitu ice cream truck sebagai usaha yang menguntungkan secara ekonomi dan manajemen. Seperti kita ketahui bahwa ice cream sekarang bukan hanya diminati oleh anak kecil tetapi juga orang dewasa, varian rasa ice cream pun bermacam macam sehingga dapat di kreasikan seunik mungkin.

7 Baca lebih lajut

isprsarchives XL 7 W3 1049 2015

isprsarchives XL 7 W3 1049 2015

For the first image (2014/04/21), these ice types can also be discerned in the intensity images (see Figure 5, left hand side). The resulting ice chart matches the ice situation on the day before (according to the DMI ice report) quite well. In the open water portion, a low concentration of ice floes is depicted by the sparsely dispersed occurrences of ice in Figure 5. The iceberg detection algorithm automatically detects 3941 icebergs from the image. As can be seen in Figure 5 (on the bottom right) also within iceberg clusters and near to sea ice covered areas, icebergs become detected reliably due to the utilization of the iterative concept. In future work, the false alarm rate of the detector will be investigated.
Baca lebih lanjut

8 Baca lebih lajut

CONVENTION ON THE CONSERVATION OF ANTARTIC MARINE LIVING RESOURCES (CCAMLR)

CONVENTION ON THE CONSERVATION OF ANTARTIC MARINE LIVING RESOURCES (CCAMLR)

The making of the Nairobi Convention was designed to fill a gap in current framework of international law on marine pollution which particularly resulted from wrecks. The Nairobi Convention applies to the exclusive economic zone (EEZ) of the State Party, or to its area be- yond an adjacent to the territorial sea of that state if the said state party has not established any EEZ, and extending not more than 200 nautical miles from the baseline which the territorial sea is measured. However, the Nairobi Convention also provides an opt-in option whereby State Party may also make the convention applicable to their territorial seas and inland waters with notification to the Secretary-General.
Baca lebih lanjut

8 Baca lebih lajut

Isolation Of Anverene From The Antarctic Peninsula Red Algae (Plocamium Cartilaginium)

Isolation Of Anverene From The Antarctic Peninsula Red Algae (Plocamium Cartilaginium)

Investigations of macroalgae from polar waters surrounding Antarctica have focused largely on red algae but include several studies of brown algae Amsler et al., 2001... Isolation of An[r]

3 Baca lebih lajut

ICE CREAM PARE ENAK DI LIDAH SERTA BERNILAI GIZI TINGGI.

ICE CREAM PARE ENAK DI LIDAH SERTA BERNILAI GIZI TINGGI.

Pare atau paria merupakan salah satu jenis sayuran yang tidak memiliki banyak penggemar. Hanya sedikit orang yang menyukai buah pare. Karena rasanya yang memang pahit. Dari rasa yang pahit itu ,maka tergugahlah untuk mengolah buah pare menjadi suatu makanan yang dapat diterima masyarakat dan juga digemari oleh semua kalangan yaitu dengan mengubahnya menjadi Ice Cream Pare. Agar dalam pikiran masyarakat pare bukanlah sesuatu yang mengerikan karena rasanya yang tidak enak. Sebagai mahasiswa sangat tidak mungkin jika harus terjun langsung sebagai pelaku usaha tersebut, tetapi hanya akan menampung pare yang sudah menjadi Ice Cream, dengan pengolahan Ice Creamnya atas pengarahan dari kami, sehingga kami hanya akan melakukan pengepakan dan pemberian label serta nama produk pada kemasan tersebut.
Baca lebih lanjut

12 Baca lebih lajut

isprs annals III 2 99 2016

isprs annals III 2 99 2016

This paper provides a new method to characterize the spatial structures of sea ice in SAR intensity imagery. The sea ice spatial structures are modeled as a weighted linear combination of two stochastic models: a Poisson line mosaic model and a multi-Gamma model. Then two kinds of geostatistic metrics are defined to describe the image spatial structures. By the experiment, we first compared the theoretical variograms with different values of parameters and found that each of the two different variograms have their own advantages in discriminating different spatial structures. Then the proposed method was applied to the simulated images and RARDARSAT-1 images. Through comparing the parameters estimated from the mixture model with the sea ice information obtaining from egg code, we found that two parameters (concentration and floe size) of sea ice can be retrieved from the mixture model.
Baca lebih lanjut

10 Baca lebih lajut

isprs archives XLI B8 463 2016

isprs archives XLI B8 463 2016

In this study, authors have developed an algorithm to extract thin ice area using brightness temperature scatter plots of AMSR2 19GHz polarization difference (V-H) vs 19GHz V polarization. The extracted thin sea ice areas were validated by comparing with simultaneously observed MODIS images. The most of the thin ice areas identified in MODIS images were automatically extracted with this algorithm. The authors have processed total of 6 scenes for the Sea of Okhotsk with this algorithm. The result suggested the effectiveness of the algorithm. This new algorithm is now considered as the algorithm for producing the Thin Ice dataset for the Sea of Okhotsk as one of GCOM-W Research Products. Since the heat flux of ice is strongly affected by the ice thickness differences, this product may contribute to the imporvement of the heat flux calculation over the sea ice area.
Baca lebih lanjut

6 Baca lebih lajut

Institutional Repository | Satya Wacana Christian University: Voice of Nature (Resital Vokal) T1 852010026 BAB I

Institutional Repository | Satya Wacana Christian University: Voice of Nature (Resital Vokal) T1 852010026 BAB I

Beberapa karya dari Roger Quilter yang akan dibawakan pada resital vokal ini, yaitu: “The Sea Bird”, “Moonlight”, dan “By The Sea”. “The Sea Bird” menggambarkan seekor burung laut yang sedang terbang menyusuri pinggir pantai yang dingin. Ia terbang melayang-layang saat matahari mulai terbenam. Selanjutnya adalah “Moonlight”, lagu ini bertempo lebih cepat dari lagu sebelumnya. Lagu ini bercerita tentang seseorang yang sedang menikmati malamnya di bawah sinar bulan. Angin yang berbisik membuainya, ia menjadi hanyut dalam suasana malam itu. Lagu yang ketiga yakni “By The Sea”. Lagu ketiga dari siklus (songcycle) yang berjudul “ Three Song of The Sea ” ini menggambarkan tentang seseorang yang sedang berada di tengah berkilauan, mengagumi indahnya lampu-lampu di sekitarnya yang gemerlapan indah. Ombak dan angin yang bergulung-gulung menutupi dosa- dosanya, membuat dia merasa penuh.
Baca lebih lanjut

7 Baca lebih lajut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Identifikasi, patogenisitas bakteri dan pemanfaatan gen 16S rRNA untuk deteksi penyakit ice ice pada budidaya rumput laut

Pengelolaan budidaya rumput laut yang sehat dan bebas penyakit ice-ice merupakan komponen penting dalam peningkatan produksi rumput laut. Untuk mendukung pengendalian terpadu penyakit ice-ice pada budidaya rumput laut diperlukan informasi variasi genetik bakteri patogen dan penyediaan deteksi secara cepat dan akurat. Kajian yang dilakukan bertujuan untuk mengidentifikasi bakteri patogen berdasarkan hasil analisis sekuen gen 16S-rRNA, mengkonstruksi primer PCR spesifik dari sekuen gen 16S-rRNA dari bakteri yang memiliki tingkat patogenisitas tertinggi. Gen 16S-rRNA bakteri yang memberikan tingkat patogenisitas tertinggi diamplifikasi dengan primer PCR universal domain bakteri forward primer 63f (5’-CAG GCC TAA CAC ATG CAA GTC-3’) dan reverse primer 1387r (5’-GGG CGG WGT GTA CAA GGC-3’). Hasil sekuensing DNA dibandingkan dengan data base European Bioinformatics Institute (EBI) BLASTN. Perancangan dan analisis kelayakan pasangan primer yang diperoleh dilakukan dengan menggunakan program Primer 3. Dua primer spesifik PCR berhasil dirancang yakni aSEFM-F (5- CAGCCACACTGGAACTGAGA -3) dan aSEFM-R (5- TTAGCCGGTGCTTCTTCTGT -3). Kedua primer ini bereaksi optimum pada suhu 60 o C dengan yang menghasilkan amplikon berukuran 201 bp.
Baca lebih lanjut

152 Baca lebih lajut

Analisis Perbandingan Perceived Quality Ice Cream Stormy Plate Dengan Ice Cream Lainnya.

Analisis Perbandingan Perceived Quality Ice Cream Stormy Plate Dengan Ice Cream Lainnya.

3. Persepsi konsumen tentang ice cream Stormy Plate yaitu harga ice cream paling murah dibanding dengan Baskin & Robbins dan Pisseta. Persepsi ini dapat muncul dikarenakan Stormy Plate mengusung motto yaitu “LESS THAN GOCENG, MAN” dan “GOCENG IS MY LIFE”. Tindakan yang harus dilakukan oleh Stormy Plate agar kenaikan harga ice cream tersebut tidak berdampak pada penurunan penjualan adalah :

55 Baca lebih lajut

sea besscienceexesum2016julyrevised

sea besscienceexesum2016julyrevised

The developmen t of an understanding of science is important for students in today’s world if they are to become citizens who can make informed decisions about themselves and the world in which they live. Students are faced with a myriad of information, and sifting fact from fiction and understanding the scientific basis of important social, economic, and environmental issues is possible only if they have the tools to accomplish this. Students’ understanding of science should build throughout their schooling so that when they become adults they are able to act from a sound basis decisions when faced with diverse issues such as treatment of diseases, climate change, and the applications of technology. Across the world, there is an increased demand for those qualified to pursue the careers in science, technology, and engineering that dive the innovation and invention necessary for economic growth and improving the quality of life. To meet this demand, the SEA-BES Common Core Regional Learning Standards in Science Framework is developed under the analysis of national curriculum in SEAMEO Member Countries.
Baca lebih lanjut

20 Baca lebih lajut

ICE BREAKING REFLEKTIF DAN

ICE BREAKING REFLEKTIF DAN

You will experience a painful sharpening from time to time, by going through various problems, but you'll need it to become a stronger person.. You will experience a painful..[r]

14 Baca lebih lajut

ICE BREAKING REFLEKTIF AKU

ICE BREAKING REFLEKTIF AKU

• Anak-anak yatim, Parmin, mbok Darmi, Anak-anak yatim, Parmin, mbok Darmi, pengemis tua, murid-murid pengajian, pengemis tua, murid-murid pengajian, jamaah masjid dan banyak lagi j[r]

13 Baca lebih lajut

Show all 1720 documents...